Beacon Designer

5.10
Manual
PREMIER
Biosoft International
3786 Corina Way,

Palo Alto, CA 94303-4504

Tel: 650-856-2703

FAX: 650-618-1773

E-mail: [email protected]
Copyright © 2006 by PREMIER Biosoft International. All Rights Reserved.
Information in this manual may change without notice and does not represent a commitment on
the part of PREMIER Biosoft International.
The software described in this manual is provided by PREMIER Biosoft International under a
License Agreement. The software may be used only in accordance with the terms of the
agreement.
PREMIER Biosoft International ("Premier") claims copyright to this program and documentation
as an unpublished work. Claim of copyright does not imply waiver of Premier's other rights.
This program and documentation are confidential and the property of Premier. Use, examination,
reproduction, copying, decompilation, transfer, and/or disclosure to others are strictly prohibited
except by express written agreement with Premier.
For more information on Beacon Designer and product updates, visit the PREMIER Biosoft web
site at http://www.PremierBiosoft.com

ii
Beacon Designer 5.10

INTRODUCTION .................................................................................................. 1

WORKING ENVIRONMENT ................................................................................ 4

Menus and Toolbar....................................................................................................................... 4
Main Window .............................................................................................................................. 14
Primer Search Parameters for Standard Real Time PCR.......................................................... 17
Primer Search Parameters for NASBA(R) Assay ....................................................................... 19
Beacon Search Parameters ....................................................................................................... 21
TaqMan (R) Probe Search Parameters....................................................................................... 22
Multiplex Search Parameters for Taqman® Assay .................................................................... 24
LNA(TM) Substituted TaqMan (R) Probe Search Parameters .................................................... 27
Multiplex Search Parameters for LNA(TM) substituted Taqman(R) Assay ................................. 29
FRET Probes Search Parameters.............................................................................................. 32
SYBR (R) Green Primer Search Parameters.............................................................................. 34
BLAST Search Parameters ........................................................................................................ 36
Template Structures Search....................................................................................................... 41
View Cross Homology ................................................................................................................ 42
View Secondary Structures ........................................................................................................ 43
Multiplex Results ........................................................................................................................ 44

TUTORIAL ......................................................................................................... 44
Create and Manage a Project .......................................................................................45
Create a New Project ................................................................................................................. 45
Open Project............................................................................................................................... 45
Close Project .............................................................................................................................. 46
Save Project As .......................................................................................................................... 46
Save Sequence As ..................................................................................................................... 46
Open Sequence .............................................................................................................47
Open Sequence from Entrez......................................................................................................47
Open Sequence from dbSNP.....................................................................................................47
Open Sequence from File .......................................................................................................... 47
Add Text Sequence .................................................................................................................... 48
Load Multiple SNP.........................................................................................................49
Load Unpublished SNP information ........................................................................................... 49
Search Sequence ..........................................................................................................51

Avoid Cross Homology ................................................................................................52

Set Parameters for BLAST Search ............................................................................................ 52
Interpreting Human BLAST Results ........................................................................................... 55
Interpreting Microbial BLAST Results ........................................................................................ 56
Interpreting Cross Homology Results......................................................................................... 57
Avoid Template Structures ..........................................................................................58

Beacon Design ..............................................................................................................59

Parameters for Primer Design.................................................................................................... 59
Primer Search Results ............................................................................................................... 61

i
Beacon Designer 5.10

Evaluate Primers ...........................................................................................................63

Evaluate Primers ........................................................................................................................ 63
Multiplex Results ........................................................................................................................ 64
Design Beacons ............................................................................................................65
Parameters for Beacon Design .................................................................................................. 65
Beacon Search Results.............................................................................................................. 66
Evaluate Beacon ...........................................................................................................67
Evaluate Beacon ........................................................................................................................ 67
Multiplex Beacons ...................................................................................................................... 68
Nucleic Acid Sequence Based Amplification PCR.....................................................69
Design Primers for NASBA(R) .................................................................................................... 69
NASBA(R) Primers Search Result .............................................................................................. 71
Evaluate Primers ...........................................................................................................73
Evaluate NASBA(R) Primers....................................................................................................... 73
Multiplex NASBA(R) Primers....................................................................................................... 74
Design Beacons For NASBA(R) ....................................................................................75
Parameters for NASBA(R) Beacon Design................................................................................. 75
NASBA(R) Beacon Search Results............................................................................................. 76
Evaluate Beacons For NASBA(R) ................................................................................77
Evaluate Beacons For NASBA(R) ............................................................................................... 77
Multiplex Beacons For NASBA(R)............................................................................................... 79
TaqMan(R) Design.........................................................................................................80
Parameters for TaqMan(R) Probe Design .................................................................................. 80
TaqMan(R) Probe Search Results .............................................................................................. 82
Evaluate TaqMan (R) Probes........................................................................................83
Evaluate TaqMan (R) probes ...................................................................................................... 83
Multiplex TaqMan(R) ................................................................................................................... 84
Multiplex Taqman Assay ..............................................................................................85
Design TaqMan probes and primers for multiplex assay ........................................................... 85
Multiplex TaqMan(R) and Primer for Reference gene multiplexing ............................................ 88
Multiplex Taqman Set Search results......................................................................................... 90
LNA(TM) Substituted TaqMan(R) Assay.......................................................................91
Design LNA(TM) Substituted TaqMan ........................................................................................ 91
LNA(TM) Substituted TaqMan(R) Search Results....................................................................... 93
Evaluate LNA(TM) Substituted TaqMan (R) ...................................................................95
Evaluate LNA(TM) Substitued TaqMan (R) ................................................................................. 95
Multiplex LNA(TM) Substituted TaqMan (R) Probes.................................................................... 97
Multiplex LNA(TM) Substituted Taqman Assay ...........................................................98
Design LNA(TM) Substituted TaqMan probes and primers for multiplex assay......................... 98

ii
Beacon Designer 5.10

Design LNA(TM) Substituted TaqMan probes and primers for Reference Gene Multiplexing ... 99
Multiplex Taqman Set Search results....................................................................................... 101
FRET Probe Design.....................................................................................................102
Design FRET Probes Parameters for FRET Probe Design ................................................... 102
FRET Probe Search Results .................................................................................................... 104
Evaluate FRET Probes................................................................................................105
Evaluate FRET Probes............................................................................................................. 105
Multiplex FRET Probes ............................................................................................................ 106
SYBR (R) Green Primers Design ...............................................................................107
Parameters for Primer Design.................................................................................................. 107
Primer Search Results ............................................................................................................. 109
Evaluate Primers .........................................................................................................110
Evaluate Primers ...................................................................................................................... 110
Generate Report ..........................................................................................................111
Generate Report....................................................................................................................... 111
Print Preview ............................................................................................................................ 113
Export Results.............................................................................................................114
Export Beacon Search Results ................................................................................................ 114
Export TaqMan(R) Probes Result ............................................................................................. 115
FRET Probes Result Export ..................................................................................................... 116
SYBR (R) Green primers Result Export .................................................................................... 117
Export Multiplex Set.................................................................................................................. 118

PREFERENCES............................................................................................... 119
Reaction Conditions ................................................................................................................. 119

TECHNICAL INFORMATION........................................................................... 119

Internet Setting ......................................................................................................................... 120
Automatic Product Upgrade ..................................................................................................... 121
Standalone WWW BLAST for Linux ..........................................................................122
Install RedHat Linux Server...................................................................................................... 123
Setup Firewall........................................................................................................................... 124
Setup Apache webserver .........................................................................................................125
Download BLAST Binaries ....................................................................................................... 126
Setup Standalone WWW BLAST Server for Linux................................................................... 128
Format Databases .................................................................................................................... 130
Configuration Files.................................................................................................................... 132
System Requirements .............................................................................................................. 133
Troubleshooting........................................................................................................................ 134
Standalone WWW BLAST for Mac .............................................................................137
Download Blast Binaries for Mac ............................................................................................. 138
Install Standalone WWW BLAST Server for Mac .................................................................... 139
Setup Standalone WWW BLAST Server for Mac .................................................................... 140
Format Databases for Mac.......................................................................................................142
Configuration Files for Mac ...................................................................................................... 145

iii
Beacon Designer 5.10

System Requirements for Mac ................................................................................................. 146

Troubleshooting for Mac........................................................................................................... 147
Algorithm and Formulae.............................................................................................149
Formula for Melting Temperature Calculation.......................................................................... 149
Melting Temperature Calculation For LNA(TM) Probes............................................................ 152
Formula for Calculating TaOpt ................................................................................................. 155
Formula for Free Energy .......................................................................................................... 156
Formula for Rating.................................................................................................................... 157
Appendix......................................................................................................................159
Primer Design Guidelines For NASBA(R) ................................................................................. 159
Beacon Design Guidelines .......................................................................................................160
TaqMan(R) Design Guidelines .................................................................................................. 162
LNA(TM) Substituted TaqMan(R) Design Guidelines ................................................................ 163
FRET probe Design Guidelines................................................................................................ 164
SYBR (R) Green Primer Design Guidelines.............................................................................. 165
Glossary ................................................................................................................................... 166
System Specifications ................................................................................................169

Software Limits ...........................................................................................................170

Terms of Use ...............................................................................................................175

References...................................................................................................................177

iv
Beacon Designer 5.10 Introduction

Introduction
Beacon Designer designs Molecular Beacons for Standard Real Time PCR and Nucleic Acid
Sequence Based Amplification(R), TaqMan(R), LNA(TM) Substituted TaqMan, FRET probes and
SYBR (R) Green primers for real time detection of PCR products. Beacon Designer provides the
following major functionality:

Beacon Design

Automatic Tm adjustment - automatically selects staem of appropriate length for optimal beacon
Tm.

Optimal beacons - designs molecular beacons free of dimers, repeats, and runs for increased
signal strength.

Allele discrimination - designs molecular beacons for detection of both wild and mutant alleles.

Multiplex beacons and primers - checks molecular beacons for cross homologies with all
primers preventing competition in multiplex reactions.

Evaluate pre-designed Beacons - allows use of previously designed beacons as a base for
searching primers/beacons on other targets for multiplexing.

Tm calculation - highly accurate hairpin Tmcalculation by connecting to the mfold server.

Lightning fast - processes average cDNA sequence in under a second.

Graphical view - displays graphical view of the designed beacon.

TaqMan(R) probe
(R)
TaqMan(R) probes - designs optimal TaqMan probes free of dimers, repeats, and runs to
ensure signal fidelity.

Multiplex TaqMan(R) and primers - supports multiplexing for up to four sequences, checks for
cross homologies with all probes and primers preventing competition in multiplex reactions.

Evaluate pre-designed TaqMan(R) probes and Primers - allows use of SYBR (R) green assay
(R)
primers to design optimum TaqMan probes.

Algorithm - calculates Tmusing highly accurate SantaLucia nearest neighbor thermodynamic

values.

Graphical view - displays graphical view of probe secondary structures.

LNA(TM) Substituted TaqMan(R) Probes:

(R)
LNA(TM) Substituted TaqMan(R) probes - designs optimal LNA(TM) Substituted TaqMan
probes of small length and high Tm, free of dimers, repeats, and runs to ensure signal fidelity.

Multiplex LNA(TM) Substituted TaqMan(R) Probes and primers - supports multiplexing for up to
four sequences, checks for cross homologies with all probes and primers preventing competition
in multiplex reactions.

Evaluate pre-designed LNA(TM) Substituted TaqMan(R) probes and Primers - allows use of
(R) (R)
SYBR green assay primers to design optimum LNA(TM) Substituted TaqMan probes.

1
Beacon Designer 5.10 Introduction

Algorithm - calculates Tmusing highly accurate correction values given by Dr. Raymond Peterson
and then added to SantaLucia nearest neighbor thermodynamic values.

Graphical view - displays graphical view of probe secondary structures.

FRET Probes

FRET probes - designs optimal FRET probes free of dimers, repeats, and runs to ensure signal
fidelity.

Multiplex FRET probes and primers - checks FRET probes for cross homologies with all
primers preventing competition in multiplex reactions.
(R)
Evaluate pre-designed FRET probes and Primers - allows the use of SYBR green primers to
design optimum FRET probes.

Algorithm - calculates the Tm using highly accurate SantaLucia nearest neighbor

thermodynamic values.

Graphical view - displays graphical view of probe secondary structures.

Primer Design
(R) (R)
Design primers - designs primer pairs optimized for SYBR Green/ beacon/ TaqMan / FRET
applications.

Algorithm - calculates Primer Tmusing highly accurate SantaLucia nearest neighbor

thermodynamic values.

Primer rating - primers ranked as per their priming efficiency.

Comprehensive criteria - primers are screened for their thermodynamic properties as well as
secondary structures.

Automatic Primer Multiplexing - pools of primers are checked for cross homologies to reduce
primer dimer.
(R)
Pre-designed primers - allows the use of previously designed primers for beacon, TaqMan ,
(R)
FRET and SYBR Green assays.

Avoid template secondary structures - automatically avoids secondary structures in the

template while designing primers.

Avoid cross homology - ensures signal fidelity by automatically avoiding homologies found
using BLAST.

Primer amplicon and probe BLAST search - BLAST searches primers, amplicon and probes to
verify specificity of the design.

SNP amplification Primers for beacon, TaqMan(R) and FRET chemistries are designed to amplify
SNPs. SYBR (R) Green primers are designed so that the nucleotide that distinguishes the alleles
is at the 3' terminal base of one of the primers.

Uniform conditions - all primers in a run are optimized for identical reaction conditions for PCR.

BLAST Search

2
Beacon Designer 5.10

BLAST search - BLAST search the entire sequence, designed primers and amplicon to visualize
specificity.

BLAST databases - searches local custom databases using stand-alone BLAST or connects
directly to the NCBI server for public databases.

Repeat and low complexity regions - BLAST search parameters are optimized to detect
repeats and low complexity regions while searching the genomic databases available at NCBI.

BLAST result view - provides result view for BLAST searched on the sequence, primer-pair,
amplicon and probe.

Database and Data Management

Design modes - Beacon and TaqMan(R) design are in different modules: Allows mode switching
at run time.

Projects - creates multiple projects.Data of multiple experiments can be easily managed by

creating separate project for each experiment.

Application Database - maintains a local database for sequence information and search results.

Web Integration

Web Integration - batches of sequences can be quickly retrieved from Entrez using accession
numbers and from dbSNP using assay IDs.

BLAST search - integrated BLAST search of any loaded sequence. Local customized databases
can also be searched using the Standalone WWW BLAST service from NCBI.

Beacon and Template Secondary Structure Search - integrated with the Quikfold server to
view the possible secondary structures at folding temperature. These structures are avoided in
probe and primer design.

Input/Output

Online sequence retrieval - automatically connects to Entrez or dbSNP and retrieves multiple
sequences.

File formats - supports GenBank, FASTA, and db SNP formats. GenBank and FASTA formatted
files can contain multiple sequences.

SNP loading - easily adds SNP(s) at a time on a single sequence or load thousands of SNPs
using standard GenBank variation files.

View output in spreadsheet - results can be viewed and manipulated in any spreadsheet
program like MS Excel and Lotus123.

Flexible output format - tab delimited format of the output file can be easily loaded into any
database.

3
Beacon Designer 5.10 Working Environment

Working Environment

Menus and Toolbar

The Beacon Designer toolbar is displayed at the top of the main window under the menu bar. It
provides shortcut buttons for the following menu commands. The toolbar options can also be
accessed from pop-up menu at right click (For Macintosh, CTRL+click) over the Sequence
Information tab and Search Status tab.

Menus

The main menu bar is at the top of the main window.

Menu Toolbar Hot Keys Hot keys Description

(For windows) (For MAC)

Beacon Program version and

Designer PREMIER Biosoft contact
information

About Beacon
Designer

Quit Beacon
Designer

File Menu Alt+F

New

New Project Ctrl+N Create a new project to

+N manage the data of every
new design project.

New Sequence Ctrl+E Add a text sequence from

+E any other application by
cutting and pasting the
sequence bases or by
manually typing the
sequence in the
Sequence window.

Open

4
Beacon Designer 5.10 Working Environment

Project Ctrl+O Open to work on an

+O existing project.

Sequence:

From File Ctrl+L Retrieve one Single or

+L multiple more sequences
from a local file. (must be
in FASTA or GenBank
format )

From Entrez Ctrl+G Retrieve one or more

+G sequences from Entrez.
Program interprets the
SNP information in the
header and displays it

From dbSNP Ctrl+S Retrieve one or more

+S sequences from dbSNP

Save Project Save the existing project

As with different file name at
specified location

Save Save the existing

Sequence As sequence with different
name within the project

Close Project Close and save the

current project.

Export Exports the primer and

probe search results in a
tab delimited spread sheet
format file type(.xls,.csv).

Export Beacon Ctrl+Alt+E Launch Export Results

Results Alt+E window for beacon search
result export.

Export Ctrl+Alt+E Launch Export Results

TaqMan® +Alt+E window for TaqMan®
Results search result export.

Export Ctrl+Alt+E Launch Export Results

Multiplex +Alt+E window for Multiplex
Results Search result export

5
Beacon Designer 5.10 Working Environment

Export FRET Ctrl+Alt+E Launch Export Results

Results +Alt+E window for FRET search
result export.

Export SYBR® Ctrl+Alt+E Launch Export Results

Green Results +Alt+E window for SYBR® Green
search result export.

Report Export the design results

in a report format that can
be printed.

Generate The user may select the

Report data that needs to be
included in the report by
checking or un-checking
the boxes of the
corresponding fields.

Exit Saves active working

project and terminates
program.

Edit Menu Alt+E

Copy

Sense Primer Ctrl+Shift+E Copy the Sense Primer of

+Shift+E the selected sequence to
the clipboard.

Antisense Ctrl+Shift+A Copy the Anti-sense

Primer +Shift+A Primer of the selected
sequence to the clipboard.

P2 Primer Ctrl+Shift+E Copy the P2 Primer of the

(In case of +Shift+E selected sequence to the
NASBA clipboard.
Primers)

P1 Primer Ctrl+Shift+E Copy the P1Primer along

(In case of +Shift+A with Tag of the selected
NASBA sequence to the clipboard.
Primers)

Beacon Ctrl+Shift+B Copy the Molecular

Sequence +Shift+B Beacon probe of the
selected sequence to the
clipboard.

6
Beacon Designer 5.10 Working Environment

TaqMan® Ctrl+Shift+T Copy the TaqMan® probe

Sequence +Shift + T of the selected sequence
to the clipboard.

FRET Ctrl+Shift+F Copy the FRET probe of

Sequence +Shift+F the selected sequence to
the clipboard.

Select All Ctrl+A Select all sequences in

+A the Sequence Information
tab.

Search Ctrl+F Search Sequences.

Sequence +F

Delete Delete selected

Sequence sequences in the
Sequence Information tab.

View Menu Alt+V

Sequence Ctrl+Alt+Q View selected sequence

Details +Alt+Q source file.

BLAST Details

Complete Ctrl+Shift+S View BLAST results

Sequence +Shift+S information for the
selected sequence.

Primer Pair Ctrl+Shift+P View BLAST results

+Shift+P information for the Primer
Pair.

Amplicon Ctrl+Shift+C View BLAST results

+Shift+C information for the
Amplicon.

Probe Ctrl+Shift+R View BLAST results

+Shift+R information for the Probe.

Template Ctrl+Alt+T View Secondary structure

Structure +Alt+T information for the
Details selected sequence.

Multiplex Ctrl+Shift+I Launch Multiplex Primers

Primers +Shift+I result window.(More than
one sequences should be

7
Beacon Designer 5.10 Working Environment

selected)

Multiplex Ctrl+Alt+B Launch Multiplex Beacons

Beacon +Alt+B result window in the
Beacon Mode.

Multiplex Ctrl+Alt+U Launch Multiplex

TaqMan® +Alt+U TaqMan® result window
in the TaqMan®Mode.

Multiplex FRET Ctrl + Alt + F Launch Multiplex FRET

probes + Alt + F results window in the
FRET Probes Mode.

Cross Ctrl+Alt+H View Cross-Homology

Homology +Alt+H results data interpreted
form the BLAST results
for the selected sequence.

All

Primer View All primers for the

selected sequence
ordered by descending
rating.

Probe View All alternate probes

(Beacons / for the selected sequence
TaqMan®/ ordered by descending
FRET probes) rating.

All Structures

Primer View graphical displays of

primer secondary
structures for the selected
sequence.

Probe View graphical displays of

(Beacons / probe secondary
TaqMan®/ structures for the selected
FRET probes) sequence.

Sequence View Ctrl+Alt+Z Show/Hide Sequence

+Alt+Z View.

Base Per Block Shows either 3/10 bases

per block in the sequence.

8
Beacon Designer 5.10 Working Environment

Sequence Shows either

Strand Single/Double strand in
the sequence.

Tool bar Show/Hide Tool bar.

Status bar Show/Hide Status bar.

Analyze Menu Alt+A

Beacon Design
Mode

Primer Search

NASBA Ctrl+M Launch NASBA Primers

Primers +M selected, Primer Search
parameter window.

Ctrl+L Launch Standard Primers

Standard +L selected, Primer Search
Primers parameter window.

Evaluate
Primers

NASBA Ctrl+Alt+B Launch NASBA Primers

Primers +Alt+B selected in Evaluate
Primers window for
evaluating pre-designed
primer pair.

Standard Ctrl+Alt+P Launch Standard Primers

Primers +Alt+P selected in Evaluate
Primers window for
evaluating pre-designed
primer pair.

Beacon Search Ctrl+R Launch Standard Beacon

+R selected, Beacon Search
parameter window for
beacon search.

Evaluate Ctrl+Alt+R Launch Evalaute Beacons

Beacons +Alt+R window for evaluating pre-
designed molecular
Beacon.

9
Beacon Designer 5.10 Working Environment

Template Ctrl+T Launch Template

Structure +T Structure Search
Search parameter window for
Template secondary
structures search.

BLAST Search

Complete Ctrl+Alt+S Set parameters and

Sequence... +Alt+S launch BLAST Search for
selected sequences.

Primer Pair Ctrl+Alt+M Launch BLAST Search

+Alt+M Primer Pair window to
verify cross homology in
the designed primer pair.

Amplicon Ctrl+Alt+A Launch BLAST Search

+Alt+A Amplicon window to verify
cross homology in the
designed Amplicon.

Probe Ctrl+Alt+O Launch BLAST Search

+Alt+O Probe window to verify
cross homology in the
designed probe.

TaqMan®
Design Mode

TaqMan®
Search

LNA(TM)® Ctrl+U Launch LNA(TM)®

Substituted +U Substituted
selected
TaqMan® Search
parameter window.

Standard Ctrl+R Launch Standard

+R selected
TaqMan® Search
parameter window.

Multiplex
Search

Standard Ctrl+Alt+D Launch Standard

+Alt+D selected
Multiplex Search

10
Beacon Designer 5.10 Working Environment

parameter window.

LNA(TM)® Ctrl+Alt+L Launch LNA(TM)®

Substituted +Alt+L Substituted
selected
Multiplex Search
parameter window.

Evaluate
TaqMan®

LNA(TM)® Ctrl+Alt+L Launch LNA(TM)®

Substituted +Alt+L Substituted
selected, Evaluate
TaqMan® Search window.

Standard Ctrl+Alt+R Launch Standard

+Alt+R selected, Evaluate
TaqMan® Search window.

FRET Probes
Design Mode

FRET probe Ctrl + R Launch FRET Search

Search +R parameter window for
FRET probes search.

Evaluate FRET Ctrl + Alt + R Launch Evaluate FRET

probes + Alt + R window for evaluating pre-
designed FRET probes.

SYBR ® Green
Primer Design
Mode

SYBR® Green Ctrl + M Launch SYBR ® Green

Primer Search +M Search parameter window
for SYBR ® Green primer
search.

Evaluate Ctrl + Alt + P Launch Evaluate SYBR®

SYBR®Green +Alt + P Green window for
Primers evaluating pre-designed
primers.

Tools Menu Alt+T

Reaction Set reaction conditions for

11
Beacon Designer 5.10 Working Environment

Conditions primer design.

SNP Add or Delete SNP

information

Add Ctrl+Shift+N Launch window for adding

+Shift+N SNP information to the
selected sequence.

Delete Ctrl+Shift+D Delete SNP information.

+Shift+D

Online Menu Alt+O

Entrez Home Launch the Entrez home

page in default browser.

Internet Set up Internet proxy

Settings server.

Assays Alt+N Switch between Beacon /

TaqMan® / FRET /
SYBR® Green Design
modes.

Beacon Design Switch to Beacon Design

mode.

TaqMan® Switch to TaqMan®

Design Design mode.

FRET probes Switch to FRET Probes

Design Design mode.

SYBR® Green Switch to SYBR® Green

Primer Design Design mode.

Help Menu Alt+H

Contents F1 View online help for

Beacon Designer.

Online Open an online tutorial.

Tutorial

Check Automatically detects for

Upgrades availability of a free
program upgrade and
installs it on your

12
Beacon Designer 5.10 Working Environment

computer.

PREMIER Open PREMIER Biosoft

Biosoft home home page in your
page browser.

Request Open an online form to

Feature request any new features
to serve your research
needs.

About Beacon Program version and

Designer PREMIER Biosoft contact
information.

Toolbar

Beacon Mode

TaqMan® Mode

FRET Probes Mode

SYBR® Green Mode

13
 Beacon Designer 5.10 Working Environment

Main Window
;

The main window displays the Sequence Information Tab, Search Status Tab, Sequence View
and the Search Results Tab.

Sequence Information Tab

The table allows you to select sequences probe and primer design, BLAST search, template
search and multiplexing. It displays the accession number, definition, and sequence length of all
the sequences within a project. Sequences can be sorted by accession numbers, definition, or
sequence length by clicking the respective column headers. You can also delete the selected
sequence(s).

Search Status Tab

For convenience, an overall view of the designed primer and probe quality is given in the Search
Status Tab at the end of each search.

The search status is displayed in their respective modes. Primer search, BLAST search, template
search and SNP status are common to all the modes.
For Beacon/TaqMan(R)/FRET probe search and primer search, the quality of the designed probe
and primer is displayed as Best, Good, Poor or Not Found. The probes and primers with the
rating greater than or equal to 75 are termed Best, those between 74 and 50 are termed Good,
and those with the rating below 50 are termed Poor. If no probes or primers are found that meet
the selected set of parameters "Not Found" is displayed in the search status. By clicking the
column header you can sort sequences by their quality. (Algorithm and Formulae)
Similarly the BLAST search status is displayed as "Complete" or "Not Found" on the basis of the
results returned from NCBI BLAST server. The Template structure search status is also displayed
as "Complete" or "Not Found"on the basis of the results returned from Quikfold server. The SNP
status for the sequence can be either "Selected" or "Not selected".

Sequence View

The Sequence View displays the nucleotide sequence. The selected sequence can be viewed as
3/10 bases per block. The sequence can be viewed in either as single stranded or double
stranded. The designed primers and probes are marked on the sequence .The sense primer is
marked in blue and the antisense primer is marked in red. The selected SNP position is also
marked in pink.

Result Display Tab

The detailed search results are displayed below the Sequence Information table. The result
display tabs include Beacon/TaqMan(R)/FRET probes/ SYBR (R) Green primers Properties tab,
BLAST Information tab and SNP Information tab.

Beacon Properties Tab

You can view the beacon and primer properties for a selected sequence under this tab.

The primer results include both sense and antisense primer rating, primer sequence, position,
length, melting temperature, GC%, maximum hairpin dG, maximum self dimer dG, repeat and run
length, optimum annealing temperature, maximum cross-dimer dG, product length and product
Tm. Apart from this you can also view primer secondary structures by clicking Secondary
Structures option from pop-up menu available at right click (For Mac, CTRL+click) over the

14
Beacon Designer 5.10 Working Environment

Primer Properties table or by selecting View>Secondary Structures>Primers. You can view the
alternate primer pairs for the selected sequence by clicking the All Primers button or by selecting
View>All>Primers.

The beacon properties include beacon rating, beacon sequence, position, length, beacon Tm,
probe Tm, alternate hairpin dG, self-dimer dG, cross-dimer dG, and a graphical view of the
beacon. You can view beacon secondary structures by clicking Secondary Structures option from
pop-up menu available at right click (For Mac, CTRL+click) over the Beacon Properties table or
by selecting View > Secondary Structures > Beacon. You can view the alternate beacons for
the selected sequence by clicking the All Beacons button or by selecting View > Alternate >
Beacon.

TaqMan(R) Properties Tab

(R)
You can view the TaqMan and the primers properties for a selected sequence under this
tab.The primer results include both sense and antisense primer rating, primer sequence, position,
length, melting temperature, GC%, maximum hairpin dG, maximum self dimer dG, repeat and run
length, optimum annealing temperature, maximum cross-dimer dG, product length and product
Tm. You can view primer secondary structures by clicking All Structures option from the pop-up
menu available at right click (For Mac, CTRL+click) over the Primer Properties table or by
selecting View > Alternate > Primers. You can view the alternate primer pairs for the selected
sequence by clicking the All Primers button or by selecting View > Alternate > Primers.

The TaqMan(R) properties include TaqMan(R) probe rating, sequence, position, length, Tm , % GC,
hairpin dG, self dimer dG, repeat and run length. You can view TaqMan(R) probe secondary
structures by clicking All Structures option from pop-up menu available at right click over (For
Macintosh, CTRL+click) the TaqMan(R) Properties table or by selecting View>All
Structures>TaqMan(R). You can view the alternate TaqMan(R) probes for the selected sequence
by clicking the All TaqMan(R) button or by selecting View>All>TaqMan(R).

FRET Probes Properties Tab

You can view the FRET probes and the primers properties for a selected sequence in this tab.
The primer results include both sense and antisense primer rating, primer sequence, position,
length, melting temperature, GC%, maximum hairpin dG, maximum self dimer dG, repeat and run
length, optimum annealing temperature, maximum cross-dimer dG, product length and product
Tm. You can view primer secondary structures by clicking the All Structures option from the
pop-up menu available with a right click (for Mac, CTRL+click) on the Primer Properties table or
by selecting the menuView > All > Primers. You can view the alternate primer pairs for the
selected sequence by clicking the All Primers button or by selecting the menu
View>All>Primers.

The FRET probes properties include individual FRET probe rating, sequence, position, length,
Tm , % GC, hairpin dG, self dimer dG, repeat and run length. You can view FRET probes
secondary structures by clicking All Structures option from the pop-up menu available with a
right click (for Macintosh, CTRL+click) on the FRET probes Properties table or by selecting the
menu View>All Structures>FRET probes. You can view the alternate FRET probes for the
selected sequence by clicking the All FRET probes button or by selecting the menu
View>All>FRET probes.

SYBR (R) Green Primers Properties Tab

You can view primer properties for a selected sequence in this tab. The primer results include
sense and antisense primer ratings, primer sequences, positions, lengths, melting temperatures,
GC%, maximum hairpin dG, maximum self dimer dG, repeat and run lengths, optimum annealing
temperature, maximum cross-dimer dG, product length and product Tm. You can also view
primer secondary structures by clicking All Structures button on the Primer Properties table or

15
Beacon Designer 5.10 Working Environment

by selecting the menu View>All>Primers. You can view the alternate primer pairs for the
selected sequence by clicking the All Primers button or by selecting the menu
View>All>Primers.

BLAST Information tab

The BLAST search information includes Genome and Database details against which BLAST
search was performed and the Search status of the BLAST search for the sequence, primer-pair
and amplicon. If there is any error in BLAST search or no significant cross homology is found a
"Not Found" status is displayed.

You can view the information about sequences showing significant cross homology with the
selected sequence by clicking the Cross-Homology button or by selecting View>Cross
Homology.

The BLAST results for a sequence against a database can be viewed in the Search Status tab or
by selecting View>BLAST Details. This will open the BLAST result page in your default browser.
The same information is available in the BLAST properties tab. The BLAST results for the primer
pair, the amplicon and the probe can be viewed in the search status in the BLAST properties tab.

SNP Information tab

You can view SNP information for the selected sequence in this tab. The SNP information
includes the SNP base position and the mutant nucleotide for all the SNPs on the sequence.

16
Beacon Designer 5.10 Working Environment

Primer Search Parameters for Standard Real Time PCR

Search Parameters;

The Primer Search Parameters window is launched when you select Analyze >Primer

Search>Standard or click button from the toolbar.

In the Beacon Design mode, the primer search parameters are defaulted to design primers
optimized for beacon applications. In the TaqMan(R) Design mode, the primer search parameters
are defaulted to design primers optimized for TaqMan(R) applications.

You can set parameters for primer search in this window and launch a primer search.

Search parameters:

Avoid Template Structure: Default value: Checked. Template secondary structures will be
avoided while designing primers.

Avoid Cross Homology: Default value: Checked. Interprets BLAST search results for the
selected sequence to avoid designing primers in the region of cross homology.

Multiplex: Default value: Checked. Checks for cross-dimers with all primers of selected
sequences preventing competition in multiplex reactions.

Range Parameters

Search Location: Default value: Anywhere. The optimum primers are searched anywhere on the
sequence or biased towards 5' end or biased towards 3' end of the selected sequence. Search
Location selection is disabled, when the Avoid Template Structure is checked.

Search Range: The optimum primers are searched within the user specified search range. The
search range can be specified as From and To sequence base numbers. Search Range
selection is restricted to the sequence bases analyzed for template secondary structures, when
Avoid Template Structure is checked.

Tm (oC): Default value = 55 +/- 5 oC Tm and the +/- tolerance. The search engine will find primers
for all sequences as close as possible to the specified target value of Tm. For example: To specify
a range of 60 oC to 70oC, enter 65 oC for target Tm and 5 oC for the +/- tolerance. Tm values are
calculated using nearest neighbor thermodynamic calculation using Santa Lucia values.

TaOpt (oC): Default value = 55 +/- 5 oC.TaOpt and the +/- tolerance. The search engine will find
primers for all sequences as close as possible to the specified target value of TaOpt. Formula for
calculating TaOpt.

Primer length: Default value = 18 to 22 base pairs, the desired range for the primer length.

Primer Pair Parameters

Specify amplicon length: Default value = 100 - 150 base pairs. Target product length range in
bp. The location of the amplicon will dictate the location of primers as the program tries to design
primers within the specified location.

Alternate Primers: Default value = 2. The number of alternate primer pairs designed per
sequence in a single search.

17
Beacon Designer 5.10 Working Environment

Advanced Search Parameters:

Hairpin maximum dG 3' End (kcal/mol): Default value = 2 -kcal/mol. The free energy of the
most stable hairpin that is acceptable at 3' end of the primer.

Formula for calculating free energy. - dG = dH - T * dS,

Where dH = enthalpy, T = temperature, dS = entropy.

Hairpin maximum dG Internal (kcal/mol): Default value = 3 -kcal/mol. The free energy of the
most stable hairpin that is acceptable in the primer.

3' End maximum stability dG (kcal/mol): Default = 10 -kcal/mol Primers with a 3' end stability
greater than the specified value are not considered. Primers with stability greater than 4 and less
than the specified value are rated lower.

Self-dimer maximum dG 3' End (kcal/mol): Default value = 5 -kcal/mol. The free energy of the
most stable self-dimer that is acceptable at 3' end of the primer.

Self-dimer maximum dG Internal (kcal/mol): Default value = 6 -kcal/mol. The free energy of the
most stable self-dimer that is acceptable in the primer.

Run/repeat maximum length: Default value = 4 bp/dinuc. The maximum acceptable length of
single nucleotide run (e.g. AAAA) or dinucleotide repeats (ATATATAT).

Run/repeat maximum length: Default value = 2 base pair. Primers with less than the specified
number of G or C' s at the 3' end will be rated lower.

Maximum ambiguous bases in the amplicon: Default value = 0. The number of ambiguous
bases tolerated in the amplicon.

Maximum primer pair Tm mismatch: Default value = 3. The maximum acceptable difference
between the Tm values of the two primers.

Cross-dimer maximum dG 3' End (kcal/mol): Default value = 5 -kcal/mol. The free energy of
the most stable cross-dimer that is acceptable at 3' end of the primer.

Cross-dimer maximum dG Internal (kcal/mol): Default value = 6 -kcal/mol. The free energy of
the most stable cross-dimer that is acceptable in the primer.

Multiplexing maximum dG (kcal/mol): Default value = 6 -kcal/mol. The free energy of the most
stable cross-dimer that is acceptable in a multiplex reaction.

18
Beacon Designer 5.10 Working Environment

Primer Search Parameters for NASBA(R) Assay

The Primer Search Parameters window is launched when you select Analyze > Primer Search >

NASBA or click button from the toolbar.

You can set parameters for primer search in this window and launch a primer search.

Search parameters:

Avoid Template Structure: Default value: Checked. Template secondary structures will be
avoided while designing primers.

Avoid Cross Homology: Default value: Checked. Interprets BLAST search results for the
selected sequence to avoid designing primers in the region of cross homology.

Multiplex: Default value: Checked. Checks for cross-dimers with all primers of selected
sequences preventing competition in multiplex reactions.

Range Parameters

Search Location: Default value: Anywhere. The optimum primers are searched anywhere on the
sequence or biased towards 5' end or biased towards 3' end of the selected sequence. Search
location selection is disabled, when the Avoid Template Structure is checked.

Search Range: The optimum primers are searched within the user specified search range. The
search range can be specified as From and To sequence base numbers. Search Range
selection is restricted to the sequence bases analyzed for template secondary structures, when
Avoid Template Structure is checked.

Target Tm (oC): Default value = 55 +/- 5 oC Target Tm and the +/- tolerance. The search engine
will find primers for all sequences as close as possible to the specified target value of Tm. For
example: To specify a range of 60 oC to 70oC, enter 65 oC for target Tm and 5 oC for the +/-
tolerance. Tm values are calculated using nearest neighbor thermodynamic calculation using
Santa Lucia values.

Target TaOpt (oC): Default value = 55 +/- 5 oC. Target TaOpt and the +/- tolerance. The search
engine will find primers for all sequences as close as possible to the specified target value of
TaOpt. Formula for calculating TaOpt.

Primer length: Default value = 20 to 30 base pairs, the desired range for the primer length.

Primer Pair Parameters

Specify amplicon length: Default value = 100 - 150 base pairs. Target product length range in
bp. The location of the amplicon will dictate the location of primers as the program tries to design
primers within the specified location.

Alternate primers per sequence: Default value = 2 . The number of alternate primer pairs
designed per sequence in a single search.

Advanced Search Parameters:

Hairpin maximum dG 3' End (kcal/mol): Default value = 2 -kcal/mol. The free energy of the
most stable hairpin that is acceptable at 3' end of the primer.

Formula for calculating free energy. - dG = dH - T * dS,

19
Beacon Designer 5.10 Working Environment

Where dH = enthalpy, T = temperature, dS = entropy.

Hairpin maximum dG Internal (kcal/mol): Default value = 3 -kcal/mol. The free energy of the
most stable hairpin that is acceptable in the primer.

3' End maximum stability dG (kcal/mol): Default = 10 -kcal/mol Primers with a 3' end stability
greater than the specified value are not considered. Primers with stability greater than 4 and less
than the specified value are rated lower.

Self-dimer maximum dG 3' End (kcal/mol): Default value = 5 -kcal/mol. The free energy of the
most stable self-dimer that is acceptable at 3' end of the primer.

Self-dimer maximum dG Internal (kcal/mol): Default value = 6 -kcal/mol. The free energy of the
most stable self-dimer that is acceptable in the primer.

Run/repeat maximum length: Default value = 3 bp/dinuc. The maximum acceptable length of
single nucleotide run (e.g. AAA) or dinucleotide repeats (ATATAT).

GC Clamp: Default value = 2 base pair. Primers with less than the specified number of G or C' s
at the 3' end will be rated lower.

Maximum ambiguous bases in the amplicon: Default value = 0. The number of ambiguous
bases tolerated in the amplicon.

Maximum primer pair Tm mismatch: Default value = 3. The maximum acceptable difference
between the Tm values of the two primers.

Cross-dimer maximum dG 3' End (kcal/mol): Default value = 5 -kcal/mol. The free energy of
the most stable cross-dimer that is acceptable at 3' end of the primer.

Cross-dimer maximum dG Internal (kcal/mol): Default value = 6 -kcal/mol. The free energy of
the most stable cross-dimer that is acceptable in the primer.

Multiplexing maximum dG (kcal/mol): Default value = 6 -kcal/mol. The free energy of the most
stable cross-dimer that is acceptable in a multiplex reaction.

Add Purines : Default value =AAA. Stretches of pyrimidine (C or T ) in the first 10-12 nucleotides
of the P1 primer sequence complementary to the target RNA sequence may cause abortive
transcription. Therefore in P1 primer Purine bases are added if they contain more than 50 %of
pyrimides in first 10 -12 nucleotide.

20
Beacon Designer 5.10 Working Environment

Beacon Search Parameters

Beacon Designer uses the highly accurate mfold algorithm for hairpin Tm calculation. You can set
the parameters for beacons search by selecting Analyze >Beacon Search or click from the
toolbar.

Beacon Search Parameters:

Probe length: Default value = 18 to 30 bp. The desired range for the probe length.

Tm (oC) : Default value = 9 +/- 5 oC . higher than primer pair TaOpt. The search engine will find
probes for the sequences in the search as close as possible to the specified target value of Tm.
The probe Tm values are calculated using nearest neighbor thermodynamic calculation using
Santa Lucia values.

Beacon Tm (oC): Default value = 9+/-5 oC. higher than primer pair TaOpt. The search engine will
find beacons for sequences as close as possible to the specified target Tm value. The Tm values
are calculated using highly accurate hairpin Tm calculation by connecting to the Quikfoldserver.

Beacon stem sequence: Default value = For five base is CGCGA , for six base is CGCGAT and
for seven base is CGCGATC. Stems of appropriate length are selected automatically for optimal
beacon Tm.

Use Primers Designed In SYBR (R) Green mode: Default: Unchecked. On checking would
automatically select the best primer pair for the Beacon assay from the primer pair pool (including
the alternate primers) designed in theSYBR (R)Green mode.

Note: This feature will be available only if the primers for that sequence were designed in the
SYBR (R)Green mode.

E-mail address: Field for entering E-mail address. A valid E-mail address is essential for
connecting to the Quikfoldserver.

Output Options:

Alternate TaqMan(R) Probes: Default = 2. The number of alternate beacons to be designed per
sequence. You can replace the default probe by selected alternate beacon.

Design Sense/Antisense beacon: Default = Sense. Defines the sense of the output beacon.
This option is available for beacon design for allelic discrimination.

Advanced Search Parameters:

Hairpin maximum dG (kcal/mol): Default value = 3 -kcal/mol. The free energy of the most stable
alternate hairpin that is acceptable. Formula for calculating free energy.

Self-dimer maximum dG (kcal/mol): Default value = 6 -kcal/mol. The free energy of the most
stable self-dimer that is acceptable.

Run/repeat maximum length: Default value = 4 bp/dinuc. Probes with single (e.g. AAAAA) runs
or dinucleotide (ATATATATAT) repeats of length greater than the specified value are discarded.

Cross Dimer maximum dG (kcal/mol): Default value = 6 -kcal/mol. The free energy of the most
stable cross-dimer that is acceptable in a multiplex reaction.

21
Beacon Designer 5.10 Working Environment

TaqMan (R) Probe Search Parameters

The TaqMan(R) Search Parameters window is launched when you select Analyze

>TaqMan(R) search> Standard or click button from the toolbar.

Design parameters:

Primer Length: Default value = 20 to 24 bp. The desired range for the primer length.
(R)
TaqMan(R) Length: Default value = 20 to 24 bp. The desired range for the TaqMan length.

Primer Tm (oC): Default value = 59 +/- 2 oC. Target Tm and the +/- tolerance. The search engine
will find primers as close as possible to the specified target value of Tm. For example: To specify
the range of 60 oC to 70 oC, enter 65 oC for target Tm and 50 oC for the +/- tolerance. The Tm
values are calculated using nearest neighbor thermodynamic calculation using Santa Lucia
values.

TaqMan(R) Tm (oC): Default value = 10 +/- 2 oC higher than primer Tm . TaqMan Tm and the +/-
tolerance. The search engine will find TaqMan(R) probes as close as possible to the specified
target value of Tm. The Tm values are calculated using nearest neighbor thermodynamic
calculation using Santa Lucia values.

Specify amplicon length: Default value = 75 - 150. Target product length range in bp. The
location of the amplicon will dictate the location of primers as the program tries to design primers
within the specified location.

Use Primers Designed In SYBR (R)Green mode: Default: Unchecked. On checking would
automatically select the best primer pair for the TaqMan(R) assay from the primer pair pool
(including the alternate primers) designed in the SYBR (R)Green mode.

Note: This feature will be available only if the primers for that sequence were designed in the
SYBR (R)Green mode.

Avoid Template Structure: Default value: Checked. Template secondary structures will be
avoided while designing primers.

Avoid Cross homology: Default value: Interprets BLAST search results for the selected
sequence to avoid designing primers in the region of cross homology.

Sequence Length Range

Search Range: The optimum TaqMan(R) probes and primers are searched within the user
specified search range. The search range can be specified and From and To sequence base
numbers. Search Selelection is restricted to the sequence bases analyzed for template
secondary structures, when the Avoid Template Structure is checked.

Output Options:

Alternate TaqMan (R) Probes: Default value = 2. The number of alternate TaqMan(R) probes
designed per sequence in a single search. You can replace the default probe by any of the
selected alternate probe.

Design Sense/Antisense TaqMan(R) : Default = Sense. Defines the sense of the output
TaqMan(R). This option is available for TaqMan(R) design for allelic discrimination.

22
Beacon Designer 5.10 Working Environment

Advanced Search Parameters

Advanced Design parameters:

Hairpin maximum dG (kcal/mol): Default value = 3 -kcal/mol. The free energy of the most stable
hairpin that is acceptable in the designed primer and TaqMan(R) probe.

Formula for calculating free energy. - dG = dH - T * dS,

Where dH = enthalpy, T = temperature, dS = entropy.

Self-dimer maximum dG (kcal/mol): Default value = 6 -kcal/mol. The free energy of the most
stable self-dimer that is acceptable in the designed primer and TaqMan(R) probe.

Run/repeat maximum length: Default value = 4 bp/dinuc. Primers and TaqMan(R) probe with
single (e.g. AAAAA) runs or dinucleotide (ATATATATAT) repeats of length greater than the
specified value are discarded.

Multiplexing maximum dG (kcal/mol): Default value = 6 -kcal/mol. The free energy of the most
stable cross-dimer that is acceptable in a multiplex reaction.

Maximum bases between Primer and TaqMan(R): Default value = 10. The maximum
acceptable distance between primer and probe. According to the standard TaqMan(R) design
guidelines, it is recommended that the probe be designed within 10 base pairs of the primer that
anneals to the same strand as the probe, without any overlaps.

Note: With Beacon Designer, you can relax the limit up to 25bp if required.

TaqMan(R) must not have more G than C bases: Default value = Checked. It is an empirical
observation is that probes with more G than C bases will often produce reduced normalized
fluorescence values.

Advance Primer Parameters:

Run/repeat maximum length: Default value =2 bp. Primers with less than the specified number
of G or C's at the 3' end will be rated lower.

3' End maximum stability dG (kcal/mol): Default = 10 -kcal/mol Primers with a 3' end stability
greater than the specified value are not considered. Primers with stability greater than 4 and less
than the specified value are rated lower.

Advance Primer Pair Parameters:

Maximum ambiguous bases in the amplicon: Default value = 0. The number of ambiguous
bases tolerated in the amplicon.

Maximum primer pair Tm mismatch: Default value = 2. The acceptable maximum difference
between the Tm of the two primers.

Cross-dimer maximum dG (kcal/mol): Default value = 6 -kcal/mol. The free energy of the most
stable cross-dimer that is acceptable.

23
Beacon Designer 5.10 Working Environment

Multiplex Search Parameters for Taqman® Assay

Multiplex Taqman Search parameter window is launched when you select

Analyze> Multiplex TaqMan >Standard or click button from tool bar.

You can set parameters for Multiplex Taqman Search in this window and can launch the Multiplex
Taqman search.
Multiplex Set Name: This field will let you select the name for multiplex set. Each set will have
maximum of 4 sequences and minimum of 2 sequences.

Primer Parameters
Primer Search parameters:
Avoid Template structure: Default value: Checked. Template secondary structures will be
avoided while designing primers.
Avoid Cross homology: Default value:Checked. Interprets BLAST search results for the
selected sequence to avoid designing primers in the region of cross homology.
Note: If SNP is selected on any of the sequences in a multiplexed group, then Avoid Cross
Homology and Avoid Template structure will be disabled.
Design Parameters
Primer Length: Default value = 20 to 24 bp. The desired range for the primer length.
Tm (oC): Default value = 59 +/- 2 oC. Primer Tm and the +/- tolerance. The search engine will find
primers as close as possible to the specified target value of Tm. For example: To specify the
range of 60 oC to 70 oC, enter 65 oC for PrimerTm and 50 oC for the +/- tolerance. The Tm values
are calculated using nearest neighbor thermodynamic calculation using Santa Lucia values.
Amplicon length: Default value = 100 - 150. Target product length range in bp.
Note: For the successful multiplex reactions, you need to keep your amplicon PCR effciency at
same level otherwise quantification of your amplicons cannot be compared.
Sequence Length Range/ Reference Gene Selection:
Length Range: The optimum TaqMan® probes and primers are searched within the user
specified search range. The search range can be specified and From and To sequence base
numbers. Search Range selection is restricted to the sequence bases analyzed for template
secondary structures, when the Avoid Template Structure is checked.
Reference Gene Selection: Default value: unchecked. You can perform multiplex Taqman
design for reference gene multiplexing. For reference gene multiplexing it is necessary to select
at least one sequence as a reference gene. Selected reference gene should have pre-designed
primer and probes.
a) When Avoid Template Structure is unchecked: For selected reference gene, amplicon
length will be displayed in “Search range” column and Tm of Primer pair and probe for selected
reference gene will be displayed in Primer Tm and Probe Tm column.

b) When Avoid Template Structure is checked: Initially “Search Range” selection is restricted
to the sequence bases analyzed for template secondary structures. But when you select a
reference gene amplicon length will be displayed in Search range column and Tm of Primer and
probe for selected reference gene will be displayed in Primer Tm and Probe Tm column

24
Beacon Designer 5.10 Working Environment

Reaction conditions
Note: Reaction conditions used for all reference gene must be identical and will be used for
multiplex search.
Limit for selecting the sequence as a reference gene:3
TaqMan Parameters:

Probe Length: Default value = 20 to 24 bp. The desired range for the LNA(TM)™ substituted
TaqMan® length.

Probe Tm (oC): Default value = 10 +/- 2 oC higher than primer Tm. Probe Tm and the +/-
tolerance. The search engine will find TaqMan® probes as close as possible to the specified
target value of Tm. The Tm values are calculated using nearest neighbor thermodynamic
calculation using Santa Lucia values.

Advanced Design parameters

Hairpin maximum dG (kcal/mol): Default value = 3 -kcal/mol. The free energy of the most
stable hairpin that is acceptable in the designed primer and TaqMan® probe.
Formula for calculating free energy. - dG = dH - T * dS,
Where dH = enthalpy, T = temperature, dS = entropy.
Self-dimer maximum dG (kcal/mol): Default value = 6 -kcal/mol. The free energy of the most
stable self-dimer that is acceptable in the designed primer and TaqMan® probe.
Run/repeat maximum length: Default value = 4 bp/dinuc. Primers and TaqMan® probe with
single (e.g. AAAAA) runs or dinucleotide (ATATATATAT) repeats of length greater than the
specified value are discarded.
Multiplexing maximum dG (kcal/mol): Default value = 6 -kcal/mol. The free energy of the most
stable cross-dimer that is acceptable in a multiplex reaction.
Maximum bases between Primer and TaqMan®: Default value = 10. The maximum acceptable
distance between primer and probe. According to the standard TaqMan® design guidelines, it is
recommended that the probe be designed within 10 base pairs of the primer that anneals to the
same strand as the probe, without any overlaps.
Note: With Beacon Designer, you can relax the limit up to 250 bp if required.
TaqMan® must not have more G than C bases: Default value = Checked. It is an empirical
observation is that probes with more G than C bases will often produce reduced normalized
fluorescence values.
Advanced Primer Parameters:
Run/repeat maximum length: Default value =2 bp. Primers with less than the specified number
of G or C's at the 3' end will be rated lower.
3' End maximum stability dG (kcal/mol): Default = 10 -kcal/mol Primers with a 3' end stability
greater than the specified value are not considered. Primers with stability greater than 4 and less
than the specified value are rated lower.
G/C Clamp : Consecutives G/C's at 3' end: Default value = 2. GC clamp length at 3' end is the
number of consecutive G or C permitted at the 3' terminus the primers.
Advanced Primer Pair Parameters:
Maximum ambiguous bases in the amplicon: Default value = 0. The number of ambiguous
bases tolerated in the amplicon.

25
Beacon Designer 5.10 Working Environment

Maximum primer pair Tm mismatch: Default value = 2. The acceptable maximum difference
between the Tm of the two primers.
Multiplexing Maximum primer pairs Tm mismatch: Default value = 3. The acceptable
maximum difference between the Tm of the two primers between two different sequences.
Cross-dimer maximum dG (kcal/mol): Default value = 6 -kcal/mol. The free energy of the most
stable cross-dimer that is acceptable.
Output Options:
Alternate Multiplex Set: Default value = 2. The number of alternate TaqMan® probes designed
per sequence in a single search. You can replace the default probe by any of the selected
alternate probe.

26
Beacon Designer 5.10 Working Environment

LNA(TM) Substituted TaqMan (R) Probe Search Parameters

The LNA(TM) substituted TaqMan (R) search parameters window is launched when

you select Analyze >TaqMan (R) search>LNA(TM). When you click button from the
toolbar the TaqMan search window launched will have "Standard" selected and to perform
LNA(TM) substituted TaqMan search select "LNA(TM)". As a result parameters for the LNA(TM)
substituted TaqMan design will be enabled under TaqMan parameters tab.

Primer Parameters:

Avoid Template Structure: Default value: Checked. Template secondary structures will be
avoided while designing primers.

Avoid Cross homology: Default value: Interprets BLAST search results for the selected
sequence to avoid designing primers in the region of cross homology.

Primer Length: Default value = 20 to 24 bp. The desired range for the primer length.

Primer Tm (oC): Default value = 59 +/- 2 oC. Primer Tm and the +/- tolerance. The search
engine will find primers as close as possible to the specified target value of Tm. For example: To
specify the range of 60 oC to 70 oC, enter 65 oC for PrimerTm and 50 oC for the +/- tolerance.
The Tm values are calculated using nearest neighbor thermodynamic calculation using Santa
Lucia values.

Amplicon length: Default value = 75 - 150. Target product length range in bp. The location of
the amplicon will dictate the location of primers as the program tries to design primers within the
specified location.

Sequence Length Range:

Search Range: The optimum TaqMan(R)probes and primers are searched within the user
specified search range. The search range can be specified and From and To sequence base
numbers. Search Range selection is restricted to the sequence bases analyzed for template
secondary structures, when the Avoid Template Structure is checked.

TaqMan Parameters:

Use Primers Designed In SYBR Green mode: Default: Unchecked. On checking would
automatically select the best primer pair for the TaqMan(R) assay from the primer pair pool
(including the alternate primers) designed in the SYBR Green mode.

Note: This feature will be available only if the primers for that sequence were designed in the
SYBR Green mode.

TaqMan(R) Length: Default value = 15 to 18 bp. The desired range for the LNA(TM) substituted
TaqMan(R) length.

TaqMan(R) Tm (oC): Default value = 10 +/- 2 oC higher than primer Tm. Target Tm and the +/-
tolerance. The search engine will find TaqMan(R)probes as close as possible to the specified
target value of Tm. The Tm values are calculated using nearest neighbor thermodynamic
calculation using Santa Lucia values.

Note: During allele discrimination assay design the default value of Target TaqMan(R) Tm (oC) is
7 +/- 2 oC higher than primer Tm.

27
Beacon Designer 5.10 Working Environment

LNA(TM) substituted design: These parameters are enabled when "LNA(TM)" is selected and
disabled when “Standard” is selected.

Number of LNA(TM) bases: Default value: 4. Number of LNA(TM) bases to be included in the
TaqMan(R) probes can be specified. Minimum number of LNA(TM) which can be added is 1 and
Maximum is 10.

LNA(TM) free region on end: Default value: 2. LNA(TM) free region on each end refer to the
number of base which should be ignored from 5' and 3' bases before incorporating LNA(TM) in
TaqMan probe. This is required to substitute the LNA(TM) in the central regions of the probes, as
LNA(TM) substituted at the 3' ends may lead to mispriming which is not acceptable.

LNA(TM) base every : Default value : 3. LNA(TM) base every lets you to decide, which base
should be replaced with LNA(TM) base in oligo. A value of 3 will replace every third nucleotide
with an LNA(TM) analog. Minimum value is 2 and maximum is 10.

Note:

a. Beacon Designer will start substituting the DNA bases to LNA(TM) bases based on the
LNA(TM) free region on each end value. For Example : If LNA(TM) phase off is 4 then, 4 bases
will be left from 5' and 3' end and 5 bases will be LNA(TM) from 5' end. Then, based on LNA(TM)
base every and Number of LNA(TM) other bases will be substituted by LNA(TM).

b. When LNA(TM) substituted TaqMan is designed for allele discrimination assay, then SNP is
always centralized in the probes and is LNA(TM). Then based on the number of LNA(TM) and
LNA(TM) base every the DNA bases on either side of the SNP, LNA(TM) will be substituted and
one having the higher Tm will be given priority.

Advanced Option

Output Options:

Alternate TaqMan(R )Probe: Default value = 2. The number of alternate LNA(TM) substituted
TaqMan(R) probes designed per sequence in a single search. You can replace the default probe
by any of the selected alternate probe.

Design Sense/Antisense TaqMan(R): Default = Sense. Defines the sense of the output
TaqMan(R). This option is available for TaqMan(R) design for allelic discrimination.

28
Beacon Designer 5.10 Working Environment

Multiplex Search Parameters for LNA(TM) substituted Taqman(R) Assay

Multiplex Taqman Search parameter window is launched when you select

Analyze> Multiplex TaqMan> LNA(TM) or click button from tool bar.

You can set parameters for Multiplex Taqman Search in this window and can launch the Multiplex
Taqman search.

Multiplex Set Name: This field will let you select a name for your multiplexed group.

Primer Parameters
Primer Search parameters:

Avoid Template structure: Default value: Checked. Template secondary structures will be
avoided while designing primers.
Avoid Cross homology: Default value: Checked. Interprets BLAST search results for the
selected sequence to avoid designing primers in the region of cross homology.

Note: If SNP is selected for any of the sequence in a multiplexed group then “Avoid Template
structure” and “Avoid Cross homology” will be disabled.

Primer Design Parameters:

Primer Length: Default value = 20 to 24 bp. The desired range for the primer length.
Tm (oC): Default value = 59 +/- 2 oC. Primer Tm and the +/- tolerance. The search engine will find
primers as close as possible to the specified target value of Tm. For example: To specify the
range of 60 oC to 70oC, enter 65 oC for PrimerTm and 50 oC for the +/- tolerance. The Tm values
are calculated using nearest neighbor thermodynamic calculation using Santa Lucia values.
Amplicon length: Default value = 100 - 150. Target product length range in bp. For the
successful multiplexing individual reactions should have similar effciency hence your amplicon
length should be identical otherwise quantification of your amplicon cannot be compared.
Sequence Length Range/ Reference Gene Selection:
Length Range: The optimum TaqMan® probes and primers are searched within the user
specified search range. The search range can be specified From and To sequence base
numbers. Search Range selection is restricted to the sequence bases analyzed for template
secondary structures, when the Avoid Template Structure is checked.
Reference Gene Selection: Default value: unchecked. You can perform multiplex Taqman
design for reference gene multiplexing. For reference gene multiplexing it is necessary to select
at least one sequence as a reference gene. Selected reference gene should have pre-designed
primers and probes.
a) When Avoid Template Structure is unchecked: For selected reference gene, amplicon
length will be displayed in “Search range” column and Tm of Primer pair and probe for selected
reference gene will be displayed in Primer Tm and Probe Tm column.
b) When Avoid Template Structure is checked: Initially Search Range selection is restricted to
the sequence bases analyzed for template secondary structures. But when you select a reference
gene amplicon length will be displayed in “Search range” and will be non editable and Tm of

29
Beacon Designer 5.10 Working Environment

Primer and probe for selected reference gene will be displayed in Primer Tm and Probe Tm
column.
Reaction conditions:
Note: Reaction conditions used for all reference genes must be identical and will be used for
multiplex search.
Limit for selecting the sequence as a reference gene: 3
Taqman Parameters

Probe Length: Default value = 20 to 24 bp. The desired range for the LNA(TM) substituted
TaqMan® length.

Probe Tm (oC): Default value = 10 +/- 2 oC higher than primer Tm. Probe Tm and the +/-
tolerance. The search engine will find TaqMan® probes as close as possible to the specified
target value of Tm. The Tm values are calculated using nearest neighbor thermodynamic
calculation using Santa Lucia values.

Note: During allele discrimination assay design the default value of Probe Tm ( oC) is 7 +/- 2 oC
higher than primer Tm.

Number of LNA(TM) bases: Default value: 4. Number of LNA(TM) bases to be included in the
TaqMan® probes can be specified. Minimum number of LNA(TM) which can be added is 1 and
Maximum is 10.

LNA(TM) free region on each end: Default value : 2.LNA(TM) free region on each end refer to
the number of base which should be ignored from 5' and 3' bases before incorporating LNA(TM)
in TaqMan® probe. For Example: If LNA(TM) free base on each end is 2 then, 4 bases will be left
from 5' and 3' end. Then, based on LNA(TM) base every base and number of LNA(TM), DNA
bases will be substituted by LNA(TM). This is required to substitute the LNA(TM) in the central
regions of the probes, as LNA(TM) substituted at the 3' ends may lead to mispriming which is not
acceptable.

LNA(TM) base every: Default value: 3. LNA(TM) base every lets you to decide, which base
should be replaced with LNA(TM) base in oligo. A value of 3 will replace every third nucleotide
with an LNA(TM) analog. Minimum value is 2 and maximum is 10. Note: a. For allele
discrimination studies, the probe always includes the mutant base at its center. In LNA(TM) spiked
probes, a single LNA(TM) base is introduced at the mutation site.

Advanced Design parameters

Hairpin maximum dG (kcal/mol): Default value = 3 -kcal/mol. The free energy of the most
stable hairpin that is acceptable in the designed primer and TaqMan® probe.
Formula for calculating free energy. - dG = dH - T * dS,
Where dH = enthalpy, T = temperature, dS = entropy.
Self-dimer maximum dG (kcal/mol): Default value = 6 -kcal/mol. The free energy of the most
stable self-dimer that is acceptable in the designed primer and TaqMan® probe.
Run/repeat maximum length: Default value = 4 bp/dinuc. Primers and TaqMan® probe with
single (e.g. AAAAA) runs or dinucleotide (ATATATATAT) repeats of length greater than the
specified value are discarded.

30
Beacon Designer 5.10 Working Environment

Multiplexing maximum dG (kcal/mol): Default value = 6 -kcal/mol. The free energy of the most
stable cross-dimer that is acceptable in a multiplex reaction.
Maximum bases between Primer and TaqMan®: Default value = 10. The maximum acceptable
distance between primer and probe. According to the standard TaqMan® design guidelines, it is
recommended that the probe be designed within 10 base pairs of the primer that anneals to the
same strand as the probe, without any overlaps.
Note: With Beacon Designer, you can relax the limit up to 250 bp if required.
TaqMan® must not have more G than C bases: Default value = Checked. It is an empirical
observation is that probes with more G than C bases will often produce reduced normalized
fluorescence values.
Advanced Primer Parameters:
Run/repeat maximum length: Default value =2 bp. Primers with less than the specified number
of G or C's at the 3' end will be rated lower.
3' End maximum stability dG (kcal/mol): Default = 10 -kcal/mol Primers with a 3' end stability
greater than the specified value are not considered. Primers with stability greater than 4 and less
than the specified value are rated lower.
G/C Clamp : Consecutives G/C's at 3' end: Default value = 2. GC clamp length at 3' end is the
number of consecutive G or C permitted at the 3' terminus the primers.

Advanced Primer Pair Parameters:

Maximum ambiguous bases in the amplicon: Default value = 0. The number of ambiguous
bases tolerated in the amplicon.
Maximum primer pair Tm mismatch: Default value = 2. The acceptable maximum difference
between the Tm of the two primers of same sequence.
Multiplexing Maximum primer pairs Tm mismatch: Default value = 3. The acceptable
maximum difference between the Tm between primer pair of two different sequences.
Cross-dimer maximum dG (kcal/mol): Default value = 6 -kcal/mol. The free energy of the most
stable cross-dimer that is acceptable.

Output Options:
Alternate Multiplex Set: Default value = 2. The number of alternate TaqMan® probes designed
per sequence in a single search. You can replace the default probe by any of the selected
alternate probe.

31
Beacon Designer 5.10 Working Environment

FRET Probes Search Parameters

The FRET Probes Search Parameters window is launched when you select

Analyze >FRET Probes search menu or click the button from the toolbar.

Design parameters:

Primer Length: Default values = 18 to 22 bp. The desired range for the primer length.

FRET Probes Length: Default values = 25 to 35 bp. The desired range for the FRET Probes
length.

Distance between Probes: Default = 1 to 5 bases. The desired distance between the 3' end of
the first probe (donor probe) from the 5' end of the second probe (acceptor probe).

Primer Tm (oC): Default value = 55 +/- 5 oC. TPrimer Tm and the +/- tolerance. The search
engine will find primers as close as possible to the specified target value of Tm. For example: To
specify the range of 60 oC to 70 oC, enter 65 oC for Primer Tm and 50 oC for the +/- tolerance.
The Tm values are calculated using nearest neighbor thermodynamic calculation using Santa
Lucia values.

FRET Probes Tm (oC): Default value = 8 +/- 3 oC higher than primer Tm . Target Tm and the +/-
tolerance. The search engine will find FRET Probes as close as possible to the specified target
value of Tm. The Tm values are calculated using nearest neighbor thermodynamic calculation
using Santa Lucia values.

Specify amplicon length: Default value = 100 - 250. Target product length range in bp. This
parameter dictates the primer positions relative to each other, assuring that the distance between
the 5' end of the upstream primer to the 3' end of the downstream primer is within the specified
value.

Use Primers Designed In SYBR (R)Green mode: Default: Unchecked. On checking would
automatically select the best primer pair for the FRET Probes assay from the primer pair pool
(including the alternate primers) designed in the SYBR (R)Green mode.

Note: This feature will be available only if the primers for that sequence were designed in the
SYBR (R) Green mode.

Avoid Template Structure: Default value: Checked. Significant template secondary structures
which may hinder the primers from annealing are identified and avoided when designing primers.

Avoid Cross homology: Default value: Checked. Interprets BLAST search results for the
selected sequence to avoid designing primers in the region of cross homology.

Sequence Length Range

Search Range: The optimum FRET Probes and primers are searched within the user specified
search range. The search range can be specified as From and To sequence base numbers.
Search Range selection is restricted to the sequence bases analyzed for template secondary
structures, when the Avoid Template Structure is checked.

Output Options:

Alternate Probes: Default value = 2. The number of alternate FRET Probes designed per
sequence in a single search. You can replace the default probe by any of the alternate probe.

32
Beacon Designer 5.10 Working Environment

Design Sense/Antisense FRET Probes: Default = Sense. Defines the sense of the output
FRET Probes.

Advanced Search Parameters

Advanced Probe parameters:

Hairpin maximum dG (kcal/mol): Default value = 3 -kcal/mol. The free energy of the most
stable hairpin that is acceptable in the designed primer and FRET Probes probe.

Formula for calculating free energy. - dG = dH - T * dS,

Where dH = enthalpy, T = temperature, dS = entropy.

Self-dimer maximum dG (kcal/mol): Default value = 6 -kcal/mol. The free energy of the most
stable self-dimer that is acceptable in the designed primer and FRET Probes probe.

Run/repeat maximum length: Default value = 4 bp/dinuc. Primers and FRET Probes probe with
single (e.g. AAAAA) runs or dinucleotide (ATATATATAT) repeats of length greater than the
specified value are discarded.

Maximum bases between Primer and FRET Probes: Default value = 10. The maximum
acceptable distance between primer and probe. According to the standard FRET Probes design
guidelines, it is recommended that the probe should be designed as close as possible to the
primer on the same strand without overlapping the primer.

FRET Probes must not have more G than C bases: Default value = Checked. It has been
empirically observed that probes with more G's than C's will often produce reduced normalized
fluorescence values.

Advanced Primer Parameters:

Run/repeat maximum length: Default value = 2 bp. Primers with less than the specified number
of G's or C's at the 3' end will be rated lower.

3' End maximum stability dG (kcal/mol): Default = 10 -kcal/mol Primers with a 3' end stability
greater than the specified value are not considered. Primers with stability greater than 4 and less
than the specified value are rated lower.

Advanced Primer Pair Parameters:

Maximum ambiguous bases in the amplicon: Default value = 0. The number of ambiguous
bases tolerated in the amplicon.

Maximum primer pair Tm mismatch: Default value = 2. The acceptable maximum difference
between the Tm of the two primers.

Cross-dimer maximum dG (kcal/mol): Default value = 6 -kcal/mol. The free energy of the most
stable cross-dimer that is acceptable.

33
Beacon Designer 5.10 Working Environment

SYBR (R) Green Primer Search Parameters

SYBR Primer Green Primer Search Parameters;

The Primer Search Parameters window is launched when you select Analyze

>Primer Search or click button from the toolbar.

You can set parameters for primer search in this window and launch a primer search.

Search parameters:

Avoid Template Structure: Default value: Checked. Significant template secondary structures
which may hinder the primers from annealing are identified and avoided when designing primers.

Avoid Cross Homology: Default value: Checked. Interprets BLAST search results for the
selected sequence to avoid designing primers in the regions of significant cross homologies.

Range Parameters

Search Location: Default value: Anywhere. The optimum primers are searched anywhere on the
sequence or biased towards the 5' or the 3' end of the selected sequence. Search location
selection is disabled, when the Avoid Template Structure is checked.

Search Range: The optimum primers are searched within the user specified search range. The
search range can be specified as From and To sequence base numbers. Search Range selection
is restricted to the sequence bases analyzed for template secondary structures, when Avoid
Template Structure is checked.

Tm (oC): Default value = 55 +/- 5 oC Primer Tm and the +/- tolerance. The search engine will find
primers for all sequences as close as possible to the specified value of primer Tm. For example:
To specify a range of 60 oC to 70oC, enter 65 oC for primer Tm and 5 oC for the +/- tolerance.
The Tm values are calculated using nearest neighbor thermodynamic calculation using Santa
Lucia values.

TaOpt (oC): Default value = 55 +/- 5 oC. TaOpt and the +/- tolerance. The search engine will find
primers for all sequences as close as possible to the specified value of TaOpt. Formula for
calculating TaOpt.

Primer length: Default value = 18 to 22 base pairs, the desired range for the primer length.

Primer Pair Parameters

Specify amplicon length: Default value = 100 - 150 base pairs. Target product length range in
bp. This parameter dictates the primer positions relative to each other, assuring that the distance
between the 5' end of the upstream primer to the 3' end of the downstream primer is within the
specified value.

Alternate primers: Default value = 2 . The number of alternate primer pairs designed per
sequence in a single search.

Advanced Search Parameters:

Hairpin maximum dG 3' End (kcal/mol): Default value = 2 -kcal/mol. The free energy of the
most stable hairpin that is acceptable at 3' end of the primer.

Formula for calculating free energy. - dG = dH - T * dS,

Where dH = enthalpy, T = temperature, dS = entropy.

34
Beacon Designer 5.10 Working Environment

Hairpin maximum dG Internal (kcal/mol): Default value = 3 -kcal/mol. The free energy of the
most stable hairpin that is acceptable in the primer.

3' End maximum stability dG (kcal/mol): Default = 10 -kcal/mol Primers with a 3' end stability
greater than the specified value are not considered. Primers with stability greater than 4 and less
than the specified value are rated lower.

Self-dimer maximum dG 3' End (kcal/mol): Default value = 5 -kcal/mol. The free energy of the
most stable self-dimer that is acceptable at the 3' end of the primer.

Self-dimer maximum dG Internal (kcal/mol: Default value = 6 -kcal/mol. The free energy of the
most stable self-dimer that is acceptable in the primer.

Run/repeat maximum length: Default value = 4 bp/dinuc. The maximum acceptable length of
single nucleotide run (e.g. AAAA) or dinucleotide repeats (ATATATAT).

Run/repeat maximum length: Default value = 2 base pair. Primers with less than the specified
number of G's or C' s at the 3' end will be rated lower.

Maximum ambiguous bases in the amplicon: Default value = 0. The number of ambiguous
bases tolerated in the amplicon.

Maximum primer pair Tm mismatch: Default value = 3 0C. The maximum acceptable difference
between the Tm values of the two primers.

Cross-dimer maximum dG 3' End (kcal/mol): Default value = 5 -kcal/mol. The free energy of
the most stable cross-dimer that is acceptable at the 3' end of the primer.

Cross-dimer maximum dG Internal (kcal/mol): Default value = 6 -kcal/mol. The free energy of
the most stable cross-dimer that is acceptable in the primer.

35
Beacon Designer 5.10 Working Environment

BLAST Search Parameters

Parameters;

Beacon Designer supports BLAST search against all the genomic databases available at NCBI.
Local customized databases can also be searched using the Standalone WWW BLAST service
from NCBI.

In Beacon Designer BLAST is available for Complete Sequence, amplicon, primer pairs. The
selected sequence is BLAST searched against any of the selected genomic database, the results
are interpreted to designing primers avoiding cross homology. The cross homology in the thus
designed primer pair/amplicon can be verified by BLASTing the primer pair/amplicon sequence
against the same genomic database.

You can set parameters for BLAST search for selected sequences in the BLAST Search
Parameter window. To launch the BLAST search parameters window

selectAnalyze>BLAST Search or click from the toolbar.

To launch theBLAST Search parameters window for Primer pair/Amplicon

selectAnalyze>BLAST Search>Primer-pair/Amplicon/Probe.

The following parameters are available for BLAST search:

Search Type

Human Genome BLAST: Search your query sequence against the genome (all assemblies),
genome (reference only), Ref RNA (Default), Build RNA or Ab initio RNA databases at NCBI.
http://www.ncbi.nlm.nih.gov/genome/seq/page.cgi?F=HsBlast.html&&ORG=Hs

Microbial Genome: Search your query sequence against the DNA databases (Default) of all the
completed genomes at NCBI. Various organisms are listed inSearch options >Genomes under
two basic categories:Archaeal genome andBacterial genome.
http://www.ncbi.nlm.nih.gov/sutils/genom_table.cgi?

Eukaryotic BLAST: Search your query sequence against the genome databases (Default)
available under Vertebrates, Plants, Fungi, Insects, Protozoa, Nematodes and other eukaryotes.

Vertebrates

Mouse Genome: Search your query sequence against the genome (all assemblies), genome
(reference only), Ref RNA (Default), Build RNA or Ab initio RNA databases ofmouse available at
NCBI.
http://www.ncbi.nlm.nih.gov/genome/seq/MmBlast.html

Cat Genome BLAST: Search your sequence against RefSeq

RNA.http://www.ncbi.nlm.nih.gov/genome/seq/FcaBlast.html

Chicken Genome: Search your query sequence against the genome (all assemblies), genome
(reference only), Ref RNA (Default), Build RNA or Ab initio RNA databases ofcjicken available at
NCBI.
http://www.ncbi.nlm.nih.gov/genome/seq/GgaBlast.html

Chimpanzee Genome BLAST : Search your query sequence against the genome (all
assemblies), Genome (reference only), RNA*(RefSeq, Ab Initio, build).
http://www.ncbi.nlm.nih.gov/genome/seq/PtrBlast.html

36
Beacon Designer 5.10 Working Environment

Cow Genome BLAST : Search your query sequence against the Genome (all assemblies),
Genome (reference only), RNA*(RefSeq, Ab Initio, build).
http://www.ncbi.nlm.nih.gov/genome/seq/BtaBlast.html

Dog Genome BLAST: Search your query sequence against the Genome (reference
only),RNA*(RefSeq, Ab Initio, build).
http://www.ncbi.nlm.nih.gov/genome/seq/CfaBlast.html

PigGenome BLAST:Search your query sequence against the RefSeq (RNA).

http://www.ncbi.nlm.nih.gov/genome/seq/SscBlast.html

Rat Genome: Search your query sequence against the genomic sequence, Ref RNA (Default),
Build RNA or Ab initio RNA databases ofrat available at
NCBI.http://www.ncbi.nlm.nih.gov/genome/seq/RnBlast.html

Sheep Genome BLAST : Search your query sequence against the RefSeq RNA
http://www.ncbi.nlm.nih.gov/genome/seq/OarBlast.html

Zebrafish Genome: Search your query sequence against the mRNAs or Reference mRNAs
(Default) ofZebra fish available at NCBI.
http://www.ncbi.nlm.nih.gov/genome/seq/DrBlast.html

Puffer fish: Search your query sequence against the Genomic Sequence (Default) of Puffer fish
available at NCBI.
http://www.ncbi.nlm.nih.gov/blast/Genome/fugu.html

Plants : Search your query sequence against DNA and mRNA (Default) database of all the
completed genomes at NCBI. http://www.ncbi.nlm.nih.gov/BLAST/Genome/PlantBlast.shtml?10

Fungi: Search your query sequence against the DNA (Default) of databaseof all the completed
genomes at NCBI:
http://www.ncbi.nlm.nih.gov/sutils/genom_table.cgi?organism=fungi

Protozoa: Search your query sequence against the DNA (Default) of databaseof all the
completed genomes at NCBI:
http://www.ncbi.nlm.nih.gov/sutils/blast_table.cgi?taxid=Protozoa

Insects: Search your query sequence against the Genomic sequence (Default) ofall the
completed genomes at NCBI:
http://www.ncbi.nlm.nih.gov/sutils/genom_table.cgi?organism=insects

Nematodes:Search your query sequence against the DNA (Default) of all the completed
genomes at NCBI:http://www.ncbi.nlm.nih.gov/BLAST/Genome/NematodeBlast.html

Other Eukaryotes: Search your query sequence against the Genomic sequence (Default) of all
the completed genomes at
NCBI:http://www.ncbi.nlm.nih.gov/sutils/genom_tree.cgi?organism=euk

nr BLAST: (Available for complete sequence/ Primer Pair / Amplicon / Probe BLAST Search)

Search your query sequence against the chosen current nucleic acid database. Select from
among organism-specific, inclusive, or specialized set databases:

nr: All GenBank+RefSeq Nucleotides+EMBL+DDBJ+PDB sequences (but no EST, STS, GSS, or

phase 0, 1 or 2 HTGS sequences). No longer "non-redundant".

37
Beacon Designer 5.10 Working Environment

est: Database of GenBank+EMBL+DDBJ sequences from EST Divisions.

est_human: Human subset of GenBank+EMBL+DDBJ sequences from EST Divisions.

est_mouse: Mouse subset of GenBank+EMBL+DDBJ sequences from EST Divisions.

est_others: Non-Mouse, non-Human sequences of GenBank+EMBL+DDBJ sequences from

EST Divisions.

gss: Genome Survey Sequence, includes single-pass genomic data, exon-trapped sequences,
and Alu PCR sequences.

htgs: Unfinished High Throughput Genomic Sequences: phases 0, 1 and 2 (finished, phase 3
HTG sequences are in nr)

pat: Nucleotides from the Patent division of GenBank.

pdb: Sequences derived from the 3-dimensional structure from Brookhaven Protein Data Bank.

month: All new or revised GenBank+EMBL+DDBJ+PDB sequences released in the last 30 days.

alu-repeats: Select Alu repeats from REPBASE, suitable for masking Alu repeats from query
sequences. ftp://ftp.ncbi.nih.gov/pub/jmc/alu/

dbsts: Database of GenBank+EMBL+DDBJ sequences from STS Divisions .

chromosome: Searches Complete Genomes, Complete Chromosome, or contigs form the NCBI
Reference Sequence project..

Local BLAST: Search any customized database set on your local server using the Standalone
WWW BLAST service.

Server name / IP address: Host name of the server or IP address of the machine on which the
Standalone WWW BLAST service is installed (Linux / Mac). This address will be used to connect
the client (Beacon Designer) to the server for local BLAST search.

Genomes:Select the local database category as of Human, Microbes or Others

Human: All the databases which belong to human.

Microbes: All the databases which belong to microbes.

Others: All the databases which belong to organisms other than human and microbes.

Search Options:

Program: Default = blastn. Standard Nucleotide-Nucleotide BLAST search.

Database: Displays the list of available database for each search type. The databases are same
as mentioned in search type above.

To verify database to be used, follow this link :

http://www.ncbi.nlm.nih.gov/genome/seq/Database.html

Desktop BLAST: Desktop BLAST can BLAST search sequences against local custom
databases without the need of setting up a local BLAST server. For Desktop BLAST search, you
must have sequence files either .txt or .fa stored locally on your computer. You need to

38
Beacon Designer 5.10 Working Environment

guide Beacon Designer to the directory which contains .fa or .txt sequences and then BLAST
search sequence against the sequences.

Note: There is a limitation with the Mac OS X version of Java you cann't click on a directory to
select it. "For Desktop BLAST", you need to guide Beacon Designer to .fa or .txt sequences
instead of directory. When you select a single .txt or .fa sequences automatically all the
sequences contained in that directory will be available for BLAST.

Database location: Specify the location to locate the directory having the sequence files against
which you need to perform the desktop BLAST

Genomes: Select the local database category as of Human, Microbes or Others

Human: All the databases which belong to human.

Microbes: All the databases which belong to microbes.

Others: All the databases which belong to organisms other than human and microbes.

Note: For Desktop BLAST and the local database there is an editable text field for Expect Value,
for which the minimum value is 0.0001 and maximum value is 1000.

Advanced Options

Limit by Entrez Query :( Available only for theStandard BLAST type in the Primer Pair /
Amplicon / Probe BLAST Search)
BLAST searches can be limited to the results of an Entrez query against the database chosen.
This can be used to limit searches to subsets of the BLAST databases. Any terms can be entered
that would normally be allowed in an Entrez search session. To limit to a specific organism you
can either select using the pulldown menu, form a list of the most common organism in the
databases. Or enter the name of the organism in the Entrez Query field with the [Organism]
qualifier. Default = (none)

Filter: Default = unchecked

The Filter in the program is similar to the Choose Filter option in the Options for advanced
blasting at NCBI BLAST. The Filter, by default, is unchecked and is only applied to the query
sequence (or its translation products) and not to database sequences. This is because checking
the filter will mask off segments of the query sequence that have low compositional complexity,
as determined by SEG program and Human repeats (LINE's and SINE's) and consequently they
will not be reported in the BLAST output. The program will then search these regions for
designing primers and probes, which is undesirable.

When the Filter is unchecked, the entire query sequence will be BLAST'ed against the selected
database. As the database contains regions of Low-complexity and/or Human repeats, they will
be reported in the BLAST output as homologies and the program will avoid these regions when
locating primers and probes.

Note: It is not unusual for nothing at all to be masked, so filtering should not be expected to
always yield an effect.

Expect: Default = 10, 0.01 for Primer Pair /Amplicon /Probe BLAST.
The Expect value is the statistical significance threshold for reporting matches against database
sequences; the default value is 10, meaning that 10 matches are expected to be found merely by
chance, according to the stochastic model of Karlin and Altschul (1990). If the statistical
significance ascribed to a match is greater than the EXPECT threshold, the match will not be
reported. The lower EXPECT thresholds are more stringent. Fractional values are acceptable.
The Expect value can be used as a convenient way to create a significance threshold for

39
Beacon Designer 5.10 Working Environment

reporting results. The E value describes the random background noise that exists for the matches
between sequences. The Expect value (E) decreases exponentially with the Score (S) that is
assigned to a match between two sequences. When the Expect value is set at 10, a larger list
with more low-scoring hits can be reported. Similarly a lower Expect value can be set to avoid
reporting of low scoring hits.

Program Advanced Options

-G Cost to open a gap [Integer]

default = 5

-E Cost to extend a gap [Integer]

default = 2

-q Penalty for a mismatch [Integer]

default = -3

-r reward for nucleotide match [Integer]

default = 1

-e Expectation value [Real]

default = 10

-W wordsize [Integer]

default = 11

-v Number of one-line descriptions [Integer]

default = 100

-b Number of alignments to show [Integer]

default = 100

Format Options

NCBI-gi: Default = Checked

Results in NCBI gi identifiers to be shown in the output, in addition to the accession and/or locus
name.
Descriptions: Default = 100, and 50 for Primer-pair / Amplicon /Probe BLAST Search.
Restricts the number of short descriptions of matching sequences reported to the number
specified.
Alignments: Default = 100,and 50 for Primer-pair / Amplicon /Probe BLAST Search.
Restricts database sequences to the number specified for which high-scoring segment pairs
(HSPs) are reported. The default limit is100. If more database sequences than this happen to
satisfy the statistical significance threshold for reporting (see EXPECT above), only the matches
ascribed the greatest statistical significance are reported.

40
Beacon Designer 5.10 Working Environment

Template Structures Search

Significant template secondary structure may hinder the primers from annealing and prevent
complete product extension by the polymerase. Template secondary structures search can be
performed on the sequence to avoid designing primers in the regions which form stable
secondary structures at the PCR extension temperature. The possible secondary structures in the
template are obtained from the Quikfoldserver.

The Template Structures dialog is launched when you select Analyze

>Template Structures Search or click button from the toolbar.

You can view the secondary structures for the selected sequence by selecting View >Template
Structure Details.

Search Parameters

Sequence Range: Default value: 1- 1200 bp. The length of the sequence which is submitted to
the Quikfold server for finding the secondary structures at the PCR extension temperatures.
Maximum 1200 bp can be submitted for folding to Quikfoldserver.

Folding Temperature : Default value : 55 oC. The tempearature at which sequence is submitted
at Mfold for finding the secondary structures is settable.

E-mail address: Field for entering E-mail address. A valid E-mail address is essential for
connecting to the Quikfoldserver.

The Sequence is folded at the PCR reaction conditions for most optimum folding results.

41
Beacon Designer 5.10 Working Environment

View Cross Homology

Beacon Designer avoids cross homologies, repeats and low complexity regions while designing
primers. It interprets BLAST search results to determine relevant cross homologies for the
selected sequence.
You can view the relevant cross homologies in the Cross Homology window by selecting
View>Cross Homology or clicking Cross Homology Button from the Blast Information tab.

The window has five columns:

1. Check box: Checking or un-checking will select or unselect the sequences for avoiding cross
homology while designing primers. By default all the checkboxes remain checked to ensure the
relevant cross homologies for the sequence could be avoided.
2. Accession number: The accession numbers of the sequences showing cross homology. This
unique identifier can be used to access the sequence(s) and associated information from the
database. Clicking the accession number opens the database records for the corresponding
sequence in your default browser.
3. Description: Description of the sequences showing cross homology.
4. E-Value: Number of hits expected with similar or better score. It depicts the significance of
match. E-value = 0 indicates complete homology.
5. From - To: The region of the query sequence homologous with the database sequences is
shown as the start and the end base number.

The Cross Homology window launched for Microbial BLAST displays:

1. Description: Description of the sequence showing cross homology.
2. Alignment: Portion of the query showing alignment with the subject sequence.

The Description table has four columns:

a. Check box: Selecting a description will allow you to select or unselect alignments ranges
(from-to) in the Alignment table for avoiding cross homology. Unselecting a description will not
avoid the description and it's alignments as relevant cross homology, while designing primers.
Un-checking the sequence in the Description table, automatically un-checks all the sequences
ranges (from-to) in the Alignment table.
b. Reference: Displays the accession numbers of sequences showing cross homology. This
unique identifier can be used to access specific sequences and associated information from the
database. Clicking the accession number opens the database records for the corresponding
sequence in default browser.
c. Description: Description of the sequences showing cross homology.
d. E-Value: Number of hits expected with similar or better score. It depicts the significance of
match.

The Alignment table has three columns:

a. Check box: Selecting an alignment (from-to) will avoid only the selected alignment as relevant
cross homology while designing primers. The sequence copy in database is unchecked by
default. By default, all other checkboxes remain checked to ensure the relevant cross homologies
for the sequence are avoided.
b. From - To: The region of the query sequence homologous with the database sequence is
represented in terms of the start and the end base number.
c. E-Value: It depicts the statistical significance of member of the set reported.

42
Beacon Designer 5.10 Working Environment

View Secondary Structures

(R)
The graphical view of the primer, beacon, FRET and TaqMan secondary structures is displayed
in the Secondary Structures window. You can view the primer secondary structures by clicking
All Structures option from pop-up menu available at right click (For Mac, CTRL+click) over the
Primer Properties table or by selecting View > Alternate > Primers. In the SYBR (R)Green mode

view the primer secondary structures by clicking the button on the Primer
Properties tab.

You can view the beacon secondary structures by clicking All Structures option from pop-up
menu available at right click (For Mac, CTRL+click) over the Beacon Properties table or by
selecting View > All Structures > Beacons. Similarly to view the TaqMan(R) and FRET
secondary structures clickAll Structures option from pop-up menu available at right click (For
Mac, CTRL+click) over the TaqMan(R)Properties and FRET Properties table respectively or select
View > All Structures > TaqMan(R) / FRET.

The Secondary Structures window displays the graphical view of all the possible structures for
dimers, hairpins, cross-dimers, repeats and runs for the selected primer or probe.
The dG values for each structure and its position as internal or 3' end is also shown. The sense
structures are displayed in blue while the antisense structures are displayed in red.

43
Beacon Designer 5.10

Multiplex Results

With Beacon Designer you can multiplex primers or primers-beacons, TaqMan(R) - TaqMan(R)
TaqMan(R) - primers or between the two FRET Probes and primers for each of the selected
sequences. The multiplex results are displayed in the Multiplex Results window.

The window has four columns:

1. Accession number: Displays the accession numbers of multiplexed sequences.
2. Type: Displays the type of oligonucleotide being multiplexed.
3. Graphical view: Displays the graphical view of the most stable cross dimer formed between
the multiplexed oligonucleotides. The sense sequence is displayed in blue and the antisense in
red.
4. Most stable cross-dimer dG (kcal/mol): Displays the free energy of the most stable cross-
dimer formed between two primers and primers-beacons or TaqMan(R) - TaqMan(R) and
TaqMan(R) - primer or between the two FRET Probes and primers sequences of the selected
sequence.

Designer;

Project;

44
Beacon Designer 5.10 Tutorial

Tutorial

Create and Manage a Project

Beacon Designer enables you to organize your work by creating separate Projects.

You can create any number of projects using Beacon Designer. But only one project can be
opened at a time. You can delete an existing project from Finder by deleting the project folder and
the .bdp file. You can design beacons and TaqMan® in the same project by switching the design
mode.

Create a New Project

You can start working with Beacon Designer by creating a new project.

To create a new project:

1. Choose File> New>Project or click button from the toolbar. Enter the project name.

2. By default a project is created in the BD Projects folder. You can browse in the Save File dialog
and create a project at any other location on your local drive.

Open Project
To open an existing project:
1. Choose File > Open > Project or click from the toolbar. Browse and select the .bdp file of
the project you want to open and click Open.

2. You can also open the project by selecting a project displayed in the history list at the bottom of
the file menu. Beacon Designer displays four most recent projects in the history list.

3. An open project is automatically closed when you open another project.

Note: To transfer a previously created project from original location to a new folder or to another
drive or even to another machine, copy both the project.bdp file and the project folder and paste
at the new destination.

45
Beacon Designer 5.10 Tutorial

Close Project
To close a project:

1. Choose File>Close Project.

2. Choose File>Open>Sequence>From Entrez. This will close the project and exit the program.

Save Project As
You can save number of projects but only one can be opened at a time.
To save a project
1) Select File>Save Project As.
2) Enter the project name.
3) Select the location where you want to save the project.
4) Beacon Designer will save the project at specified location.

Save Sequence As
You can save existing sequence as a new sequence in a project:
To save the sequence
1) Open the project.
2) Select the sequence to be saved.
3) Select File> Save Sequence As.
4) Save Sequence As dialog will be launched.
5) Specify the name.
6) Selected sequence will be saved with specified name within the project.
Note: Sequence will be saved with specified name, only feature information of the sequence will
be copied.

46
Beacon Designer 5.10 Tutorial

Open Sequence
Sequences can be opened directly from Entrez, dbSNP or from files saved on your local drive.

Open Sequence from Entrez

Beacon Designer provides online access to Entrez. Sequences can be directly retrieved from
Entrez using this web integration feature.

1. Choose File>Open>Sequence>From Entrez or click button from the toolbar. Enter the
accession/ GI number.

2. You can open multiple sequences at a time. To open multiple sequences, type or paste the list
of accession/ GI numbers separated by comma, tab or new line.

For example you can type the following accession numbers: AJ300450, Y13051, AB036365 in
the open sequence window and click OK. The accession or GI numbers can be separated by
commas or tabs, or entered one number per line. The downloaded sequences will appear in the
Sequence Information table.

Open Sequence from dbSNP

Beacon Designer provides online access to dbSNP. Sequences can be directly retrieved from
dbSNP using this web integration feature and opened in the current project.

1. Choose File>Open>Sequence>From dbSNP or click button from the toolbar. Enter the
Assay ID.

2. You can open multiple sequences at a time. To open multiple sequences, type or paste the list
of Assay ID separated by comma, tab or new line.

Open Sequence from File

To open a sequence from a file saved on the local drive:

1. Choose File>Open>Sequence>From File or click button from the toolbar. In the file open
dialog, browse and select the sequence file you want to open and click Open. You can open
multiple sequences by selecting multiple files using Shift / Ctrl and click Open.

Open a different format sequence:

Beacon Designer supports sequences in GenBank and FASTA formats. To open a sequence of
another format first convert it to FASTA format as follows:
Copy the sequence in a text file and type a greater than sign (>) followed by a single line
comment before the first base.

For example:

Once a sequence is opened in the program it is automatically saved in the application database
and it will remain in the program until it is explicitly deleted. The sequence in the program is
displayed in the Sequence Information table in the main window. You can view the complete
sequence in your default browser by selecting View>Sequence Details.

47
Beacon Designer 5.10 Tutorial

Add Text Sequence

You can add a text sequence or a sequence from any other application not in supported format
by using this option.

1. Choose File>New>Sequence or click button from the toolbar.

2. In the New Sequence window type a single line definition for the sequence in the Sequence
Definition text field.

3. Now Type or paste the sequence bases in Sequence window and click Add.

You can import sequence from any other application by cutting and pasting the sequence bases
in the Sequence window. You can also edit the sequence manually by typing the sequence in the
editor.

Note: In demo mode, the program does not allow you to open a sequence from your local drive
or Entrez.

48
Beacon Designer 5.10 Tutorial

Load Multiple SNP

In Beacon Designer you can load hundreds of SNPs for designing probes for multiplex detection.
SNP's can be defined as Variation feature in GenBank file format.
You can open multiple sequences from Entrez containing SNP information in the following format:

Variation 1256

/replace="t"

Where Variation feature represent SNP information, 1256 is SNP position as base number, and
"t" represents the mutant base.
Beacon Designer will automatically identify the variation feature in this format as SNP information
and display it under the SNP Information Tab.

You can edit the GenBank sequences to add or modify the variation feature to match the
supported format.
To edit a sequence:
1. Download the sequence from Entrez. Select Online > Entrez Home to launch the Entrez
home page in the default browser.
2. Save the searched sequence on the local drive.
3. Open the sequence in a text editor such as Notepad and edit it to add SNP information as
variation feature in the supported format explained above.
4. Save the modified file and open it in the project using Open Sequence from File option. You
can open multiple sequences by selecting multiple files using Shift / Ctrl and clicking Open or by
selecting the sequence file containing the multiple sequences.

Load Unpublished SNP information

You can even design beacon or TaqMan(R) for unpublished SNPs from your own local SNP
database. You can load such non-GenBank SNP locations by first converting the sequence
information into a GenBank like format with SNP information as Variation features. To convert the
format, copy the sequence in a text file and add mandatory fields to it, as shown in the template.

49
Beacon Designer 5.10 Tutorial

Sample SNP information file

Please refer the template to incorporate the SNP information in the non-GenBank sequences.

50
Beacon Designer 5.10 Tutorial

Search Sequence
Search Sequence;

Sequences can be searched by their Accession number or Sequence Definition.

1) To search a sequence choose Edit > Find or click the button from toolbar.

2) Select the Search Criteria and type in either an accession number or Sequence Definition
keyword in the corresponding field.

3) The search can be made case-sensitive by checking the Match Case option.

Note: When searching by accession number complete accession number or the initial character
of the accession number can be used.

For example:

1. Select Accession Number under Search Criteria, Type L22214 in the corresponding field and
click Find.

2. The corresponding sequence gets highlighted. In case only the partial accession number is
known (L22), type the first few characters or numbers.

3. The Find function displays all the accession numbers starting with L22, choose the appropriate
and click Find.

4. Similarly, a search can be conducted using a keyword that appears in the sequence definition.

5. In case of L22214, the definition contains word "Adenosine".

6. Select Definition under Search Criteria, key-in "Adenosine" the corresponding field and click
Find.

7. Sequence definition in the Search window, will display search results for all the sequences that
include the word "Adenosine" in their sequence definition.

51
Beacon Designer 5.10 Tutorial

Avoid Cross Homology

Primers can be designed avoiding regions of cross homology. Beacon Designer will BLAST your
sequences, automatically interpret the results and will then design highly specific primers. Both
primers and amplicons can be BLAST searched using genomic database available at NCBI or
local customized database using the Standalone WWW BLAST server. Primers will already have
been designed to avoid cross homology. This will allow visualizing primer specificity.

Set Parameters for BLAST Search

To BLAST search a Sequence:

1. Select a sequence in the Sequence Information table .

2. Select menu Analyze > BLAST Search > Sequence or click button from the toolbar.
3. In the BLAST Search Sequence window, set parameters for BLAST Search and click Search.
4. As soon as the search is complete, the BLAST results are interpreted to identify the sequences
showing cross homology.
5. You can view the cross homology results by clicking the Cross Homology button in the
BLAST Information tab .
6. You can view BLAST result details in your default browser by selecting View>BLAST Details.

The time required to return the results for a sequence varies dramatically, depending on the load
on NCBI servers and the speed of your internet connection, from just a few seconds to several
minutes per search. If a sequence is BLASTed for a second time, the new results replace the
previous results. Thus Beacon Designer always displays the most recent BLAST results.

Example:

To BLAST search the sequence for avoiding cross homology:

1. Select sequences L22214 in the Sequence Information table.

2. Select Analyze> BLAST Search> Sequence from the menu or click from the toolbar.

3. In the BLAST Search Sequence window, all the parameters are set to default. i.e. Search
Type: Human genome BLAST, Genomes: Human Database: Ref RNA, Expect value is 10,
Filter unchecked.

4. Launch search by clicking the Search button.

5. As soon as the search is complete, the BLAST search results are interpreted to identify the
sequences exhibiting cross homology.

6. You can view the cross homology results by clicking the Cross Homology button in the BLAST
Information tab.

7. For sequence NM_026658, choose Search Type: Eukaryotic Genome BLAST, Genomes:
Mouse, Database: Ref RNA, Expect value 10, Filter unchecked.

8. For sequence ECs0219, choose Search Type: Microbial genome BLAST, Genomes:
Bacterial Genome: Escherichia coli O157:H7, Database: DNA, Expect value 10, Filter
unchecked.

52
Beacon Designer 5.10 Tutorial

Set Parameters for Local BLAST Search

1. Select menu Analyze> BLAST Search> Sequence or click button from the toolbar.
2. In the BLAST search window, select Search Type as Local Database BLAST.
3. Enter Server Name/ IP Address.
4. Click Genomes.
5. Select the local database category as of Human, Microbes or Other Genome and click OK.
6. Select the Database for BLAST search from the dropdown menu.
7. Click Search. As soon as the search is complete, the BLAST results are interpreted to identify
the sequences showing cross homology.
8. You can view the cross homology results by clicking the Cross Homology button in the
BLAST properties tab.
9. You can view the BLAST result details in your default browser by selecting menu
View>BLAST Details.

Note: The default parameters for BLAST search are optimized to report all the relevant cross
homologies for the query sequence. We recommend not changing these default values.

Set Parameters for Desktop BLAST Search

Desktop BLAST can BLAST search sequences against local custom databases without the need
of setting up a local BLAST server. For Desktop BLAST search, you must have sequence files
either .txt or .fa stored locally on your computer. You need to guide Beacon Designer to the
directory which contains .fa or .txt sequences and then BLAST search sequence against the
sequences.

The following instructions show how Array Designer can perform Desktop BLAST.

1) Select Analyze > BLAST Search > Sequence or click the button on the toolbar.
2) In the BLAST search window, select Deskop BLAST search.
3) Click on the Browse button to locate the directory having the sequence files.
4) Click Genomes.
5) Select the database category as of Human, Microbes or Others Genome and click OK.
6) Select the Database for BLAST search from the drop down menu.
7) Click Search. As soon as the search is complete, the BLAST results are interpreted to identify
the sequences showing cross homology.

8) You can view the homology results by clicking the button on the toolbar.
9) You can view the BLAST result details in your default browser by selecting menu View >
BLAST Details.

Note: For Desktop BLAST and the local database there is an editable text field for Expect Value,
for which the minimum value is 0.0001 and maximum value is 1000.

For BLAST, the search parameters are defaulted as:

Filter: Unchecked. The program automatically avoids low complexity and sequence repeats. If
the filter named 'Default' is checked, the query sequence will be masked and the cross homology
for the regions will not be reported, leading to a design in low complexity or repeat regions.

Expect = 10. It is the statistical significance threshold for reporting matches against database
sequences. If the statistical significance ascribed to a match is greater than the EXPECT
threshold, the match will not be reported. Lower EXPECT thresholds are more stringent, leading
to fewer chance matches being reported. Increasing the threshold shows less stringent matches.
In order to avoid cross homology, it is essential to select less stringent EXPECT thresholds for
which all relevant matches are reported.

53
Beacon Designer 5.10 Tutorial

To BLAST Search the Primer-pair / Amplicon / Probe

1. Select sequence in the Sequence Information table.

2. Select menu Analyze > BLAST Search > Primer-pair / Amplicon / Probe.

3. The Genome and database fields for BLAST search are consistent with the genome and
database fields chosen while BLAST searching the sequence. Set other parameters for BLAST
search and launch search.

4. The search results are displayed in BLAST Information tab in the main window.

5. You can view BLAST Primer-pair/Amplicon/Probe result details in your default browser by
clicking on "Completed" in the Search Status column in the BLAST Information tab in the Main
Window or by selecting menu View>BLAST Details > Primer-pair / Amplicon / Probe.

54
Beacon Designer 5.10 Tutorial

Interpreting Human BLAST Results

Cross

Human Ref RNA database is available for BLAST search at NCBI. It consists of ref-sequence
records. The query sequences submitted for BLAST search will show complete homology with
either the database copy of the mRNA sequence or its modeled transcript or with both, depending
on the differences in two sequences.
The database sequences showing cross homology with the query sequence are displayed in the
Avoid Cross Homology window. In this window, all the relevant cross homologies are checked.
The program considers the checked sequences for avoiding cross homology. You can uncheck a
sequence if you think it is not a relevant cross homology.

1. Select sequence L22214 in the Sequence Information table. BLAST the sequence against Ref
RNA database of Human.
2. Select View>Cross Homology from the menu or click the Cross-Homology button in the
BLAST Information Tab.
3. In the cross homology results for the sequence L22214, the first sequence shows complete
homology with the query sequence. These hits have E-Value of 0.0.
4. The sequences having E-Value of 0.0 remain unchecked by default. The program will not
consider these sequences as relevant cross homologies as these are the splice variants or
mRNA of the query sequence itself, present in the database .
5. For example: for sequence L22214, the first sequence having E-value 0.0 is NM_000674.1,
6. The sequence NM_000674.1 is the Homo sapiens adenosine A1 receptor (ADORA1) mRNA,
which is the same as the query sequence.
7. If you select this sequence for avoiding cross homology by checking the checkboxes opposite
it, the primer search will fail to design any primers because the entire sequence will be deemed
cross homologous.
8. The sequences showing relevant cross homology are NM_000675.3 and NM_000677.2 which
are mRNA for Homo sapiens adenosine A2a receptor (ADORA2A) and adenosine A3 receptor
(ADORA3).
9. These sequences are checked by default. The program will not design probes in the region
where these sequences show homology with the query.
10. The sequence L22214 shows cross homology with NM_000675.3 from bases 1134 to 1192
and 945 to 969, with NM_000677.2 from bases 689 to 740 and 820 to 852. The program will not
design any primers in these regions.
11. You can save the selection by clicking the OK button and proceed with primer design.

55
Beacon Designer 5.10 Tutorial

Interpreting Microbial BLAST Results

When the complete genome of an organism is represented in a single accession number, then
BLASTing a sequence against such a database will result in a single description The copy of the
query sequence in the database and all other relevant cross homologies are reported in that
single hit. To avoid relevant cross homologies, which are reported as different alignments,
microbial BLAST results are interpreted differently.
The database sequences showing cross homology with the query sequence are displayed in the
Avoid Cross Homology window. In this window, all the relevant cross homologies are checked.
The program considers the checked sequences for avoiding cross homology. You can uncheck a
sequence if you think it is not a relevant cross homology.

1. Select the sequence ECs0219 in the Sequence Information table.

2. Select View>Cross Homology from the menu or click the Cross-Homology button in the
BLAST Information Tab.
3. In the cross homology results for the sequence ECs0219, the alignment which shows 100%
homology with the query sequence, remains unchecked by default. The program will consider this
alignment as the database copy of the query sequence. For example: for the sequence ECs0219,
the alignment showing complete homology is from 1 to 189 bases.
4 If you select this alignment for avoiding homology, the program will fail to design any primers
because the entire sequence will be deemed as cross homologous.
5. Rest of the alignments from 88 to 102, 142 to 155, 83 to 96, 119 to 132, 151 to 164 and 176 to
189 bases show cross homology with the query sequence.
6. By default these alignments are checked. The program will not design primers in the region
where these alignments show homology with the query sequence.
7. You can save the selection by clicking the OK button and proceed with primer design.

56
Beacon Designer 5.10 Tutorial

Interpreting Cross Homology Results

Homology Results;

The database sequences showing cross homology with the query sequence are displayed in the
Avoid Cross Homology window. In this window, all the relevant cross homologies are checked.
The program considers the checked sequences for avoiding cross homology. You can uncheck a
sequence if it is not a relevant cross homology.

1. Select the sequence NM_026658 in the Sequence Information table.

2. Select View >Cross Homology from the menu or click the Cross-Homologybutton in the
BLAST Information Tab.
3. In the cross homology results for NM_026658, the first sequence shows complete homology
with the query sequence. The hit has an E-Value of 0.0. This encodes for Mus musculus
mitochondrial translation optimization 1 homolog (S.cerevisiae) (Mto1), mRNA.
4. This sequence remains unchecked by default. The program will not consider this sequence as
a relevant cross homology as it is the database copy of the query sequence.
5. For example: For sequence NM_026658, the first sequence that shows 100% homology is
NM_026658.1
6. If you select this sequence for avoiding homology with, the program will fail to design any
primers because the entire sequence will be deemed as cross homologous.
7. The sequences showing relevant cross homology are NM_009483.1, NM_153106.1,
NM_138721.1 which are Mus musculus ubiquitously transcribed tetratricopeptide repeat gene, X
chromosome (Utx), mRNA; Mus musculus peptidyl arginine deiminase, egg and embryo
abundant (Padi5), mRNA; and Mus musculus U7 snRNP-specific Sm-like protein LSM10
(Lsm10), mRNA.
8. By default these sequences are checked. The program will not design primers in the regions
where these sequences show homology with the query sequence.
9. You can save the selection by clicking OK and proceed with primer design.

57
Beacon Designer 5.10 Tutorial

Avoid Template Structures

A successful real-time PCR reaction requires efficient amplification of the product. Both primers
and target sequence affect this efficiency. Significant template secondary structure may prevent
the primers from annealing and therefore prevents complete product extension by the
polymerase.

While designing primers please note the following points:

1. Avoid designing primers in the region of template secondary structures, as at annealing

temperature these regions will not be available for primer- template hybridization. (The kinetics
always favors the intramolecular template secondary structure over the desired template-primer
annealing).

2. Avoid designing primers in the internal hairpin loop regions.

3. Avoid designing primers flanking template secondary structures.

4. Avoid designing primers immediately upstream of a secondary structure, the farther the primer
is from a secondary structure, the better.

Set Parameters for Template Secondary Structure Search

To search a sequence for Template Secondary Structures:

1. Select a sequence in the Sequence Information table.

2. Select menu Analyze > Template Structure Search or click button from the toolbar.
3. In the Template Structure Search window, set the parameters for Template Search and click
Search.
4. As soon as the search is complete, the Template Search results are interpreted to identify
regions of stable secondary structures.
5. You can view the Template Search results in your default browser by selecting View
>Template Structure Details.

The time required to return the results for a sequence varies dramatically, depending on the load
on Quikfold server and the speed of your internet connection, from just a few seconds to several
minutes per search. If a sequence is Template Searched for a second time, the new results
replace the previous results. Thus, Beacon Designer always displays the most recent Template
Structure Search results. Up to 1200 bp at a time can be submitted for folding to the
Quikfoldserver. Also, a valid e-mail address is essential for connecting to the Quikfold server.

Example:

To search a sequence for Template Secondary Structures:

1. Select sequences AJ300450 in the Sequence Information table.

2. Select Analyze > Template Structure Search from the menu or click from the toolbar.
3. In the Template Structure Search window, set Sequence Range as 1000 to 2100. Rest of the
parameters are set at their default values.
4. Enter a valid e-mail Address.
4. Launch search by clicking the Search button.
5. As soon as the search is complete, the Template Structure search results are interpreted to
identify regions of stable secondary structures.
6. You can view Template Search results in your default browser by selecting View >Template
Structure Details.

58
Beacon Designer 5.10 Tutorial

Beacon Design
Design;

Parameters for Primer Design

Beacon for a sequence can be designed only after a primer pair has been designed. You can
either design primers for a sequence using the software or evaluate pre-designed primer pairs. In
Beacon Designer you can automatically design primers for multiplex reactions. The primers
designed on multiple sequences in a single search with multiplex option selected are
automatically checked for cross-dimer formation with the primer pairs of other sequences chosen,
preventing competition in multiplex reactions. In Beacon Designer a maximum of five sequences
can be multiplexed for Beacon assays.

You can also check the beacons and primers designed in different search for multiplexing
compatibility by using Multiplex Primer . In order to design primers first set the parameters
for primer design.
Set Parameters for Primer Design:
To design primers for selected sequence(s) in Beacon Designer:
1. Open the sequence(s) in the current project.

2. Select the sequence(s) and choose Analyze >Primer Search or click button from the
toolbar.

3. Set the primer search parameters to meet your research needs. You can reset the parameters
to default values by clicking Default. The default values of most of the range parameters are set
loosely to ensure that the search succeeds in finding the best possible primer pair. The search
algorithm uses the target values or the middle of the range (except for the product length and the
primer length) to search for the best primers. If the range specified is narrow, no primers meeting
the specifications may result. We recommend using default values for primer search.

4. By default the Avoid Cross Homology option is checked. In this case the primers will be
designed avoiding homologous regions. Similarly the Avoid Template Structure option is
checked and by default, significant template secondary structures which may hinder the primers
from annealing are identified and avoided.

To design primers at these default values, the sequence(s) should already be BLASTed and a
template search done. You may choose to skip these steps and design primers without avoiding
cross-homology and/or template secondary structures. Simply uncheck these options in the
Primer Search Window before launching a search.

5. When multiple sequences are selected for a multiplex reaction, the primers in the pool will be
checked for cross dimers and the primers best suited for multiplex reaction will be displayed.

6. If the sequence(s) contain SNP information, the primers will be designed to amplify the SNP.

7. Click Search to launch a search.

8. Primer search parameters are saved for future searches.

For example:

1. Select sequence AJ300450 in the Sequence Information table.

2. In order to design primers avoiding template secondary structures, the sequence should be
evaluated for presence of stable secondary structures by folding it at Quikfold.
3. To launch Template Structures dialog select Analyze> Template Structures or click

59
Beacon Designer 5.10 Tutorial

from the toolbar.

4. Set template Search Range as from 1000 to 2100, for folding Human immunodeficiency virus
type 1 Gag core protein Gene sequence for which primers are to be designed.
5. BLAST search the sequence against a suitable database by selecting Analyze> BLAST
Search > Sequence.
7. Similarly select sequence Y13051 in the Sequence Information table.
8. Analyze the sequence for presence of template secondary structures using Analyze>
Template Structures. Set the Search Range as from 2339 to 3520 bp to fold Human T-cell
lymphotropic virus type 2 reverse transcriptase 'pol' gene.
9. BLAST search the sequence against suitable a database by selecting Analyze> BLAST
Search > Sequence.
10. Now proceed to design primers for the sequences, select Analyze >Primer Search or

click from the toolbar.

11. Set the Primer Search Parameters to their default values.
12. The Search Range for sequence AJ300450 is restricted to, 1 to 1200 bp, spanning Human
immunodeficiency virus type 1 Gag core protein Gene and that of Y13051 is restricted to 2339 to
3520bp spanning Human T-cell lymphotropic virus type 2 reverse transcriptase 'pol' gene.
13. Avoid Template Structure, Avoid Cross Homology, and Multiplex options are checked.
14. Click Search to launch a search.
15. As soon as the primer search is complete, the properties of the designed primer are displayed
in the Primer Properties table under the Beacon Properties tab with both, the individual and
primer pair rating. The primer rating is given to quantify the merit of primer with reference to the
search parameters. A primer rating of 100 indicates that the primer exactly matches the specified
search parameters.

60
Beacon Designer 5.10 Tutorial

Primer Search Results

Primer;

As soon as the primer search is complete the search quality status is displayed in the Search
Status Tab and the detailed result is displayed in the Primer properties table under Beacon
Properties tab.

1. The displayed result include both the sense and antisense primer rating, primer sequence,
position, length, melting temperature, GC%, maximum hairpin dG, maximum self dimer dG,
repeat and run length, optimum annealing temperature, maximum cross dimer dG, product
length, product Tm.
2. You can view all possible primer secondary structures in
View Secondary Structures window.
3. In the Sequence View, both sense and antisense primer positions are marked on the
sequence.
4. You can copy the primer sequence to the clipboard. Select Edit > Copy > Primer Sequence
or select Copy Primer Sequence option from pop-up menu available at right click (For Mac,
CTRL+click) over the primer sequence.

Example:

1. The primer search result for sequence AJ300450 displays sense and antisense primers along
with the free energy values for secondary structures and product properties. The designed primer
pair amplifies the Gag core protein gene of HIV-1 viral isolate.
2. Similarly, the primer search result for sequence Y13051 displays sense and antisense primers
along with the free energy values for secondary structures and product properties. The designed
primer pair amplifies Human T-cell lymphotropic virus type 2 reverse transcriptase 'pol' gene.
3. You can view the graphical view of all the primer secondary structures in Secondary Structures
window by clicking Primer All Structures option from pop-up menu available at right click (For
Mac, CTRL+click) over the Primer Properties table or by selecting View > Alternate > Primers.

You can replace the default primer pair with an alternate primer pair to meet your research needs.

1. Properties of the alternate primers are displayed in the All Primers window. Select any primer
pair.
2. Click the Replace button.
3. The selected primer pair will replace the default primer pair in the Primer Properties table.

Select alternate primer:

After designing primer you can replace the default primers by selecting any other primer pair from
the All Primers window.

1. To view alternate beacons click button.

2. The window displays the alternate primers. The window displays both the default primer
displayed under Primer Properties Tab and alternate primers. The primer which is displayed
under Primer Properties tab will be highlighted in All Primer window.

2. Select any primer pair in this window, it will be highlighted.

3. Click the Replace button.

Note: If Primer selected is not compatible with the Beacons displayed then a message ""

4. The selected beacon replaces the default primer pair in the Primer Properties tab and now will

61
Beacon Designer 5.10 Tutorial

be highlighted with grey color in All Primers window. The primer sequence and properties can be
printed and saved outside the program by using Export Beacon Results.

Sort Primers:

In All Primers window there will be facility to sort sense primer, antisense primer and product on
the basis of rating, position, length, Tm , GC%, Hairpin Delta G value and Self dimer delta G
values. Sorting is not available on sequence and S.No.

Note: Whenever All Primers window will be launched primers are always sorted on the basis of
Product rating.

62
Beacon Designer 5.10 Tutorial

Evaluate Primers

Evaluate Primers
In Beacon Designer, you can add pre-designed primers instead of designing primers using the
program. This is useful when you already have primers in your lab or are working with published
primer sequences.
To add and evaluate a primer pair for a sequence:
1. Select the sequence in the Sequence Information table.

2. Select Analyze > Evaluate Primers or click (In the SYBR(R) Green Primers Design mode
click ) button from the toolbar, to launch the Evaluate Primers window.
3. Type or paste the primer sequences in the given text field. The primers should always be
added in the 5' to 3' direction.
4. Beacon Designer analyzes and rates the added primers. The primers are analyzed using
existing primer search parameters from the Primer Search Parameters window.

For example:
1. Select the sequence AB036365.
2. Add the following primer sequences:
Sense Primer: 5' TGTCTGCATGTACCTCTACC 3'.
Antisense Primer: 5' AGTTCTTCTATTCGCTTGTAGG 3'.
Beacon Designer analyzes and rates these primers using existing primer search parameters,
which are currently set as default. The primer properties are displayed in Primer properties table.
3. To verify the specificity of the evaluated primer pair, you can BLAST search the primer pair
against the relevant database using Analyze>BLAST Search>Primer Pair/Amplicon.
4. Detailed BLAST search results are displayed in the default browser.

63
 Beacon Designer 5.10 Tutorial

Multiplex Results
;

In Beacon Designer you can design beacons and primers for multiplex reactions. By avoiding
homologies, competition can be avoided to maximize signal strength. A pool of primers can be
checked for cross homologies and then beacons designed that avoid cross homologies with all
primers in the pool.
In order to multiplex the primers:
1. Select the sequences in Sequence Information table. You can select up to five sequences for
multiplexing.
2. Select Analyze > Multiplex Primers or click from the toolbar.
3. Beacon Designer instantly analyzes all the selected primers and displays the most stable cross
dimers that are formed between the selected primers.
4. The multiplex results are displayed in Multiplex Results Window.

For example:
1. Select sequences AJ300450,Y13051 and AB036365 in Sequence Information table. Each of
these sequences has a primer pair, which you have designed or added in previous steps.
2. Multiplex these by selecting Analyze > Multiplex Primers.
3. Multiplex results show the most stable cross-dimer formed between two primers.
4. The cross dimers are displayed graphically along with the cross dimer dG.
5. By interpreting these results you can easily choose the most appropriate primers for a multiplex
reaction.

64
Beacon Designer 5.10 Tutorial

Design Beacons

Parameters for Beacon Design

Beacon Designer supports beacon design for multiplex and allele discrimination assays. You can
simultaneously design beacons on up to five sequences.

To proceed with beacon design:

1. Select the sequence for which primers are designed.

2. Select Analyze > Beacon Search or click button from the toolbar.
3. If necessary set the Beacon Search Parameters to meet your experimental requirements.
4. Beacon search parameters are saved for future search. You can reset the parameters to their
default values by clicking Default.
5. Launch a search by clicking Search.
The most important point to note is that beacons are designed with stems of appropriate length
adjusted automatically for optimal beacon Tm with reference to the primer pair TaOpt. The
designed beacon is checked for cross dimer formation with the amplifying primer pairs,
preventing competition in multiplex reactions. They are also checked for secondary structures,
and cross hybridization to ensure high signal strength.

Note: If the sequence has selected SNP, Beacon Designer will design both wild and mutant
beacons for the sequence. To overlook the SNP information while designing beacons, click or
the Unselect SNP button in the SNP Information tab or delete the existing SNP using Delete
SNP.

For Example:

1. Select sequences AJ300450, Y13051 and AB036365 on which you have already designed
primers.
2. Select Analyze > Beacon Search.
3. In the Beacon Search Parameters window set all parameters to default.
These parameters are defined in consultation with Sanjay Tyagi. The probe length will range
between 18 to 22 bases. The target melting temperature of output beacon is set 9 oC higher than
TaOpt, and the tolerance is +/- 5 oC. Beacon Designer will search beacons as close as possible to
the specified target value of Tm.
For example: If TaOpt is 55.4 oC, then the target Tm will be 64.4 oC and the range will be 59.4 oC
to 69.4 oC. The beacons with Tm equal to target are given the highest priority and the beacons
having a Tm outside this range is not considered. The universal stem sequences are given as
default. The stem of appropriate length is automatically selected and added for optimal beacon
Tm.
Advanced search parameters include the values for secondary structures such as self-dimers,
alternate hairpins, repeats and runs. The default values for secondary structures are set to
ensure high signal strength of output beacon. Beacons with value of self dimer, alternate hairpin,
cross dimer, repeats and runs greater than the specified value are discarded.
4. After setting parameters for beacon design, click Search.
5. The search quality Status will be immediately displayed in the Search Status tab. The detailed
beacon search results will be displayed in the Beacon Properties tab along with the beacon
rating.

65
Beacon Designer 5.10 Tutorial

Beacon Search Results

As soon as the beacon search is complete the search quality status is displayed in the Search
Status tab and the detailed results are displayed in Beacon Properties Tab.

1. Wild and mutant beacons are designed for sequences with SNP selected. Sense / antisense
beacons are designed for all the other sequences.
2. The displayed results include beacon rating, beacon sequence, position, length, probe melting
temperature, beacon hairpin Tm, maximum alternate hairpin dG, maximum self-dimer dG,
maximum cross-dimer dG, and the graphical view of the beacon hairpin structure.
3. In the Sequence View you can view the position of the beacon on the sequence.
4. You can view all possible beacon secondary structures in View Secondary structures
window.
5. You can copy the beacon sequence to the clipboard. Select Edit > Copy > Beacon Sequence
or select Copy Beacon Sequence option from pop-up menu available at right click (For Mac,
CTRL+click) over the Beacon Properties table.

Select alternate beacons:

After designing beacons you can replace the default beacon by selecting any other beacon from
the All Beacons window.

1. To view alternate beacons click button . These probes are displayed in the
order of their rating.
2. Select any beacon in this window, it will be highlighted.
3. Click the Replace button.
4. The selected beacon replaces the default beacon in the Beacon Properties tab. The beacon
sequence and properties can be printed and saved outside the program by using Export Beacon
Results.

Sort Beacons

In All Beacon window there will be facility to sort Beacons probe on the basis of rating, position,
length, Tm , GC%, Hairpin Delta G value and Self dimer delta G values. Sorting is not available
on sequence and S.No.

Note : Whenever All Beacons window will be launched Beacons are always sorted on the basis
of rating.

66
Beacon Designer 5.10 Tutorial

Evaluate Beacon

Evaluate Beacon
In Beacon Designer, you can add and evaluate pre-designed beacons. Such evaluation of
beacons would be desirable for:
a. Analysis in a stand alone single PCR reaction.
b. Analysis against other imported beacons.
c. Use evaluated beacon as a base for searching primers/beacons on other targets for
multiplexing.
To evaluate a beacon:
1. Select the sequence in the Sequence Information table.

2. Select Analyze > Evaluate Beacon or click button from the toolbar.

3. Type or paste the beacon sequence in the given text field. The beacon should always be
added in the 5' to 3' direction. You are also required to specify the stem length and a valid E-mail
address. The beacon hairpin Tm is calculated by connecting to the Quikfoldserver. A valid E-mail
address is essential for connecting to the Quikfoldserver.

4. When adding a beacon on the sequences already having a primer pair, you can either choose
to evaluate the added beacon for the existing primer pairs or design new primers optimized for
the added beacon.
5. To design primers optimized for the added beacon, check the Design Optimum Primers option
from the Evaluate Beacon window. By default the TaOpt of the designed primers will be 9 oC
lower than the evaluated beacon Tm. You can change the target TaOpt value to meet your
experimental requirements.

6. Beacon Designer analyzes and rates the added beacon. The beacon is analyzed using existing
beacon search parameters from the Beacon Search Parameters window.

For Example:

1. Select the sequence NM_026658 in the Sequence Information table.

2. Select Analyze > Evaluate Beacon, to launch the Evaluate Beacon window.
3. Paste the following beacon sequence in the given text field:
CGCGATCGGACTTAGAGTGAGGGCTTAGGGCAGATCGCG .
4. As the selected sequence does not have a primer pair, Beacon Designer will design primer pair
optimized for the evaluated beacon.
5. Beacon Designer analyzes and rates the added beacon. The beacon is analyzed using existing
beacon search parameters from the Beacon Search Parameters window. Then the search engine
proceeds to design an optimized primer pair. The primers are searched using existing primer
search parameters, which are set as default.
6. The beacon properties are displayed in the Beacon Properties tab. The primer properties are
displayed in Primer Properties table in the same tab.

67
Beacon Designer 5.10 Tutorial

Multiplex Beacons
Beacon Designer can design beacons and primers for multiplex reactions. The beacons designed
on multiple sequences in a single search are automatically checked for cross-dimer formation
with the amplifying primer pairs, preventing competition in multiplex reactions.

You can use the Multiplex Beacons option to check the multiplexing of beacons and primers
designed in different searches.
To multiplex beacons:
1. Select the sequences in Sequence Information table. You can select up to five sequences for
multiplexing.
2. Select Analyze > Multiplex Beacons or click from the toolbar.
3. Beacon Designer instantly analyzes all the selected sequences and displays the most stable
cross-dimers that are formed between the beacons and primers.
4. The multiplex results are displayed instantly in the Multiplex Results Window.

For example:

To design a multiplex reaction for detection of four different pathogenic retroviruses:

1. Select sequences AJ300450, AB036365 and Y13051 in the Sequence Information table. Each
of these sequences has a primer pair, which were designed or added in previous steps. These
primers amplify the conserved sequences of the gag gene of HIV-1, the env gene of HIV-2, the
tax gene of HTLV-I, and the pol gene of HTLV-II respectively.
2. Multiplex these by selecting Analyze > Multiplex Beacons .
3. Multiplex results show the most stable cross dimer formed between the primers and beacons
of the selected sequences.
4. The cross dimers are displayed graphically along with the cross dimer dG.
5. You are now ready to choose the most appropriate primer pairs and beacons for a multiplex
experiment.

68
Beacon Designer 5.10 Tutorial

Nucleic Acid Sequence Based Amplification PCR

Design Primers for NASBA(R)

Parameters for NASBA(R) Primer Design

Introduction : NASBA(R) is a transcription-based amplification method which amplifies RNA from

either an RNA or DNA target. It is an isothermal nucleic acid amplification process involving the
simultaneous activity of three enzymes; reverse transcriptase, RNase H and T7 RNA polymerase.
This technique utilizes two oligonucleotide primers in which the downstream antisense primer
contains a highly conserved 5’ promoter sequence recognized by T7 RNA polymerase. NASBA(R)
has broad applications in the field of RNA/DNA amplification and allele specific detection.

Parameters for NASBA(R) Primer design : Beacon for a sequence can be designed only after
a primer pair has been designed. You can either design primers for a sequence using the
software or evaluate pre-designed primer pairs. In Beacon Designer a maximum of five
sequences can be multiplexed for NASBA(R) assays.

Set Parameters for NASBA(R) Primer Design :

To design NASBA(R) primers for selected sequence(s) in Beacon Designer:

1. Select the sequence(s) and choose Analyze >Primer Search>NASBA(R) or click button
from the toolbar. When you click button from the toolbar the search window launched will have
“Standard” selected and to perform NASBA(R) Primers search select “NASBA(R)”.

2. Set the primer search parameters to meet your research needs. You can reset the parameters
to default values by clicking Default. The default values of most of the range parameters are set
loosely to ensure that the search succeeds in finding the best possible primer pair. The search
algorithm uses the target values or the middle of the range (except for the product length and the
primer length) to search for the best primers. If the range specified is narrow, no primers meeting
the specifications may result. We recommend using default values for primer search.

4. By default the Avoid Cross Homology option is checked. In this case the primers will be
designed avoiding homologous regions. Similarly the Avoid Template Structure option is
checked and by default, significant template secondary structures which may hinder the primers
from annealing are identified and avoided.

To design primers at these default values, the sequence(s) should already be BLASTed and a
template search done. You may choose to skip these steps and design primers without avoiding
cross-homology and/or template secondary structures. Simply uncheck these options in the
Primer Search Window before launching a search.

5. When multiple sequences are selected for a multiplex reaction, the primers in the pool will be
checked for cross dimers and the primers best suited for multiplex reaction will be displayed.

6. If the sequence(s) contain SNP information, the primers will be designed to amplify the SNP.

7. Click Search to launch a search.

8. Primer search parameters are saved for future searches.

For example:

69
Beacon Designer 5.10 Tutorial

1. Select sequence M95491 in the Sequence Information tableSelect sequence .

2. In order to design primers avoiding template secondary structures, the sequence should be
evaluated for presence of stable secondary structures by folding it at Quikfold.

3. To launch Template Structures dialog select Analyze> Template Structures or click

from the toolbar.
4. Set template Search Range as from 1 to 1200, for folding.
5. BLAST search the sequence against aT omato.fa in local database by selecting
Analyze>BLAST Search>Sequence.
6. Now proceed to design primers for the sequences, select Analyze >Primer
Search>NASBA(R) or click from the toolbar.
11. Set the Primer Search Parameters to their default values.
12. Avoid Template Structure, Avoid Cross Homology options are checked.
14. Click Search to launch a search.
15. As soon as the primer search is complete, the properties of the designed primer are displayed
in the Primer Properties table under the Beacon Properties tab with both, the individual and
primer pair rating. The primer rating is given to quantify the merit of primer with reference to the
search parameters. A primer rating of 100 indicates that the primer exactly matches the specified
search parameters.

70
Beacon Designer 5.10 Tutorial

NASBA(R) Primers Search Result

As soon as the NASBA(R) primer search is complete the search quality status is displayed in the
Search Status Tab and the detailed result is displayed in the Primer properties table under
Beacon Properties tab.

1. Primer P1 is displayed with tag and purine bases (if added). Tag sequence is represented in
italics and are green in color. Purine bases are also in italics but black in color.

For example : AATTCTAATACGACTCACTATAGGGAAATTCACTGGGAGGCTCTAAG

AATTCTAATACGACTCACTATAGGG - Tag sequence

AAA – Extra purine bases

TTTCACTGGGAGGCTCTAAG – Primer P1 sequence

2. The displayed result of P2 primer include rating, primer sequence, melting temperature,
position, length, GC%, maximum hairpin dG, maximum self dimer dG, repeat and run length,
optimum annealing temperature, maximum cross dimer dG, product length, product Tm.

The displayed results for primer P1 include melting temperature considering both tag and without
tag, GC%, maximum hairpin dG, maximum self dimer dG, maximum cross dimer dG considering
tag while repeat and run length, optimum annealing temperature, product length, product Tm
without considering tag.

Note: The rating of the Primer P1 includes the Tm value without tag.

2. You can view all possible primer secondary structures from View>All Structures> Primers or
select option from pop-up menu available at right click over the primer sequencePrimer All
Structure.

3. In the Sequence View, both P1 and P2 primer positions are marked on the sequence.

4. You can copy the primer sequence to the clipboard. Select Edit > Copy > P1 Primer or P2
Primer respectively or select Copy P1 Primer or P2 Primer Sequence option from pop-up menu
available at right click (For Mac, CTRL+click) over the primer sequence.

Example:

1. The primer search result for sequence M95491 displays P1 and P2 primers along with the free
energy values for secondary structures and product properties.

2. You can view the graphical view of all the primer secondary structures in Secondary Structures
window by clicking All Structures option from pop-up menu available at right click over the
Primer Properties table or by selectingView > Alternate > Primers.

You can replace the default primer pair with an alternate primer pair to meet your research needs.

1. Properties of the alternate primers along with the primer displayed under Beacon properties tab
are displayed in the All Primers window. Primer pair displayed under Beacon properties tab is
marked with grey color in All Primers window.

2. Select any primer pair.

71
Beacon Designer 5.10 Tutorial

2. Click the Replace button.

3. The selected primer pair will replace the default primer pair in the Primer Properties table and
will now be marked in grey color in All Primers window.

Select alternate primer:

After designing primer you can replace the default primers by selecting any other primer pair from
the All Primers window.

1. To view alternate beacons click button.

2. The window displays the alternate primers. The window displays both the default primer
displayed under Primer Properties Tab and alternate primers. The primer which is displayed
under Primer Properties tab will be highlighted in All Primer window.

2. Select any primer pair in this window, it will be highlighted.

3. Click the Replace button.

4. The selected beacon replaces the default primer pair in the Primer Properties tab and now will
be highlighted with grey color in All Primers window. The primer sequence and properties can be
printed and saved outside the program by using Export Beacon Results.

Sort Primers:

In All Primers window there will be facility to sort P1 primer, P2 primer and product on the basis of
rating, position, length, Tm , GC%, Hairpin Delta G value and Self dimer delta G values. Sorting is
not available on sequence and S.No.

Note : Whenever All Primers window will be launched primers are always sorted on the basis of
Product rating.

72
Beacon Designer 5.10 Tutorial

Evaluate Primers

Evaluate NASBA(R) Primers

In Beacon Designer, you can add pre-designed NASBA(R) primers instead of designing primers
using the program. This is useful when you already have primers in your lab or are working with
published primer sequences.

1. Select the sequence in the Sequence Information table.

2. Select Analyze>Evaluate Primers>NASBA(R) or click button from the toolbar, to launch

the Evaluate Primers window. When Evaluate Primer dialog is launched from toolbar then select
NASBA(R).

3. Type or paste the primer sequences in the given text field. The primers should always be
added in the 5' to 3' direction and without Taq sequence.

Note : Do not add primer sequence with tag. During process of evaluation program itself will add
the tag to P1 Primer.

4. Beacon designer also allow you to use the pre-designed SYBR Green primers on sequence by
checking Import SYBR Green primers option. Program will display the SYBR Green primers in
P1 and P2 primers text field.

5. Beacon Designer analyzes and rates the added primers. The primers are analyzed using
existing NASBA(R) primer search parameters from the Primer Search Parameters window.

For example:

1. Select the sequence AF209198.

2. Add the following primer sequences:

P2 Primer: GGTTCTCCATCTGTGCCTTG
P1 Primer: ACATCAGCTATGACAATCTTATGC

Beacon Designer analyzes and rates these primers using existing primer search parameters,
which are currently set as default. The primer properties are displayed in Primer properties table.

3. To verify the specificity of the evaluated primer pair, you can BLAST search the primer pair
against the relevant database using Analyze>BLAST Search>Primer Pair/Amplicon.

4. Detailed BLAST search results are displayed in the default browser.

73
Beacon Designer 5.10 Tutorial

Multiplex NASBA(R) Primers

In Beacon Designer you can design beacons and primers for multiplex NASBA(R) reactions. By
avoiding homologies, competition can be avoided to maximize signal strength. A pool of primers
can be checked for cross homologies and then beacons designed that avoid cross homologies
with all primers in the pool.

In order to multiplex the primers:

1. Select the sequences in Sequence Information table. You can select up to five sequences for
multiplexing on which Primers for NASBA(R) assay is designed.

Note: Sequence having different types of Primers i.e. Standard and NASBA(R) cannot be used for
multiplexing.
2. Select Analyze>Multiplex Primers or click from the toolbar.
3. Beacon Designer instantly analyzes all the selected primers and displays the most stable cross
dimers that are formed between the selected primers.
4. The multiplex results are displayed in Multiplex Results Window.

For example:
1. Select sequences AF506281, AB031207, M95491 in Sequence Information table. Each of
these sequences has a NASBA(R) primer pair, which you have designed or added in previous
steps.
2. Multiplex these by selecting Analyze>Multiplex Primers.
3. Multiplex results show the most stable cross-dimer formed between two primers.
4. The cross dimers are displayed graphically along with the cross dimer dG.
5. By interpreting these results you can easily choose the most appropriate primers for a multiplex
reaction.

74
Beacon Designer 5.10 Tutorial

Design Beacons For NASBA(R)

Parameters for NASBA(R) Beacon Design

Beacon Designer supports NASBA(R) beacon design for multiplex and allele discrimination
assays. You can simultaneously design beacons on up to five sequences. In NASBA(R) assay
always sense beacons are designed and MFold tends is used predict the secondary structure
and melting temperature of molecular baecons. The parameters which are used to calculate
molecular beacon Tm at Mfold for NASBA(R) assay are:

Nucleic Acid concentration 0.25nM

Monovalent Ion concentration 100mM

Free Mg Ion concentration 12mM

Total Na Equivalent 538.18mM

Temperature for beacon Energy calculation 41ºC

To proceed with beacon design:

1. Select the sequence for which primers are designed.

2. Select Analyze > Beacon Search > NASBA(R) or click button from the toolbar.

3. If necessary set the Beacon Search Parameters to meet your experimental requirements.

4. Beacon search parameters are saved for future search. You can reset the parameters to their
default values by clicking Default.

5. Launch a search by clicking Search. The most important point to note is that beacons are
designed with stems of appropriate length adjusted automatically for optimal beacon Tm with
reference to the primer pair TaOpt. The designed beacon is checked for cross dimer formation
with the amplifying primer pairs, preventing competition in multiplex reactions. They are also
checked for secondary structures, and cross hybridization to ensure high signal strength.

Note: If the sequence has selected SNP, Beacon Designer will design both wild and mutant
beacons for the sequence. To overlook the SNP information while designing beacons, click or the
Unselect SNP button in theSNP Information tab or delete the existing SNP using Delete SNP.

For Example:

1. Select sequence M95491 which you have already designed primers.

2. Select Analyze>Beacon Search>NASBA(R).
3. In the Beacon Search Parameters window set all parameters to default.
4. After setting parameters for beacon design, click Search.
5. The search quality Status will be immediately displayed in the Search Status tab. The detailed
beacon search results will be displayed in the Beacon Properties tab along with the beacon
rating.

75
Beacon Designer 5.10 Tutorial

NASBA(R) Beacon Search Results

As soon as the NASBA(R) Beacon search is complete the search quality status is displayed in the
Search Status tab and the detailed results are displayed in Beacon Properties Tab.

1. Wild and mutant beacons are designed for sequences with SNP selected. Sense / antisense
beacons are designed for all the other sequences.
2. The displayed results include beacon rating, beacon sequence, position, length, probe melting
temperature, beacon hairpin Tm, maximum alternate hairpin dG, maximum self-dimer dG,
maximum cross-dimer dG, and the graphical view of the beacon hairpin structure.
3. In the Sequence View you can view the position of the beacon on the sequence.
4. You can view all possible beacon secondary structures in View Secondary structures
window.
5. You can copy the beacon sequence to the clipboard. Select Edit > Copy > Beacon Sequence
or select Copy Beacon Sequence option from pop-up menu available at right click (For Mac,
CTRL+click) over the Beacon Properties table.

Note : For NASBA(R) assay only sense beacons are designed.

Select alternate beacons:

After designing beacons you can replace the default beacon by selecting any other beacon from
the All Beacons window.

1. To view alternate beacons click button.

2. The window displays the alternate Beacons the window displays both the default beacon
displayed under Beacon Properties Tab and alternate Beacon The probe which is displayed
under Beacon Properties tab will be highlighted in All Beacon window. The probes are displayed
in the order of their rating.

2. Select any beacon in this window, it will be highlighted.

3. Click the Replace button.

4. The selected beacon replaces the default beacon in the Beacon Properties tab and now will be
highlighted with grey color in All Beacons window. The beacon sequence and properties can be
printed and saved outside the program by using Export Beacon Results.

Sort Beacons

In All Beacon window there will be facility to sort Beacons probe on the basis of rating, position,
length, Tm , GC%, Hairpin Delta G value and Self dimer delta G values. Sorting is not available
on sequence and S.No.

Note: Whenever All Beacons window will be launched Beacons are always sorted on the basis of
rating.

76
Beacon Designer 5.10 Tutorial

Evaluate Beacons For NASBA(R)

Evaluate Beacons For NASBA(R)

In Beacon Designer, you can add and evaluate pre-designed beacons for NASBA(R) assay. Such
evaluation of beacons would be desirable for:
a. Analysis in a stand alone single PCR reaction.
b. Analysis against other imported beacons.
c. Use evaluated beacon as a base for searching primers/beacons on other targets for
multiplexing.

To evaluate a beacon:

1. Select the sequence in the Sequence Information table.

2. Select Analyze > Evaluate Beacon or click button from the toolbar.

Note : If primers are designed for NASBA(R) assay then you can evaluate beacons for this assay
only.

3. Type or paste the beacon sequence in the given text field. The beacon should always be
added in the 5' to 3' direction.

Note: Only sense beacons can be evaluated for NASBA(R) assay.

You are also required to specify the stem length and a valid E-mail address. The beacon hairpin
Tm is calculated by connecting to the Quikfoldserver. A valid E-mail address is essential for
connecting to the Quikfoldserver.

4. When adding a beacon on the sequences already having a primer pair, you can either choose
to evaluate the added beacon for the existing primer pairs or design new primers optimized for
the added beacon.

5. To design primers optimized for the added beacon, check the Design Optimum Primers option
from the Evaluate Beacon window. By default the TaOpt of the designed primers will be 9 oC
lower than the evaluated beacon Tm. You can change the target TaOpt value to meet your
experimental requirements.

Note: On checking Design optimum primer pair option you also have the facility to select the
type of assay either Standard or NASBA(R).

6. Beacon Designer Analyzes and rates the added beacon. The beacon is Analyzed using
existing beacon search parameters from the Beacon Search Parameters window.

For Example:

1. Select the sequence L22214 in the Sequence Information table.

2. SelectAnalyze > Evaluate Beacon, to launch the Evaluate Beacon window.

3. Paste the following beacon sequence in the given text field:

CGCGACTCTAACCATGACTCGGACCTGATCGCG

77
Beacon Designer 5.10 Tutorial

4. As the selected sequence does not have a primer pair, Beacon Designer will design primer pair
optimized for the evaluated beacon.

5. Beacon Designer analyzes and rates the added beacon. The beacon is analyzed using existing
beacon search parameters from the Beacon Search Parameters window. Then the search engine
proceeds to design an optimized primer pair. The primers are searched using existing primer
search parameters, which are set as default.

6. The beacon properties are displayed in the Beacon Properties tab. The primer properties are
displayed in Primer Properties table in the same tab.

78
Beacon Designer 5.10 Tutorial

Multiplex Beacons For NASBA(R)

Beacon Designer can design beacons and primers for NASBA(R) multiplex reactions. The
beacons designed on multiple sequences in a single search are automatically checked for cross-
dimer formation with the amplifying primer pairs, preventing competition in multiplex reactions.

You can use the Multiplex Beacons option to check the multiplexing of beacons and primers
designed in different searches.
To multiplex beacons:
1. Select the sequences in Sequence Information table. You can select up to five sequences for
multiplexing on which Beacons for NASBA(R) assay are designed

Note: Sequence having different types of Beacons probes i.e. Standard and NASBA(R) cannot be
used for multiplexing.

2. Select Analyze > Multiplex Beacons or click from the toolbar.

3. Beacon Designer instantly analyzes all the selected sequences and displays the most stable
cross-dimers that are formed between the beacons and primers.
4. The multiplex results are displayed instantly in the Multiplex Results Window.

79
Beacon Designer 5.10 Tutorial

TaqMan(R) Design
Parameter for T(R) Probe Design;

Parameters for TaqMan(R) Probe Design

Beacon Designer supports TaqMan(R) probe design for multiplex and allele discrimination assays.
You can automatically design TaqMan(R) probes checked for multiplexing, on up to four
sequences The probes designed on multiple sequences in a single search are automatically
checked for cross-dimer formation with the primer pairs of other sequences, preventing
competition in multiplex reactions. You can also use the Multiplex TaqMan(R) option to check the
multiplexing of TaqMan(R) and primers designed in different search. The TaqMan(R) probe and the
primers are designed simultaneously. To design an assay, first set parameters for TaqMan(R)
design.

Steps for TaqMan(R) probe design:

1. Select the sequence in the Sequence Information table.

2. Select Analyze > TaqMan(R) Search > Standard or click button from the toolbar.
3. If necessary set the TaqMan(R) Search Parameters to meet your experimental requirements.
You can reset the parameters to default values by clicking Default. The default values of most of
the range parameters are set loosely to ensure that the search succeeds in finding the best
possible primer pair. These values do NOT affect the quality of the resulting primers, they only
serve as the minimum and maximum acceptable limits. The search algorithm uses the target
values or the middle of the range (except for the product length and the primer length) to optimize
the primers. If the range specified is narrow, no TaqMan(R) meeting the specifications may result.
We recommend the use of default values for TaqMan(R) search.
4. By default, the Avoid Cross Homology option is checked. In this case the primers will be
designed avoiding homologous regions.
By default, the Avoid Template Structure option is checked. The regions of template with
secondary structure will be avoided while designing primers.
If you would like to design primers at these default values, the sequence(s) should already be
BLASTed and a template search done. Otherwise these options should be unchecked before
launching a TaqMan(R) search.
5. When multiple sequences are selected for a multiplex reaction, the primers designed will be
checked for cross dimers and the best primers with respect to multiplexing will be displayed.
6. If the sequences contain SNP information, the primers will be designed to amplify the SNP.
7. Launch search by clicking the Search.
8. Primer search parameters are saved for future searches. You can reset the parameters to their
default by clicking Default.
The most important point to note is that the optimal primers are designed as close as possible to
the TaqMan(R) probes without overlapping it. The TaqMan(R) probes of sequences selected for
multiplexing are checked for cross dimers with each other and with all the designed primers,
preventing competition in multiplex reactions. They are also checked for secondary structures,
and cross hybridization to ensure high signal fidelity.

Note: If the sequence has selected SNP, Beacon Designer will design both wild and mutant
TaqMan(R) probes for the sequence. To overlook the SNP information while designing TaqMan(R)
probe, click the Unselect SNP button in the SNP Information tab or delete the existing SNP using
Delete SNP.

For Example:

To design a multiplex reaction for detection of four different pathogenic retroviruses:

1. Select sequences Y13051 and AJ300450 in the Sequence Information table.
2. Select Analyze > TaqMan(R) Search > Standard.

80
Beacon Designer 5.10 Tutorial

3. In the TaqMan(R) Search Parameters window set all parameters to default. These parameters
are defined according to TaqMan(R) design guidelines.
4. Avoid Template Structure, Avoid Cross Homology, and Multiplex options are checked.
Note, to design primers at these default values, the sequence(s) should already be BLASTed and
a template search done.
5. The Search Range for Y13051 is restricted to 2339 to 3520 bp to design primer pair to amplify
Human T-cell lymphotropic virus type 2 reverse transcriptase 'pol' gene.
6. Similarly the Search Range for sequenceAJ300450 is restricted to 1 to 1079 band for
AF185802 is 1 to 464 bp. To amplify conserved sequences of HTLV-I tax gene, Human
immunodeficiency virus type 1 Gag core protein gene and the env gene of HIV-2 respectively.
7. By default the Multiplexing option is checked, i.e the program will check the TaqMan(R) probes
of selected sequences for cross dimers with each other and with all the designed primers. Each
designed TaqMan(R) probe is always checked for cross dimers with the amplifying primer pair.

The probe and primer length will range between 20 to 24 bases. The target melting temperature
of the designed TaqMan(R) probe is set 10 oC higher than the primer melting temperature with a
tolerance of +/- 2 oC. Beacon Designer will search TaqMan(R) probes as close as possible to the
specified target value of Tm.
For example: If primer Tm is 59.0 oC, then the target TaqMan(R) Tm will be 69.0 oC and the range
will be 67.0 oC to 71.0 oC. The TaqMan(R) having Tm equal to target will be given highest priority
and the TaqMan(R) having a Tm outside this range will not be considered. The optimal primer for
the same strand as the TaqMan(R) will be designed, such that the 3' end of the primer is within 10
bases of the probe without overlapping the probe sequence.
The Advanced search parameters include the maximum acceptable values for secondary
structures such as self-dimers, hairpins, cross-dimers, repeats, and runs in primers and
TaqMan(R) probes. The default values for secondary structures are set to ensure high signal
strength of the designed TaqMan(R). TaqMan(R) probes and primers having values for self-dimer,
hairpin, cross-dimer, repeats and runs greater than the specified value are discarded.
Additional parameters such as GC clamp, 3'end stability and maximum difference between primer
pair Tm are considered for the designed optimum primers.

8. After setting the parameters for TaqMan(R) design, launch search by clicking Search.
9. The search quality status will be immediately displayed in the Search Status tab. The detailed
TaqMan(R) search results will be displayed in the TaqMan(R) Properties tab and the primer search
results will be displayed in the Primer Properties table along with the primer rating.

Search Results;

81
Beacon Designer 5.10 Tutorial

TaqMan(R) Probe Search Results

) Probe

As soon as the TaqMan(R) search is complete the search quality status is displayed in the Search
Status Tab, the detailed results are displayed in TaqMan(R) Properties Tab and the location of
TaqMan(R) on the sequence is displayed in the Sequence view.

1. Wild and mutant TaqMan(R) probes are designed for sequences with a SNP selected. The best
TaqMan(R) whether sense or antisense, is designed for sequences without a SNP selected.
2. The displayed results include TaqMan(R) rating, sequence, position, length, probe Tm, GC%,
maximum hairpin dG, maximum self-dimer dG, maximum cross-dimer dG.
3. You can view all possible TaqMan(R) secondary structures in View Secondary Structures
window.
4. In the Sequence View, you can view the location of the TaqMan(R) on the sequence .
5. You can copy the TaqMan(R) sequence to the clipboard. Select Edit > Copy > TaqMan(R)
Sequence or select Copy TaqMan(R) sequence option from pop-up menu available at right click
(For Mac, CTRL+click) over the TaqMan(R) sequence.

Select Alternate TaqMan(R) Probe:

After designing TaqMan(R) you can replace the default TaqMan(R)probe by selecting any other
TaqMan(R) that meets your research needs better. Other TaqMan(R) probes are available in the All
TaqMan(R) window.

1. To view alternate TaqMan(R) probes click the button.

2. The window displays both the alternate TaqMan(R) and the associated primer pair.The window
displays both the best and alternate TaqMan(R) with their associated primer pair. The probe which
is displayed under TaqMan Properties tab will be highlighted in All TaqMan window. The probes
are displayed in the order of their rating in the upper half of the window.

3. Select any TaqMan(R) in this window. The optimum primer pairs associated with the selected
TaqMan(R) probe are displayed in the All Primers window.

4. By default the best primer pair will be selected. You can select any other primer pair by
highlighting it.

5. Click the Replace button.

6. The selected TaqMan(R) probe replaces the default TaqMan(R) probe in the TaqMan(R)
Properties tab and the selected primer pair will replace the default primer pair. The probe that
replaces the default probe set will be highlighted by the grey background in the All TaqMan
window.

Sort TaqMan and Primers:

In All TaqMan window there will be facility to sort TaqMan probe sense primer, antisense primer
and product on the basis of rating, position, length, Tm , GC%, Hairpin Delta G value and Self
dimer delta G values. Sorting is not available on sequence and S.No.

Note: Whenever All TaqMan and All primers window will be launched, TaqMan and primers are
always sorted on the basis of Product rating.

82
 Beacon Designer 5.10 Tutorial

Evaluate TaqMan (R) Probes

);

Evaluate TaqMan (R) probes

In Beacon Designer, you can add and evaluate pre-designed TaqMan(R) and Primer pairs. Such
evaluation would be desirable for:
a. Adapting SYBR (R) green results to TaqMan(R) assays.
b. Analysis against other imported TaqMans(R) probes.
c. Use evaluated TaqMan(R) or Primers as a base for searching primers/TaqMan(R) on other
targets for multiplexing.

To evaluate a primer pair and designing optimum TaqMan(R) probes:

1. Select the sequence in the Sequence Information table.

2. Select Analyze > Evaluate TaqMan(R) > Standard or click from the toolbar.
3. Select Evaluate Primer Pairs from the drop-down menu, to evaluate the added primer pair and
design optimized TaqMan(R) probe.
4. Type or paste the primer sequences in the given text field. The primers should always be
added in the 5' to 3' direction.
5. The default values for TaqMan(R) Search parameters are set to ensure that the search
succeeds in finding the most optimum TaqMan(R) probe for the evaluated primer pair. You can
change these default values to suit your experimental requirements.
6. Beacon Designer anlyzes and rates the added Primer pair. The Primer pair is analyzed using
existing Primer search parameters from the TaqMan Parameters Search window.

For example:
1. Select the sequence L22214 in the Sequence Information table.
2. Select Analyze > Evaluate TaqMan(R) > Standard, to launch Evaluate TaqMan(R) window.
3. Select Evaluate Primer Pairs from the drop-down menu, to evaluate the added primer pair and
design optimized TaqMan(R) probe.
3. Paste the following primer sequences:
Sense Primer: 5' GCCCAGCATCCTTACCTACATT 3'.
Antisense Primer: 5' AAGGTGACGCGGAACTTCTG 3'.
4. Set the TaqMan(R) Search Parameters to Default.
5. Click OK to evaluate the added primer pairs and design optimum TaqMan(R) probe.
Beacon Designer analyzes and rates these primers using existing primer search parameters,
which are currently set as default. The primer properties are displayed in Primer Properties table
and the designed TaqMan(R) Properties are displayed in the TaqMan(R) Properties Tab.
6. To verify the specificity of the evaluated primer pair, you can BLAST search the primer pair
against the relevant database using Analyze > BLAST >Primer Pair option.
7. Detailed BLAST search results are displayed in the default browser.

83
Beacon Designer 5.10 Tutorial

Multiplex TaqMan(R)
In Beacon Designer you can design TaqMan(R) probes and primers for multiplex reactions. The
TaqMan(R) designed on multiple sequences in a single search at default values are automatically
checked for cross-dimers with each other and with all the designed primers, preventing
competition in multiplex reactions.
You can also use the Multiplex TaqMan(R) option to check the multiplexing of TaqMan(R) probes
and primers designed in different search runs.
In order to multiplex TaqMan(R):
1. Select the sequences in Sequence Information table. You can select up to four sequences for
multiplexing having Standard TaqMan design.

Note : Sequence having different types of TaqMan probes i.e. Standard and LNA(TM) Substitued
cannot be used for multiplexing.
2. Select View > Multiplex TaqMan(R) or click from the toolbar.
3. Beacon Designer instantly anlyzes all the selected sequences and displays the cross-dimers
that are formed between the TaqMan(R) and primers.
4. The multiplex results are displayed instantly in the Multiplex Results Window.

84
Beacon Designer 5.10 Tutorial

Multiplex Taqman® Assay

Design TaqMan probes and primers for multiplex assay

Multiplex PCR is an essential cost saving technique for an endless list of applications including
large scale genotyping, gene expression, whole genome sequencing, forensic analysis and also
facilitate the diagnosis of infectious disease.

Multiplex PCR primer design and optimization is a greater challenge than designing singleplex
PCR primer design. The aim of multiplex is to find sets of primer that can be used in a single PCR
reaction to amplify many sequences simultaneously. Beacon Designer finds the multiplex set that
matches these criterion by first finding all the acceptable primer pair for each of the targets, then
testing every combination and giving back those sets that meet the criterion.

Here is how to design Multiplex set for Taqman probes and primers for Multiplex assay:

1) Select more than one sequence.

2) Select Analyze> Multiplex TaqMan® > Standard or click button on tool bar.
3) Set “Multiplex Taqman Search parameters ” to meet your experimental need. You can reset
the parameters to the default values by clicking Default button.
4) Specify the Reaction conditions.
5) Click Search button to launch the search.
6) After the search is complete results will be displayed under Multiplexing results tab.
For Example:
1) Select Sequences NM_026658 and L22214 from sequence information table.

2) Select Analyze> Multiplex TaqMan® > Standard or click button on tool bar.
3) Specify the “Multiplex Set Name” Set 2.
4) Check Avoid Template Structure, Avoid Cross homology.
5) Set “Multiplex Taqman Search parameters ” to meet your experimental need. You can reset
the parameters to the default values by clicking the Default button.
6) Set the Reaction conditions to the default values by clicking the Default button.
7) The Search Range for NM_026658 is restricted to 1-1200bp, for sequence L22214 is
restricted to1-1200 bp BP to design primer pair.
8) After setting the parameters for TaqMan® design, launch search by clicking Search.
9) As soon as search is complete results will be displayed under multiplexing results tab. Under
this tab, left pane displays multiplexed group and right pane displays sequences corresponding to
multiplexed group. The best multiplex set for selected multiplexed group is shown under the
TaqMan properties tab.

Following steps are followed while performing TaqMan Multiplexing:

A) Select Sequences "a" and "b"

85
Beacon Designer 5.10 Tutorial

B) First of all TaqMans and Primers are searched on the selected Sequences.

C) For example: Say there is one taqman and 3 primer pair for each of the sequences a and b

Taqman for sequence a - Ta

Sense Primer for Sequence a – Sa1, Sa2, Sa3

Antisense Primer for sequence a – Aa1, Aa2, Aa3

Taqman for sequence b - Tb

Sense Primer for Sequence b – Sb1, Sb2, Sb3

Antisense Primer for sequence b – Ab1, Ab2, Ab3

D) Firstly TaqMan-TaqMan Multiplexing is carried out between the Taqmans of different

sequences for forming the individual TaqMan-Group. They are checked for cross dimer and Tm
difference. While Taqman- Taqman multiplexing following combinations will be checked for cross
dimer dG and Tm difference.

Ta : Tb

E) Then Taqman-Primer Multiplexing is carried out. In this step each TaqMan group from the set
of TaqMan Groups is taken and all the TaqMan's of this TaqMan Group are Multiplexed with the
associated primers for all the other sequence's.

Say we consider the taqman group ( Ta : Tb) then following combinations will be checked while
the Taqman- Primer multiplexing-

Taqman of sequence “a” will be checked with 3 primer pair of sequence "b"

Ta : Sb1, Ta : Ab1, Ta : Sb2, Ta : Ab2, Ta : Sb3, Ta: Ab3,

Taqman of sequence “b” will be checked with 3 primer pair of sequence "a".

Tb : Sa1, Tb: Aa1, Tb : Sa2, Tb : Aa2, Tb : Sa3, Tb : Aa3

Primers which gets failed in TaqMans-Primers multiplexing(Cross Dimer dG values and Tm

difference) are rejected.

F) Then Primer-Primer multiplexing is carried out. In this step, the primers associated with the
TaqMans of a TaqMan Group are Multiplexed with the associated Primers of TaqMan's of all
other sequences.

Say we consider Ta : Sb1 and Ta : Ab1 group, Ta : Sb3 , Ta: Ab3 group and Tb : Sa2, Tb : Aa2
group then the following combination will be checked for Primer-Primer Multiplexing.

Sb1 : Sa2 , Ab1 : Sa2

Sb1 : Aa2 , Ab1 : Aa2

Sb3 : Sa2, Ab3 : Sa2

Sb3 : Aa2, Ab3 : Aa2

Again the group that fails in Cross Dimer dG values are rejected.

86
Beacon Designer 5.10 Tutorial

G) As soon as any of the Primer Pair multiplexing for any combination is passed, then again it is
returned to the D step again. Say we consider Sb1 : Sa2 , Ab1 : Sa2 and Sb1 : Aa2 , Ab1 : Aa2
combination is passed.

H) Finally this first passed TaqMan Group is reported as the Best Multiplexed TaqMan Group for
the selected Sequences.

Here the multiplex set reported would be Ta : Sa2 : Aa2 for sequence “a” and Tb: Sb1: Ab1

87
Beacon Designer 5.10 Tutorial

Multiplex TaqMan(R) and Primer for Reference gene multiplexing

Multiplex RT-PCR using reference genes as a reference against the gene of interest is one of the
most widely accepted technique used now a days. This involves concurrent amplification of the
target gene and reference gene.

Beacon Designer designs Multiplex sets for Taqman probes and primers for reference gene
multiplexing. Beacon Designer finds the multiplex set that matches these criterion by first finding
all the acceptable primer pair for each of the targets, then testing every combination and giving
back those sets that meet the criterion.

Here is how to design Multiplex sets for Taqman probes and primers for reference gene
multiplexing-

1) Select more than one sequence.

2) Select Analyze> Multiplex TaqMan® > Standard or click button on tool bar.
3) Specify “Multiplex set name”.
4) Set “Multiplex Taqman Design parameters ” to meet your experimental need. You can reset
the parameters to the default values by clicking the Default button.
5) You can select a reference gene under the “Sequence length range/ reference gene
selection” segment. Maximum three sequences can be selected as a reference gene. To select
a sequence as a reference gene it should have pre-designed primers and probes.

Note: Sequences having SNP can be selected as a reference gene. When you select a SNP
sequence as a reference gene, you need to select either wild probe or mutant probe and selected
probe will be used for multiplexing.
Sequences not having the pre-designed primers and probes cannot be selected as a reference
gene and will be grayed out. Evaluate Primers and probe to use as a reference gene.
For selected reference gene amplicon length will be displayed in “Search Range” column and Tm
of Pre-designed Primer and probe will be displayed in Primer Tm and Probe Tm column.
6) Specify Reaction conditions.
Note: When you select a reference gene, reaction conditions for the selected reference gene will
displayed in reaction condition dialog and will be used for multiplexing.
If you select more than one sequence as a reference gene, then the reaction condition for the all
the selected reference gene must be identical.
7) Click Search button to launch the search.
8) After the search is complete results will be displayed under Multiplexing Results Tab.

For Example

1) Select Sequences L22214, M95491 and Y13051 from Sequence Information table.

2) Select Analyze> Multiplex TaqMan® > Standard or click button on tool bar.
3) Specify “Multiplex Set Name Set5.
4) Uncheck Avoid Template Structure, Avoid Cross Homology.

88
Beacon Designer 5.10 Tutorial

5) Set “Multiplex Taqman Search parameters ” to meet your experimental need. You can reset
the parameters to the default values by clicking the Default button.
6) Select the M95491 as a reference gene. “length range” for reference gene is 3467-3554”. Tm
of Probe for selected reference gene is 68.5oC and Tm of sense primer and antisense Primer for
selected reference gene are 59.0oC and 59.4oC. displayed under primer Tm and probe Tm
column.
7) Reaction condition of M95491 will be displayed in reaction condition dialog.
7) Click Search button to launch the search.
8) As soon as search is complete results will be displayed under multiplexing results tab. Under
this tab, left Pane displays multiplexed group and right Pane displays sequences corresponding
to multiplexed group. The best multiplex set for multiplexed group is shown under TaqMan
properties tab.

89
Beacon Designer 5.10 Tutorial

Multiplex Taqman Set Search results

As soon as Multiplex Taqman Set search is complete, it will automatically switched to Multiplexing
Results Tab which displays multiplexed group and the corresponding sequences. Under
multiplexing tab left pane displays Multiplexed group with group status and set rating and right
pane displays corresponding sequences of the multiplexed group along with their individual
Taqman and Primer search status.

1) Multiplex sets are displayed under TaqMan properties Tab.

2) Each multiplex set will display Taqman probe and primers of the individual sequence
considered while multiplexing. The displayed result include both the sense and antisense primer
rating, primer sequence, TaqMan® rating, Taqman sequence position, length, melting
temperature, GC%, maximum hairpin dG, maximum self dimer dG, repeat and run length,
optimum annealing temperature, maximum cross dimer dG, product length, product Tm., probe
Tm.
3) The graphical view of the primer and TaqMan secondary structures is displayed in the
Secondary Structures window. You can view the primer secondary structures and Taqman
secondary structure by clicking All Structures option from pop-up menu available at right click
(For Mac, CTRL+click) on sequence displayed in Taqman Properties tab or by selecting View>All
Structure > Primers or Taqman.
4) The Secondary Structures window displays the graphical view of all the possible structures for
dimers, hairpins, cross-dimers, repeats and runs for the selected primer or probe.
5) You can copy the primer and Taqman sequence to the clipboard. Select Edit> Copy> Sense
primer,antisense primer, Taqman Sequence or select Copy Primer Sequence or Taqman
sequence option from pop-up menu available at right click (For Mac, CTRL+click) on sequence in
Taqman Properties tab.
Select Alternate Multiplex Set
You can replace the default multiplex set with an alternate multiplex set to meet your research
needs.

1) To view alternate multiplex set select View > All Multiplex set button or click

button.
2) The window displays both the default multiplex set displayed under Taqman Properties Tab
and alternate multiplex set. The multiplex set which is displayed under Taqman Properties tab will
be highlighted in All multiplex sets window.
3) Select any Multiplex Set.
4) Click the Replace button.
5) The selected Multiplex set will replace the default multiplex set in the Taqman Properties tab.

90
Beacon Designer 5.10 Tutorial

LNA(TM) Substituted TaqMan(R) Assay

Design LNA(TM) Substituted TaqMan

Paramters for LNA(TM) Substituted TaqMan Design

Introduction: Beacon Designer designs LNA(TM) substituted TaqMan(R) probes for allele
discrimination and multiplex assays. LNA(TM) (Locked Nucleic Acid) is a novel class of nucleic
acid analogues, which are bi cyclic compounds and structurally similar to RNA nucleotides.
LNA(TM)/DNA or LNA(TM)/RNA duplexes increases thermal stability compared with similar
duplexes formed by DNA or RNA. In general, the thermal stability of a LNA(TM)/DNA duplex is
increased by 3/40C to 8/90C per modified base in the oligonucleotide. Beacon Designer designs
LNA(TM) substituted TaqMan(R) of shorter length and high Tm.

Parameters for LNA(TM) substitution : Beacon Designer lets you to specify the number of
bases to be excluded from 5' and 3' end in order to centralize the LNA(TM) in a probe, number of
LNA(TM) bases to be included in the TaqMan(R) probes and frequency of LNA(TM) substitution
i.e. distance between two LNA(TM) bases. You can design LNA(TM) substituted TaqMan(R)
probes for multiplexing, on upto four sequences. The LNA(TM) are substituted as per the values
of LNA(TM) frequency, LNA(TM) phase off and number of LNA(TM)'s. The probes designed by
LNA(TM) substitution are shorter in length as compare to standard TaqMan(R) probes and have
higher Tm values.

Steps for LNA(TM) substituted TaqMan(R) probe design :

1. Select the sequence in the Sequence Information table.

2. Select Analyze > TaqMan(R) Search > LNA(TM) or click button from the toolbar. If
TaqMan search is launched from toolbar then, select LNA(TM) option.

3. In TaqMan search dialog there are Primer Parameters tab and TaqMan Parameters Tab.
Primer design parameters are displayed below the Primer Parameters tab and TaqMan design
parameters are displayed under TaqMan Parameters Tab.

4. Set the LNA(TM) TaqMan(R) search parameters to meet your experimental requirements.

5. By default, the Avoid Cross Homology option is checked. In this case the primers will be
designed avoiding homologous regions.

6. By default, the Avoid Template Structure option is checked. The regions of template with
secondary structure will be avoided while designing primers. If you would like to design primers at
these default values, the sequence(s) should already be BLASTed and a template search done.
Otherwise these options should be unchecked before launching a TaqMan(R)search.

7. When multiple sequences are selected for a multiplex reaction, the primers designed will be
checked for cross dimers and the best primers with respect to multiplexing will be displayed.

7. If the sequences contain SNP information, the probes will be designed to identify the SNP.

8. Launch search by clicking the Search.

91
Beacon Designer 5.10 Tutorial

For Example:

To design a multiplex reaction for detection of four different pathogenic retroviruses:

1. Select sequences M95491 and AF209198 in the Sequence Information table.
2. Select Analyze > TaqMan(R) Search > LNA(TM).
3. In the TaqMan(R) Search Parameters window set all parameters to default. These parameters
are defined according to TaqMan(R) design guidelines.
4. Avoid Template Structure, Avoid Cross Homology, and Multiplex options are checked.
Note, to design primers at these default values, the sequence(s) should already be BLASTed and
a template search done.
5. The Search Range for M95491 is restricted to 1 to 1200 bp to design primer pair.
6. Similarly the Search Range for sequence AF209198 is restricted to 1 to 1048 BP.
7. By default the Multiplexing option is checked, i.e the program will check the TaqMan(R) probes
of selected sequences for cross dimers with each other and with all the designed primers. Each
designed TaqMan(R) probe is always checked for cross dimers with the amplifying primer pair.

The probe and primer length will range between 14 to 17bases. The target melting temperature of
the designed TaqMan(R) probe is set 10 oC higher than the primer melting temperature with a
tolerance of +/- 2 oC. Beacon Designer will search TaqMan(R) probes as close as possible to the
specified target value of Tm.
For example: If primer Tm is 59.0 oC, then the target TaqMan(R) Tm will be 69.0 oC and the range
will be 67.0 oC to 71.0 oC. The TaqMan(R) having Tm equal to target will be given highest priority
and the TaqMan(R) having a Tm outside this range will not be considered. The optimal primer for
the same strand as the TaqMan(R) will be designed, such that the 3' end of the primer is within 10
bases of the probe without overlapping the probe sequence.
The Advanced search parameters include the maximum acceptable values for secondary
structures such as self-dimers, hairpins, cross-dimers, repeats, and runs in primers and
TaqMan(R) probes. The default values for secondary structures are set to ensure high signal
strength of the designed TaqMan(R). TaqMan(R) probes and primers having values for self-dimer,
hairpin, cross-dimer, repeats and runs greater than the specified value are discarded.
Additional parameters such as GC clamp, 3'end stability and maximum difference between primer
pair Tm are considered for the designed optimum primers.

8. After setting the parameters for TaqMan(R) design, launch search by clicking Search.
9. The search quality status will be immediately displayed in the Search Status tab. The detailed
TaqMan(R) search results will be displayed in the TaqMan(R) Properties tab and the primer search
results will be displayed in the Primer Properties table along with the primer rating.

92
Beacon Designer 5.10 Tutorial

LNA(TM) Substituted TaqMan(R) Search Results

As soon as the LNA(TM) substituted TaqMan(R) search is complete the search quality status is
displayed in the Search Status Tab, followed by the type of assay i.e. “Good – LNA(TM)”. The
detailed results are displayed in TaqMan(R) Properties Tab and the location of TaqMan(R)on the
sequence is displayed in the Sequence view.

1. The displayed results include LNA(TM) substituted TaqMan(R) rating, sequence, position,
length, probe Tm, GC%, maximum hairpin dG, maximum self-dimer dG, maximum cross-dimer
dG. In LNA(TM) substituted TaqMan(R) LNA(TM) bases are represented by upper case and DNA
bases are in lower case, for discrimination between LNA(TM) and DNA bases.

For example :
In probe sequence ,
tctGctGgaCgcCctac G and C are LNA(TM) bases.

2. In the Sequence View, you can view the location of the LNA(TM) substituted TaqMan(R) on the
sequence but that is not case sensitive.

3.You can view all possible LNA(TM) substituted TaqMan(R) secondary structures in TaqMan All
Structure window.

4. Wild and mutant LNA(TM) substituted TaqMan(R) probes are designed for sequences with a
SNP selected. The SNP base will be centralized in the probe and will always be a LNA(TM). Other
bases which will be LNA(TM), depends on the value of number of LNA(TM) base.

Select Alternate TaqMan(R) probe :

After designing TaqMan(R) you can replace the default TaqMan(R) probe by selecting any other
TaqMan(R) that meets your research needs better. Other TaqMan(R)probes are available in the All
TaqMan(R) window.

1. To view alternate TaqMan(R) probes click the button.

2. The window displays both the best and alternate TaqMan(R) with their associated primer pair.
The probe which is displayed under TaqMan Properties tab will be highlighted in All TaqMan
window.

3. Select any TaqMan(R) in this window. The optimum primer pairs associated with the selected
TaqMan(R)probe are displayed in the All Primers table. By default the best primer pair will be
selected. You can select any other primer pair by highlighting it.

4. Click the Replace button.

5. The selected TaqMan(R) probe replaces the default TaqMan(R) probe in the TaqMan(R)
Properties tab and the selected primer pair will replace the default primer pair. The probe that
replaces the default probe set will be highlighted by the grey background in the All TaqMan
window.

Sort TaqMan and Primers:

In All TaqMan window there will be facility to sort TaqMan probe sense primer, antisense primer
and product on the basis of rating, position, length, Tm , GC%, Hairpin Delta G value and Self
dimer delta G values. Sorting is not available on sequence and S.No.

93
Beacon Designer 5.10 Tutorial

Note: Whenever All TaqMan and All primers window will be launched, TaqMan and primers are
always sorted on the basis of Product rating.

94
Beacon Designer 5.10 Tutorial

Evaluate LNA(TM) Substituted TaqMan (R)

Evaluate LNA(TM) Substitued TaqMan (R)

In Beacon Designer, you can add and evaluate pre-designed LNA(TM) substituted TaqMan(R) and
Primer pairs. Such evaluation would be desirable for:
a. Adapting SYBR green results to TaqMan(R) assays.
b. Analysis against other imported TaqMans(R) probes.
c. Use evaluated TaqMan(R) or Primers as a base for searching primers/TaqMan(R) on other
targets for multiplexing.

To evaluate a TaqMan(R) probes and designing optimum primer pair:

1. Select the sequence in the Sequence Information table.

2. Select Analyze > Evaluate TaqMan(R) > LNA(TM) or click from the toolbar. The dialog
launched from the toolbar will have both Standard and LNA(TM) enabled, but Standard selected.
To evaluate LNA(TM) substituted TaqMan or primer select LNA(TM) option.

3. Select Evaluate TaqMan from the drop-down menu, to evaluate the TaqMan probe and design
optimized primer pair.

4. Type or paste the TaqMan sequences in the given text field. The primers should always be
added in the 5' to 3' direction.

Note :
a. The TaqMan added for evaluation should not have 2 bases from 5' and 3' end as LNA(TM).

b. Adjacent LNA(TM) substitution is not acceptable during evaluation.

c. LNA(TM) substituted TaqMan evaluation is case sensitive i.e. bases (A,T, G, C) written in upper
case are considered as LNA(TM) and those written in lower case are normal DNA bases.

5. The default values for Primer Search parameters are set to ensure that the search succeeds in
finding the most optimum TaqMan(R) probe for the evaluated primer pair. You can change these
default values to suit your experimental requirements.

6. Beacon Designer analyzes and rates the added TaqMan Probe. The TaqMan probe is
analyzed using existing TaqMan search parameters from the TaqMan(R) Search Parameters
window.

For example:

1. Select the sequence AB036365 in the Sequence Information table.

2. Select Analyze > Evaluate TaqMan(R) > LNA(TM) , to launch Evaluate TaqMan(R) window.

3. Select Evaluate TaqMan from the drop-down menu, to evaluate the added probe and design
optimized primer pair.

4. Paste the following TaqMan sequences:

95
Beacon Designer 5.10 Tutorial

TaqMan : ttgCccAccAccCttt

5. Set the Primer Search Parameters to Default.

6. Click OK to evaluate the added TaqMan(R) probe.

7. The TaqMan properties are displayed in TaqMan Properties table and the designed primers
are displayed in the Primer Properties table.

8. To verify the specificity of the evaluated TaqMan, you can BLAST search the primer pair
against the relevant database using Analyze > BLAST Search > TaqMan option.

7. Detailed BLAST search results are displayed in the default browser.

96
Beacon Designer 5.10 Tutorial

Multiplex LNA(TM) Substituted TaqMan (R) Probes

In Beacon Designer you can design LNA(TM) Substituted TaqMan(R) probes and primers for
multiplex reactions. The LNA(TM) Substituted TaqMan(R) designed on multiple sequences in a
single search at default values are automatically checked for cross-dimers with each other and
with all the designed primers, preventing competition in multiplex reactions.

You can also use the Multiplex TaqMan(R) option to check the multiplexing of LNA(TM)
Substituted TaqMan(R) probes and primers designed in different search runs.
In order to multiplex LNA(TM) Substituted TaqMan(R):

1. Select the sequences in Sequence Information table. You can select up to four sequences for
multiplexing on which LNA(TM) Substituted TaqMan are designed.

Note : Sequence having different types of TaqMan probes i.e. Standard and LNA(TM) Substitued
cannot be used for multiplexing.

2. Select View > Multiplex TaqMan(R) or click from the toolbar.

3. Beacon Designer instantly anlayzes all the selected sequences and displays the cross-dimers
that are formed between the LNA(TM) Substituted TaqMan(R) and primers.

4. The multiplex results are displayed instantly in the Multiplex Results Window.

97
Beacon Designer 5.10 Tutorial

Multiplex LNA(TM) Substituted Taqman Assay

Design LNA(TM) Substituted TaqMan probes and primers for multiplex assay

Multiplex PCR is an essential cost saving technique for an endless list of applications including
large scale genotyping, gene expression, whole genome sequencing, forensic analysis and also
facilitate the diagnosis of infectious disease.

Multiplex PCR primer design and optimization is a greater challenge than designing singleplex
PCR primer design. The aim of multiplex is to find many sets of primer that can be used in the
same PCR reaction to amplify many different sequences simultaneously. Beacon Designer finds
the multiplex set that matches these criterion by first finding all the acceptable primer pair for
each of the targets, then testing every combination and giving back those sets that meet the
criterion.

Here is how to design Multiplex set for Taqman probes and primers for Multiplex assay:

1) Select more than one sequence.

2) Select Analyze> Multiplex TaqMan® > LNA(TM) or click button on tool bar.
3) Set “Multiplex Taqman Search parameters ” to meet your experimental need. You can reset
the parameters to the default values by clicking Default button.
4) Specify the Reaction conditions .
5) Click Search button to launch the search.
6) After the search is complete results will be displayed in Multiplexing results tab.

For Example:
1) Select Sequences AB036365 and L22214 from sequence information table.

2) Select Analyze> Multiplex TaqMan® > LNA(TM) or click button on tool bar.
3) Specify the “Multiplex Set Name” BF123.
4) Check Avoid Template Structure, Avoid Cross homology.
5) Set “Multiplex Taqman Search parameters ” to meet your experimental need. You can and
reset the parameters to the default values by clicking the Default button.
6) The Search Range for AB036365 is restricted to 1-1079 bp, or sequence L22214 is restricted
to.1-1200 bp to design primer pair.
7) Set the Reaction conditions to the default values by clicking the Default button.
8) After setting the parameters for TaqMan® design, launch search by clicking Search.
9) As soon as search is complete results will be displayed under multiplexing results tab. Under
this tab, left pane displays multiplexed group and right pane displays sequences corresponding to
multiplexed group. The best multiplex set for multiplexed group is shown under the TaqMan
properties tab.

98
Beacon Designer 5.10 Tutorial

Design LNA(TM) Substituted TaqMan probes and primers for Reference Gene
Multiplexing

Multiplex RT-PCR using reference genes as a positive control against the gene of interest is one
of the most widely accepted technique used now a days. This involves concurrent amplification of
the target gene and reference gene.

Beacon Designer designs Multiplex sets for Taqman probes and primers for reference gene
multiplexing. Beacon Designer finds the multiplex set that matches these criterion by first finding
all the acceptable primer pair for each of the targets, then testing every combination and giving
back those sets that meet the criterion.

Here is how to design Multiplex sets for Taqman probes and primers for reference gene
multiplexing-

1) Select more than one sequence.

2) Select Analyze> Multiplex TaqMan® > LNA(TM) or click button on tool bar.

3) Specify “Multiplex set name”.

4) Set “Multiplex Taqman Design parameters ” to meet your experimental need. You can reset
the parameters to the default values by clicking the Default button.
5) You can select a reference gene under the “Sequence length range/ reference gene
selection” segment. Maximum three sequences can be selected as a reference gene. To select
a sequence as a reference gene it should have pre-designed primers and probes.

Note: Sequences having SNP can be selected as a reference gene. When you select a SNP
sequence as a reference gene, you need to select either wild probe or mutant probe and selected
probe will be used for multiplexing.
Sequences without pre-designed primers and probes cannot be selected as a reference gene
and will be grayed out. Evaluate Primers and probe to use as a reference gene.
For selected reference gene amplicon length will be displayed in “Search Range” column and Tm
of Pre-designed Primer and probe will be displayed in Primer Tm and Probe Tm column.
6) Specify Reaction conditions.
Note: When you select a reference gene, reaction conditions for the selected reference gene will
displayed in reaction condition dialog and will used for multiplexing.
If you select more than one sequence as a reference gene, then the reaction condition for the all
the selected reference gene must be identical.
7) Click Search button to launch the search.
8) After the search is complete results will be displayed under Multiplexing Results Tab.

For Example
1) Select Sequences NM_026658, AF209198, AB036365 and L22214 from Sequence
Information table.

2) Select Analyze> Multiplex TaqMan® > LNA(TM) or click button on tool bar.
3) Specify Multiplex Set NameSet6.

99
Beacon Designer 5.10 Tutorial

4) Check Avoid Template Structure, Avoid Cross Homology.

5) Set “Multiplex Taqman Search parameters ” to meet your experimental need. You can reset
the parameters to the default values by clicking the Default button.
6) Select the NM_026658 sequence as a reference gene. “Length range” for reference gene is
2220-2346”. Tm of Probe for selected reference gene is 66.9oC and Tm of sense primer and
antisense primer for selected reference gene is 59.2oC and 59.4oC. displayed under primer Tm
and probe Tm column.
7) Reaction condition of NM_026658 will be displayed in reaction condition dialog.
8) Click Search button to launch the search.
9) As soon as search is complete results will be displayed under multiplexing results tab. Under
this tab, left panel displays multiplexed group and right panel displays sequences corresponding
to multiplexed group. The best multiplex set for multiplexed group is shown under TaqMan
properties tab.

100
Beacon Designer 5.10 Tutorial

Multiplex Taqman Set Search results

As soon as Multiplex Taqman Set search is complete, it will automatically switched to Multiplexing
Results Tab which displays multiplexed group and the corresponding sequences. Under
multiplexing tab left pane displays Multiplexed group with group status and set rating and right
pane displays corresponding sequences of the multiplexed group along with their individual
Taqman and Primer search status.

1) Multiplex sets are displayed under TaqMan properties Tab.

2) Each multiplex set will display Taqman probe and primers of the individual sequence
considered while multiplexing. The displayed result include both the sense and antisense primer
rating, primer sequence, TaqMan® rating, Taqman sequence position, length, melting
temperature, GC%, maximum hairpin dG, maximum self dimer dG, repeat and run length,
optimum annealing temperature, maximum cross dimer dG, product length, product Tm., probe
Tm.
3) The graphical view of the primer and TaqMan secondary structures is displayed in the
Secondary Structures window. You can view the primer secondary structures and Taqman
secondary structure by clicking All Structures option from pop-up menu available at right click
(For Mac, CTRL+click) on sequence displayed in Taqman Properties tab or by selecting View>All
Structure > Primers or Taqman.

4) The Secondary Structures window displays the graphical view of all the possible structures for
dimers, hairpins, cross-dimers, repeats and runs for the selected primer or probe.

5) You can copy the primer and Taqman sequence to the clipboard. Select Edit> Copy> Sense
primer,antisense primer, Taqman Sequence or select Copy Primer Sequence or Taqman
sequence option from pop-up menu available at right click (For Mac, CTRL+click) on sequence in
Taqman Properties tab.

Select Alternate Multiplex Set

You can replace the default multiplex set with an alternate multiplex set to meet your research
needs.

1) To view alternate multiplex set select View > All Multiplex set or click
button.
2) The window displays both the default multiplex set displayed under Taqman Properties Tab
and alternate multiplex set. The multiplex set which is displayed under Taqman Properties tab will
be highlighted in All multiplex sets window.
3) Select any Multiplex Set.
4) Click the Replace button.
5) The selected Multiplex set will replace the default multiplex set in the Taqman Properties tab.

101
Beacon Designer 5.10 Tutorial

FRET Probe Design

Parameter for FRET Probe

Design FRET Probes

Parameters for FRET Probe Design

Beacon Designer supports FRET probe design for allele discrimination assays. You can design
FRET probes for one sequences at a time. You can use the Multiplex FRET Probes option to
view cross dimerization of FRET Probes and primers designed in different searches. In order to
design primers first set parameters for FRET Probes design. (The FRET probe and the primers
are designed simultaneously. In order to design an assay, first set parameters for FRET design.)

Steps for FRET probe design :

1. Select the sequence in the Sequence Information table.

2. Select Analyze >FRET Probes search or click button from the toolbar.
3. If necessary set the FRET Probes Search Parameters to meet your experimental
requirements. You can reset the parameters to default values by clicking the Default button. The
default values of most of the range parameters are set loosely to ensure that the search
succeeds in finding the best possible probes and primer pair. These values do NOT affect the
quality of the resulting primers, they only serve as the minimum and maximum acceptable limits.
The search algorithm uses the target values or the middle of the range (except for the product
length and the primer length) to optimize the primers. If the range specified is too narrow, no
FRET Probes meeting the specifications may result. We recommend the use of default values for
FRET Probes search.
4. By default, the Avoid Cross Homology option is checked. In this case, the primers will be
designed by avoiding regions of significant homologies. By default, the Avoid Template Structure
option is checked. The regions of template with secondary structure will be avoided while
designing primers. If you would like to design primers at these default values, the sequence(s)
should already be BLASTed and a template search completed. Otherwise, these options should
be unchecked before launching a FRET Probes search.
5. If the sequences contain SNP information, the primers will be designed to amplify the SNP.
6. Launch search by clicking the Search button.
7. The search parameters are saved for future searches. You can reset the parameters to their
default values by clicking the Default button. The most important point to note is that the FRET
probes are designed near the 5’ end of the target strand (i.e., as far as possible from the 5’
primer-binding site on the same strand), but not overlapping the primer-binding site on the
opposite strand. They are also checked for secondary structures, and cross hybridization to
ensure high signal fidelity.

Note: If the sequence has an SNP that has been selected, Beacon Designer will design both wild
and mutant Sensor probes for the sequence. To overlook the SNP information while designing
FRET probes, click the Unselect SNP button in the SNP Information tab or delete the existing
SNP using Delete SNP.

For Example:

1. Select a sequence Y13051 in the Sequence Information table.

2. Select Analyze >FRET Probes search.
3. In the FRET Probes Search Parameters window set all parameters to default. These
parameters are defined according to FRET Probes design guidelines.
4. Avoid Template Structure and Avoid Cross Homology options are checked.
Note: to design primers at these default values, the sequence should already be BLASTed and a
template search completed.
5. The Search Range for Y13051 is restricted to 2339 to 3520 bp to design primer pair to amplify

102
Beacon Designer 5.10 Tutorial

Human T-cell psychotropic virus type 2 reverse transcripts 'pol' gene

6. Each designed FRET probe is always checked for cross dimers with the amplifying primer pair.
7. The probe and primer length will range between 18 to 22 bases. The target melting
temperature of the designed FRET probes is set 8 oC higher than the primer melting temperature
with a tolerance of +/- 3 oC. Beacon Designer will search FRET probes with Tim compatible as
closely as possible to the specified target value of primer Tm. For example: If primer Tm is 55.0
o
C, the target FRET Probes Tm will be 63.0 oC and the range will be 61.0 oC to 65.0 oC. The
FRET Probes with Tm equal to the target value will be given highest rating and the FRET Probes
with Tm's outside this range will not be considered. The optimal primer for the strand with FRET
Probes will be designed, so that the FRET probes are designed near the 5’ end of the target
strand (i.e., as far as possible from the 5’primer-binding site on the same strand), but not
overlapping the primer-binding site on the opposite strand. The 3' end of the primer is within 10
bases of the probe without overlapping the probe sequence. The Advanced search parameters
include the maximum acceptable values for secondary structures such as self-dimers, hairpins,
cross-dimers, repeats, and runs in primers and FRET probes. The default values for secondary
structures are set to ensure high signal strength. FRET Probes and primers with values for self-
dimer, hairpin, cross-dimer, repeats and runs greater than the specified value are discarded.
Additional parameters such as GC clamp, 3'end stability and maximum difference between primer
pair Tm are considered when designing primers.
8. After setting the parameters for FRET Probes design, launch search by clicking the Search
button.
9. The search quality status will be instantly displayed in the Search Status tab. The detailed
FRET Probes and primer search results will be displayed in their respective Properties tabs.

FRET Probe Search Probe FRET Search Results;

103
Beacon Designer 5.10 Tutorial

FRET Probe Search Results

As soon as the FRET Probe search is complete the search quality status is displayed in the
Search Status Tab, the detailed results are displayed in FRET Probe Properties Tab and the
location of FRET Probe on the sequence is displayed in the Sequence view.

1. Wild and mutant FRET Probes are designed for sequences with a SNP selected. The best
FRET Probe whether sense or antisense, is designed for sequences without a SNP selected.
2. The displayed results include FRET Probe rating, sequence, position, length, probe Tm, GC%,
maximum hairpin dG, maximum self-dimer dG, maximum cross-dimer dG.
3. You can view all possible FRET Probe secondary structures in
View Secondary Structures window.
4. In the Sequence View, you can view the location of the FRET Probe on the sequence .
5. You can copy the FRET Probe sequences to the clipboard. Select Edit > Copy > FRET Probe
Sequences or select Copy FRET Probe sequences option from pop-up menu available at right
click (For Mac, CTRL+click) over the FRET Probe sequence.

Select Alternate FRET Probes:

After designing FRET Probe you can replace the default FRET Probes by selecting any other
FRET Probe set that meets your research needs better. Other FRET Probes are available in the
All FRET Probe window.

1. To view alternate FRET Probe probes click the button.

2. The window displays both the alternate FRET Probes and the associated primer pair. The
probes are displayed in the order of their rating in the upper half of the window.
3. Select any FRET Probe in this window. The optimum primer pairs associated with the selected
FRET Probes are displayed in the All Primers table.
4. By default the best primer pair will be selected. You can select any other primer pair by
highlighting it.
5. Click the Replace button.
6. The selected FRET Probes replace the default FRET Probe in the FRET Probe Properties tab
and the selected primer pair will replace the default primer pair.

Sort FRET Probes:

In All FRET window there will be facility to sort FRET probe on the basis of rating, position,
length, Tm , GC%, Hairpin Delta G value and Self dimer delta G values of Probe 1 and Probe 2.
Sorting is not available on sequence and S.No.

Note: Whenever All FRET window will be launched FRET Probes are always sorted on the basis
of Probe 1 rating.

104
Beacon Designer 5.10 Tutorial

Evaluate FRET Probes

Evaluate FRET Probes

In Beacon Designer, you can add and evaluate pre-designed FRET Probes and Primer pair. Such
evaluation would be desirable for:
a. Adapting SYBR(R) green results to FRET probe assays.
b. Analysis against other imported FRET probes.

To evaluate a FRET probes and designing optimum primer pair:

1. Select the sequence in the Sequence Information table.

2. Select Analyze > Evaluate FRET or click from the toolbar.

3. Select Evaluate FRET Probe Pair from the drop-down menu, to evaluate the added FRET
probe pair and design optimized primers.
4. Type or paste the FRET probe sequences in the given text field. The probes should always be
added in the 5' to 3' direction.
5. The default values for Primer Search parameters are set to ensure that the search succeeds in
finding the most optimum primer pair for the evaluated FRET probes. You can change these
default values to suit your experimental requirements.
6. Beacon Designer analyzes and rates the added FRET probe pair. The probe pair is analyzed
using existing probe search parameters from the FRET Probe Search Parameters window.

Note: To evaluate the primers designed in the SYBR (R) Green mode check the Use SYBR(R)
Green Primers Option with the Primer pair selected from the drop-down menu in the Evaluate
(R)
box. The primer pair in the primer properties tab of the SYBR Green would be evaluated.

For example:

1.Select the sequence AB031207 in the Sequence Information table.

2. Select Analyze > Evaluate FRET, to launch Evaluate FRET window.
3. Select Evaluate FRET Probe Pairs from the drop-down menu, to evaluate the added FRET
probe pair and design optimized primer pair.
4. Paste the following probe sequences: Probe 1: 5'AGGCTTAACCATTATCCACCATGCTTAGA
3', Probe 2: 5'CCAACTCTAACCATGACTCGGACCTG 3'.

5. Set the Primer Search Parameters to Default.

6. Click OK to evaluate the added FRET probe pairs and design optimum primers. Beacon
Designer analyzes and rates these probes using existing probe search parameters, which are
currently set as default. The probe properties are displayed in FRET Properties table and the
designed Primer pair Properties are displayed in the Primer Properties Tab.

7. To verify the specificity of the evaluated probe pair, you can BLAST search the probe pair
against the relevant database using Analyze > BLAST Search > Probe, option.
8. Detailed BLAST search results are displayed in the default browser.

105
Beacon Designer 5.10 Tutorial

Multiplex FRET Probes

Evaluate Probes;

You can also use theMultiplex FRET Probesoption to check the multiplexing of FRET probes
and primers designed on a sequence.
In order to multiplex FRET:
1. Select the sequence in Sequence Informationtable. You can select one sequence for
multiplexing.

2. Select View > Multiplex FRET Probes or click from the toolbar.
3. Beacon Designer instantly analyzes the selected sequence and displays the cross-dimers that
are formed between its FRET Probes and primers.
4. The multiplex results are displayed instantly in the Multiplex Results Window.

106
Beacon Designer 5.10 Tutorial

SYBR (R) Green Primers Design

SYBR Green

Parameters for Primer Design

Beacon Designer supports primer design for SYBR(R)) Green assays. You can either design
primers for a sequence or evaluate pre-designed primer pairs. The primers designed are
automatically checked for cross-dimer formation, preventing competition and mispriming. In
SYBR(R)) Green Primer design mode you can design primers on more than one sequences at a
time for a given set of design parameters. The primers designed simultaneously on more than
one sequences are not intended for multiplex reactions.

Set Parameters for Primer Design:

To design primers for selected sequence(s) in Beacon Designer:

1. Open the sequence(s) in the current project.

2. Select the sequence(s) and choose Analyze >Primer Search or click button from the
toolbar.
3. Set the primer search parameters to meet your research needs. You can reset the parameters
to default values by clicking Default. The default values of most of the range parameters are set
loosely to ensure that the search succeeds in finding the best possible primer pair. The search
algorithm uses the target values or the middle of the range (except for the product length and the
primer length) to search for the best primers. If the range specified is too narrow, no primers
meeting the specifications may result. We recommend using default values for primer search.
4.By default the Avoid Cross Homology option is checked. The primers will then be designed
avoiding regions of significant homologies. Similarly, the Avoid Template Structure option is
checked and by default, significant template secondary structures which may hinder the primers
from annealing are identified and avoided.
To design primers at these default values, the sequence(s) should already be BLASTed and a
template search completed. You may choose to skip these steps and design primers without
avoiding cross-homology and/or template secondary structures. Simply uncheck these options in
the Primer Search window before launching a search.

5.When multiple sequences are selected, the primers in the pool will be designed simultanuously
on all the sequences but without multiplexin and the primers best suited will be displayed.
6.If the sequence(s) contain SNP information, the primers will be designed to amplify the SNP.
7.Click Search to launch a search.
8.Primer search parameters are saved for future searches.

For example:

1.Select sequence L22214 in the Sequence Information table.

2.In order to design primers avoiding template secondary structures, the sequence should be
evaluated for presence of stable secondary structures by folding it by connecting to the Quikfold
server.

3. To launch Template Structures dialog select Analyze> Template Structures or click from
the toolbar.

4. Set template Search Range as from 1000 to 2100, for the sequence for which primers are to
be designed.

5. BLAST search the sequence against a suitable database by selecting Analyze> BLAST
Search > Sequence.

107
Beacon Designer 5.10 Tutorial

6. Now proceed to design primers for the sequence, select Analyze >Primer Search or click
from the toolbar.

7. Set the Primer Search Parameters to their default values.

8. The Search Range for sequence L22214 is restricted to, 1000 to 2100 bp, spanning Human
adenosine A1 receptor (ADORA1) mRNA exons 1-6 complete cds.

9. Avoid Template Structure, and Avoid Cross Homology.

10. Click Search to launch a search.

11. As soon as the primer search is complete, the properties of the designed primer are displayed
in the table under the Primer Properties tab with both, the individual and primer pair rating. The
primer rating quantifies the merit of primer with reference to the search parameters. A primer
rating of 100 indicates that the primer exactly matches the specified search parameters.

Note: You can select multiple sequences and design primer. The primers designed are not
intended for multiplex reactions.

108
Beacon Designer 5.10 Tutorial

Primer Search Results

As soon as the primer search is complete the search quality status is displayed in the Search
Status Tab and the detailed result is displayed in the Primer properties table under Primer
Properties tab.

1. The displayed result include both the sense and antisense primer rating, primer sequence,
position, length, melting temperature, GC%, maximum hairpin dG, maximum self dimer dG,
repeat and run length, optimum annealing temperature, maximum cross dimer dG, product
length, product Tm.
2. You can view all possible primer secondary structures in View Secondary Structures window.
3. In the Sequence View, both sense and antisense primer positions are marked on the
sequence.
4. You can copy the primer sequence to the clipboard. Select Edit>Copy>Primer Sequence or
select Copy Primer Sequence option from pop-up menu available by right clicking (for Mac,
CTRL+click) the primer sequence.

Example:

1. The primer search result for sequence L22214 displays sense and antisense primers along
with the free energy values for secondary structures and product properties.
2.You can view the graphical view of all the primer secondary structures in Secondary Structures
window by clicking All Structures option from pop-up menu available by right clicking (for Mac,
CTRL+click) the Primer Properties table or by selecting View>Alternate>Primers.

You can replace the default primer pair with an alternate primer pair to meet your research needs.

1. Properties of the alternate primers and primer displayed under Primer Properties Tab are
displayed in the All Primers window. The window displays both the default primer pair displayed
under Primer Properties tab. The primer pair which is displayed under Primer Properties tab will
be highlighted in All Primer window.
2. Select any primer pair.
3. Click the Replace button.
4. The selected Primer replaces the default primer pair in the Primer Properties tab The primer
pair that replaces the default primer set will be highlighted by the grey background in the All
Primer window.

Sort Primers:

In All Primers window there will be facility to sort sense primer, antisense primer and product on
the basis of rating, position, length, Tm , GC%, Hairpin Delta G value and Self dimer delta G
values. Sorting is not available on sequence and S.No.

Note: Whenever All Primers window will be launched primers are always sorted on the basis of
Product rating.

109
Beacon Designer 5.10 Tutorial

Evaluate Primers

Evaluate Primers
In Beacon Designer, you can add pre-designed primers instead of designing primers using the
program. This is useful when you already have primers in your lab or are working with published
primer sequences.
To add and evaluate a primer pair for a sequence:
1. Select the sequence in the Sequence Information table.
2. Select Analyze > Evaluate Primers or click (In the SYBR(R) Green Primers Design mode
click ) button from the toolbar, to launch the Evaluate Primers window.
3. Type or paste the primer sequences in the given text field. The primers should always be
added in the 5' to 3' direction.
4. Beacon Designer analyzes and rates the added primers. The primers are analyzed using
existing primer search parameters from the Primer Search Parameters window.

For example:
1. Select the sequence AB036365.
2. Add the following primer sequences:
Sense Primer: 5' TGTCTGCATGTACCTCTACC 3'.
Antisense Primer: 5' AGTTCTTCTATTCGCTTGTAGG 3'.
Beacon Designer analyzes and rates these primers using existing primer search parameters,
which are currently set as default. The primer properties are displayed in Primer properties table.
3. To verify the specificity of the evaluated primer pair, you can BLAST search the primer pair
against the relevant database using Analyze>BLAST Search>Primer Pair/Amplicon.
4. Detailed BLAST search results are displayed in the default browser.

110
Beacon Designer 5.10 Tutorial

Generate Report
Report;

Generate Report
Beacon Designer can export the design results in a report format that can be printed. The report
includes the results, the design parameters used and a graphical view of sequence with positions
of all the primers and probes marked apart from the amplicon, sequence, primer and probe
properties. The user may select the data that needs to be included in the report by checking or
un-checking the boxes of the corresponding fields.

The Print Preferences window is launched when you select File>Generate Report or click

Icon on tool bar

Probe:

Properties: This include the Quality, Rating, Position, Length, Tm, Probe Tm, Self Dimer dG,
Hairpin dG, Run/Repeat Length, Cross Dimer multiplex dG. A user may select the fields to be
included in the report with the help of check boxes of the corresponding fields.

Primer Pair:

Properties: There are two. In the Primer tab a user can specify the primer pair properties and in
the Product tab the amplicon properties to be included in the report.

Search Parameters:

Select Corresponding parameters: Default: unselected. When selected, only the parameters
corresponding to the selected properties used for designing the assay will be included in the
report.

Select all Parameters: Default: Unselected. When selected, all the parameters used for
designing the assay, will be included in the report.

None: Default: Selected. None of the parameters used for designing the assay, will be included in
the report.

Include BLAST Parameters: Default: Unchecked. If the sequence is BLAST searched the
search parameter details will be included in the report.

Sequence Information: Information pertaining to the sequence such as Accession no.,

Definition, Length and SNP.

Advanced Project Information:

Project Information:

Author: You may specify a name to be included in the report.

Comments: To add notes, observation or comments about the experiment.

Note: You can generate the report for multiplex Set

Here is how you can generate the report for multiplex set

1) Select Multiplexed group for which report is to be generated.

111
Beacon Designer 5.10 Tutorial

2) Select File> Generate report

3) Generate report dialog will be launched.

4) Select the parameters which needs to be included in the report.

5) Click Ok.

Formated Report will be launched.

112
Beacon Designer 5.10 Tutorial

Print Preview
To preview the appearance of the generated report

You can click Print Preview to see how a printed Web page will look.

1.Select File>Generate Report or click icon from tool bar

2.Report Preference dialogis launched.

3.Click Print Preview Button.

4. Choose from the following commands:

Click This Tool Bar To Do This

Saves the generated report. Report can be saved as either.bdr or

Save
.html file format.

Print Set printing options and print the page.

Change paper, headers and footers, orientation, and margins for

Page Setup
this page.

First page Display the first page to be printed.

Previous
Display the previous page to be printed.
page

Next Display the next page to be printed.

Last Display the last page to be printed.

Zoom in Increase the magnification.

Zoom out Decrease the magnification.

Default Size Display the default size of the page.

Help Display the help for print preview.

Close Close the Print Preview window.

113
Beacon Designer 5.10 Tutorial

Export Results

Export Beacon Search Results

Beacon Designer can save the beacon and associated primer search results outside the program
by selecting the Export Beacon Results option.
The results are exported in a Tab delimited file that can be loaded into any spreadsheet such as
MS Excel and Lotus 123 for printing or further processing.

To Export the Beacon Search Results:

1. Select one or more sequences in the Sequence Information table.
2. Choose File > Export Beacon Results or click button from the toolbar. Beacon Designer
saves the output file with a .xls extension registered to Microsoft Excel and with .csv extension for
opening in any other spreadsheet program.

3. Beacon Designer has three option for exporting Beacons and Primers :

a. Best Beacon and Primer - At default this will be selected. Selecting this option wil let you
export Beacon and associated primer displayed under Beacon Properties tab.
b. Best Beacon and All Primers - Selecting this option will let you export Beacon displayed
under Beacon Properties tab and all the primer pair associated with this Beacon.
c. All Beacons and All Primers - Selecting this option will let you export All Beacon designed on
sequence and all primer pair associated with the Beacons.

4. At default, Beacon Designer creates the output file in the Beacon Designer installation folder.
You can select the output file name and location in the Export Result window.

5. At default, the Beacon search results include beacon quality, rating, position, length, beacon
Tm probe Tm, free energy values of most stable beacon secondary structures and complementary
beacon sequence.

The primer search results include pair quality, pair rating, product length, product Tm, TaOpt and
primer location, primer sequence and free energy values of the most stable secondary structures
for both the sense and the antisense primers. Sequence definition and length can also be
exported.

The Export Result window allows you to select any or all of the available data using the
appropriate check boxes.

114
Beacon Designer 5.10 Tutorial

Export TaqMan(R) Probes Result

Beacon Designer can save the TaqMan(R) probe and associated primer search results outside the
program by selecting the Export TaqMan(R) Results option.
The results are exported in a Tab delimited file that can be loaded into any spreadsheet such as
MS Excel and Lotus 123 for printing or further processing.

To Export the TaqMan(R) Probe Search Results:

1. Select one or more sequences in the Sequence Information table.
2. Choose File > Export TaqMan(R) Results or click button from the toolbar. Beacon
Designer saves the output file with a .xls extension registered to Microsoft Excel and with .csv
extension for opening in any other spreadsheet program.

3. Beacon Designer has three option for exporting TaqMan probes and Primers :

a. Best TaqMan(R) and Primer - At default this will be selected. Selecting this option wil let you
export TaqMan(R) probe and associated primer displayed under TaqMan(R) Properties tab.
b. Best TaqMan(R) and All Primers - Selecting this option will let you export TaqMan(R)
displayed under TaqMan(R )Properties tab and all the primer pair associated with this TaqMan(R).
c. All TaqMan(R) and All Primers - Selecting this option will let you export All TaqMan(R)
designed on sequence and all primer pair associated with the TaqMan(R).

4. At default Beacon Designer creates the output file in the Beacon Designer installation folder.
You can select the output file name and location in the Export Result window.

5. At default the TaqMan(R) search results include TaqMan(R) quality, rating, position, length,
TaqMan(R) Tm, %GC, free energy values of most stable TaqMan(R) secondary structures.

The primer search results include pair quality, pair rating, product length, product Tm, TaOpt and
primer location, primer sequence and free energy values of the most stable secondary structures
for both the sense and the antisense primers. Sequence definition and length can also be
exported.

The Export Result window allows you to select any or all of the available data using the
appropriate check boxes.

115
Beacon Designer 5.10 Tutorial

FRET Probes Result Export

Beacon Designer can save the FRET probes and associated primer search results outside the
program by selecting the Export FRET probes Results option. The results are exported in a Tab
delimited file, ready for loading into any spreadsheet such as MS Excel and Lotus 123 for printing
or further processing.

To Export the FRET probes Search Results:

1. Select one or more sequences in the Sequence Information table.

2. Choose File > Export FRET probes Results or click button from the toolbar. Beacon
Designer saves the output file with .xls extension registered to Microsoft Excel and with .csv
extension for opening in any other spreadsheet program.

3. Beacon Designer has three option for exporting FRET probes and Primers :

a. Best FRET and Primer - At default this will be selected. Selecting this option wil let you export
FRET probe and associated primer displayed under FRET Properties tab.
b. Best FRET and All Primers - Selecting this option will let you export FRET displayed under
FRET Properties tab and all the primer pair associated with this FRET .
c. All FRET and All Primers - Selecting this option will let you export All FRET designed on
sequence and all primer pair associated with the FRET.

4.At default Beacon Designer creates the output file in the Beacon Designer installation folder.
You can select the output file name and location in the Export Result window.

5.At default the FRET probes search results include FRET probes quality, rating, position, length,
FRET probes Tm, %GC, free energy values of most stable FRET probes secondary structures.
The primer search results include pair quality, pair rating, product length, product Tm, TaOpt and
primer location, primer sequence and free energy values of the most stable secondary structures
for both the sense and the antisense primers. Sequence definition and length can also be
exported.

The Export Result window allows you to select any or all of the available data using the
appropriate check boxes.

116
Beacon Designer 5.10 Tutorial

SYBR (R) Green primers Result Export

Beacon Designer can save the SYBR (R) Green primers search results outside the program by
selecting the Export SYBR (R) Green primers Results option. The results are exported in a Tab
delimited file that can be loaded into any spreadsheet such as MS Excel and Lotus 123 for
printing or further processing.

To Export the SYBR(R) Green Primer Search Results:

1. Select one or more sequences in the Sequence Information table.

2. Choose Export the SYBR(R) Green Primer Results or click button from the toolbar.
Beacon Designer saves the output file with a .xls extension registered to Microsoft Excel and with
.csv extension for opening in any other spreadsheet program.

3. Beacon Designer has three option for exporting FRET probes and Primers :

a. Best SYBR(R) Green Primer - At default this will be selected. Selecting this option wil let you
export primers pair displayed under Primer Properties tab.
b. All SYBR(R) Green Primer Primers - Selecting this option will let you export primers pair
designed on sequence.

4.At default Beacon Designer creates the output file in the Beacon Designer installation folder.
You can select the output file name and location in the Export Result window.

5.At default the SYBR(R) Green primers search results include primer sequence, quality, rating,
position, length, primer Tm, %GC, free energy values of the most stable secondary structures for
both the sense and the antisense primers.

The primer pair search results include pair quality, pair rating, product length, product Tm, TaOpt
and primer location. Sequence definition and length can also be exported. The Export Result
window allows you to select any or all of the available data using the appropriate check boxes.

117
Beacon Designer 5.10

Export Multiplex Set

Beacon Designer can save Multiplex Taqman set search results outside the program by selecting
the Export Multiplex Set Results option. The results are exported in a Tab delimited file that can
be loaded but into any spreadsheet such as MS Excel and Lotus 123 for printing or further
processing.

To Export the Multiplex Taqman Set results:

1) Select one or more than one multiplexed group.

2) Select File> Export > Multiplex Set or click button from tool bar.
3) Select either Best or All option.
4) Select a format to export of multiplex sets.
5) Select Browse.
6) Select the location and specify the name of the file.
7) Click Save action.
8) Click Ok action.

118
Beacon Designer 5.10 Preferences

Preferences

Reaction Conditions
Beacon Designer designs optimal primers based on standard reaction conditions. You can view
and change the reaction conditions by selecting Tools>Reaction Conditions.

The following are the default reaction conditions:

Nucleic acid concentration: Default value = 0.25 nM. The concentration of nucleic acid needed
for this calculation is neither the template concentration nor the primer concentration. Rather, it is
based on the fluctuating concentration of the PCR product. The authors of the original paper,
Rychlik et al., also experienced the same difficulty, "Knowing what concentration to use for c in
the case of a PCR experiment, however, is problematical: the concentration of template changes
dramatically during the course of the PCR." In the original paper, a concentration of c = 0.250 nM
was used. We have experimentally confirmed (unpublished results) that this works well in a wider
range of primer applications. The program is set to this default concentration.

Monovalent concentration: Default value = 50 mM. This value is the concentration of all the
monovalent ions present in the reaction mixture.

Note: Whitehead/ MIT Center for Genome Research uses the nucleic acid concentration of 50
nM along with salt concentration of 50 mM, which result in very similar Tm values.

Free Mg++ ion concentration: Default value = 3.0 mM for beacon, and 5.0 mM for TaqMan®
design. This is the concentration of Mg++ ions, used as binders, in a reaction mixture.

The program computes total Na[+] equivalent concentration and displays it. The value with
default settings is 269.09 mM for beacon and 332.84 mM for TaqMan® design.

Temperature for free energy calculation: Default value = 25 oC. This is the value of
temperature that will be used to calculate the dG values. It is calculated using the formula dG =
dH - T * dS.

Temperature for Beacon free energy calculation: Default value = 55 oC. This is the value of
temperature that will be used to calculate the dG values.

Setting;
Internet

119
Beacon Designer 5.10 Technical Information

Technical Information

Internet Setting
Beacon Designer has strong web integration. The program connects to NCBI Entrez and dbSNP
for retrieving sequences online. It uses Quikfoldserver for calculating beacon Tm and determining
the template secondary structures and BLAST search the selected sequences by connecting to
NCBI BLAST server.

Beacon Designer supports both direct Internet connection and Internet connection through a
proxy server. If your organization has a firewall, Beacon Designer may need to go through a
proxy server before connecting you to the Internet. The proxy server acts as an intermediary
between your internal network (Intranet) and the Internet for retrieving files from remote web
servers.

To set Beacon Designer to work with a proxy Internet connection:

1. From the Online menu, choose Internet Settings.

2. In the Proxy Server section check the 'Use a Proxy Server' option.

3. Add the proxy server's host name or IP address under "Address".

4. Add the proxy server's port number under "Port".

5. Click OK to save the settings.

Verify Proxy Internet Settings

Beacon Designer allows you to verify your Internet connection and proxy settings.

To verify proxy Internet settings:

1. Set Beacon Designer to work with a proxy Internet connection (as discussed above).

2. Click "OK". The program will prompt you to verify proxy Internet settings.

3. Click "Yes" to verify connection. For Internet connection setting verification, program will
attempt to connect to NCBI server.

4. If the proxy server is password protected, the program will automatically detect the proxy
server setting and ask you to authenticate the connection by specifying a User Name and
Password.

Note: If the proxy server uses a domain name for authentication as well, the domain name must
be entered in the user name text field in domain-name\user-name or user-name@domain-name
format.

5. In the Authenticate Proxy window, specifyUser Name and Password. The fields are case
sensitive.

6. If Beacon Designer fails to establish a connection with the NCBI server, a warning message is
displayed and the program prompts you to correct proxy Internet setting information.

If you proceed without verifying the proxy Internet setting the Internet settings will be verified the
first time you try to load sequence from Entrez.

Note: The Internet setting is similar to the Proxy server setting used in Internet Explorer.

120
Beacon Designer 5.10 Technical Information

Automatic Product Upgrade

Product Upgrade;

We frequently publish new versions of our products which contain fixes for reported problems and
contain improvements over previous versions. These are available free of charge to our
customers and may be downloaded from our web site.

Beacon Designer's intelligent updater automatically detects the availability of a free upgrade and
installs it on your computer.

Whenever you launch the program, an upgrade message will pop-up if a free upgrade is available
on our web site. This message includes a brief description of the upgrade, a link for its detailed
description, and its size in MB.

You may choose to upgrade according to your convenience. Click Now to start updating the
version currently installed or click Later to upgrade at some convenient time. Check option Do
not remind me again to stop checking for automatic upgrades.

Once your program is upgraded please relaunch the program .

If you have stopped the automatic checking of free upgrades, select Help>Check Upgrade menu
option to check for a free upgrade manually.

To confirm the build number of the program installed on your own computer:

Select Help> About Beacon Designer menu option if you use Windows.
Select Beacon Designer> About Beacon Designer menu option if you use Mac.

121
Beacon Designer 5.10 Technical Information

Standalone WWW BLAST for Linux

Standalone WWW BLAST Server is available for UNIX/Mac OS X web servers. The following
steps are necessary to set up a Standalone WWW BLAST server on Linux:

Install RedHat Linux Server

Setup Firewall

Setup Apache webserver

Download BLAST Binaries

Install Standalone WWW BLAST Server

Setup Standalone WWW BLAST Server

Format databases

Update Standalone WWW BLAST Server configuration files

System Requirements

Troubleshooting

122
Beacon Designer 5.10 Technical Information

Install RedHat Linux Server

Local

You can skip this step, if you have a RedHat Linux Server already installed.
Beacon Designer and Standalone WWW BLAST server are tested with RedHat Linux webserver
successfully.
Beacon Designer and Standalone WWW BLAST server may work with other UNIX Apache
webservers also.
RedHat Linux server is downloadable from the RedHat Linux Homepage.
Please download RedHat Linux 7.1 from
ftp://ftp.redhat.com/pub/redhat/linux/7.1/en/
For Firewall setup for RedHat Linux 7.1, please refer the Setup Firewall section.
Please download RedHat Linux 7.2 from
ftp://ftp.redhat.com/pub/redhat/linux/7.2/en/
For Firewall setup for RedHat Linux 7.2, please consult your System administrator.

For further information, please refer http://www.redhat.com/software/linux/

123
Beacon Designer 5.10 Technical Information

Setup Firewall
Firewall set up for RedHat Linux ver 6.2, 7.0 or 7.1

1. Check Firewall setup

Run the following command (at the command prompt)
ipchains -L
If you find
input Policy REJECT
output Policy REJECT
forward Policy REJECT
The result shows that the Firewall is working and your server will not listen to any client. You
should set the Firewall rules so that the server will respond to clients.
2. Disable Firewall
If you want to give access to your Linux server and do not have any security risks then you can
disable the ipchains service using the following command at command prompt:
ntsysv
Look for the ipchains service in the services scroll box and remove " * " against it by pressing the
"spacebar".
3. Set up restricted Firewall
If you want to give restricted access of your Linux server then update the ipchains file with the
help of your system administrator.
ipchains file is available at "/etc/sysconfig/ipchains"

After the Firewall setup, set up the Apache server. Apache is basically a webserver, which is
required for accessing any web page like Standalone WWW BLAST.

124
Beacon Designer 5.10 Technical Information

Setup Apache webserver

Local

Apache is open source HTTP server for UNIX, OS/2, Windows and other platforms . It is available
as a built-in server in all the versions of the RedHat Linux server. Apache is a well known internet
webserver. It listens and forwards the client request to the Server. For e.g., Apache enables client
applications (such as Beacon Designer) to execute Local BLAST at the server. The inbuilt
Apache version for RedHat Linux 7.1 is 1.3.19. To set up the Apache webserver, it requires a
change in the httpd.conf file. The default location of httpd.conf file is "/etc/httpd/conf/httpd.conf".

Following are the directives to be setup in the httpd.conf file

1. ServerName
2. Port information
3. Listen ports
4. DocumentRoot
5. Start and stop commands for Apache
# indicates comment lines. These lines are provided for easy location of the command lines.

1. ServerName
#
# ServerName: It allows you to set a host name which is sent back to clients for your
# server if it's different than the one the program would get (i.e., use "www" instead of
# the host's real name).
#
# You will have to access it by its address (e.g., http://192.168.30.3) anyway.
#
ServerName <your machine IP address>
Example:
Servername 192.168.30.3
Server / Client machine IP address troubleshooting
To find your machine IP address please type 'ifconfig' at the command prompt. Please refer to the
troubleshooting section for complete details.

2. Port information
#
# Port: The port to which the standalone server listens. For ports < 1023, you will need
# httpd to be run as root initially.
# Change this port, if this port is being used by other application.
Port 80

3. Listen port
#
# Listen: Allows you to bind Apache to specific IP addresses and/or ports, in addition
# to the default. See also the <VirtualHost> directive. If you have changed port number
# in step no. 2 then add this port to Listen directive also.
# Listen 3000
Listen <IP address:Port>
Example:
Listen 192.168.30.3:80

4.DocumentRoot
#
# DocumentRoot: The directory out of which you will serve your documents. By default,
# all requests are taken from this directory, but symbolic links and aliases may be
# used to point to other locations.

125
Beacon Designer 5.10 Technical Information

#
DocumentRoot <"Path of your document root directory">
Example:
DocumentRoot "/home/administrator/document"
Find directory directive for DocumentRoot. This starts as
#
# This should be changed to whatever you set DocumentRoot to.
#
<Directory "Path of your document root directory end with/">
Example
<Directory "/home/administrator/document/">

5. Start and stop command for Apache webserver

Save the httpd.conf file with all those changes in above steps.
Use following commands for start, stop and restart the Apache webserver
Start Apache webserver : /etc/rc.d/init.d/httpd start
Stop Apache webserver : /etc/rc.d/init.d/httpd stop
Restart Apache webserver : /etc/rc.d/init.d/httpd restart
Note : If httpd.conf is modified, then only use restart command instead of start.

Test Apache webserver setup

To check Apache webserver,create a testapache.html file in your DocumentRoot directory (e.g.
"/home/administrator/document") and paste or enter following html in it :
<html>
<title> Apache setup testing </title>
<body>
Hello from Apache Webserver
</body>
</html>
Now access this file with your default web browser by writing following address in browser
http://Your Linux Machine Server IP Address/testapache.html
Example
http://192.168.30.3/testapache.html
The page should show the following content "Hello from Apache Server". If you face difficulties in
setting up the Apache webserver please refer to Apache Webserver set up troubleshooting.

Download BLAST Binaries

Local Binaries;
Connect to the NCBI server as an anonymous user via ftp link
ftp://ftp.ncbi.nlm.nih.gov/blast/executables/ Download the wwwblast-xxx-xxx-Your_platform.tar.gz
from "LATEST_WWWBLAST" folder. For example for Linux platform, download "wwwblast-xxx-
xxx-Linux.tar.gz" file.

126
Beacon Designer 5.10 Technical Information

Install Standalone WWW BLAST Server for Linux,

After downloading the file "wwwblast-xxx-xxx-Your_platform.tar.gz", place it in the document

directory of HTTPD server. (Document root directory set up at the time of Apache config file
httpd.conf ) and uncompress it by :

gzip -d wwwblast-xxx-xxx-Your_platform.tar.gz
tar -xvpf wwwblast-xxx-xxx-Your_platform.tar

Note : Access options stored in the distribution that parameter "p" in tar options is significant. It
will preserve file access options stored in the distribution.

For Linux platform, the commands are:

gzip -d wwwblast-xxx-xxx-Linux.tar.gz
tar -xvpf wwwblast-xxx-xxx-Linux.tar
If the distribution file is uncompressed successfully, a 'blast' directory will be created in the
DocumentRoot directory (e.g. "/home/administrator/document" directory).

Download Format db

Extract BLAST server troubleshooting

127
Beacon Designer 5.10 Technical Information

Setup Standalone WWW BLAST Server for Linux

Setup Standalone WWW BLAST Server;

To set up Standalone WWW BLAST, make some more changes in httpd.conf file. The default
location of httpd.conf file is "/etc/httpd/conf/httpd.conf".

Following directives are to be setup in the httpd.conf file

1. ScriptAlias
2. Add Handler

1. ScriptAlias
#
# ScriptAlias: This controls which directories contain server scripts. ScriptAliases are
# essentially the same as Aliases, except that documents in the reaLNA(TM)me directory
# are treated as applications and run by the server when requested rather than as
# documents sent to the client. The same rules about trailing "/" apply to ScriptAlias
# directives as to Alias.
#
ScriptAlias /cgi-bin/ "your DocumentRoot Directory/blast/"
Example
ScriptAlias /cgi-bin/ "/home/administrator/document/blast/"
#
# "/home/httpd/cgi-bin" should be changed to your ScriptAliased CGI
# directory exists, if you have configured.
#
<Directory "your DocumentRoot directory/blast/"
AllowOverride None
Options ExecCGI
Order allow,deny
Allow from all
</Directory
Example
<Directory "/home/administrator/document/blast/"
AllowOverride None
Options ExecCGI
Order allow,deny
Allow from all
</Directory

2. Add Handler
#
# AddHandler: It allows you to map certain file extensions to "handlers", actions
# unrelated to file type. These can be either built into other server or added with the
# Action command (see below)
#
# If you want to use server side includes, or CGI outside ScriptAliased directories,
# uncomment the following lines, by removing # from its start.
AddHandler cgi-script .cgi

Test Standalone WWW BLAST Server

Now access the main BLAST page by your default web browser by
http://your Linux machine server IP address/blast/blast.html
Example
http://192.168.30.3/blast/blast.html
It launches the main BLAST search page.

128
Beacon Designer 5.10 Technical Information

Refer to the Main BLAST page troubleshooting if you can not access it.

Enter the sequence of interest and BLAST search against test_na_db. If the search results are
displayed it means that local BLAST is set up correctly. If you are not able to generate the results,
refer to BLAST search troubleshooting

Download Databases

1. Connect to the NCBI server as anonymous user via ftp link ftp://ftp.ncbi.nlm.nih.gov/blast/db/
Databases can be downloaded from any standard source.
2. Download the databases.
3. Extract the database in /blast/db directory.
4. Format the database.

129
Beacon Designer 5.10 Technical Information

Format Databases
Local;

Database Formatting Tool

1. For BLAST Server released before Jan 2002, formatdb program exists in /blast/db directory.
2. For BLAST Server released in Jan 2002, formatdb, makemat and copymat binaries are
removed from the archive - those should be taken from the ftp site
ftp://ftp.ncbi.nlm.nih.gov/blast/executables/release/. This connects to NCBI server as anonymous
user. For Linux, download the archive blast-x.x.x-ia32-linux.tar.gz Copy the blast-x.x.x-ia32-
linux.tar.gz file to the blast/db directory. Uncompress it using the following commands
gzip -d blast-x.x.x-ia32-linux.tar.gz
tar -xvpf blast-x.x.x-ia32-linux.tar
It will extract the formatdb file.

Format Databases

Formatdb must be used in order to format nucleotide source databases before these databases
can be searched by blastall, blastpgp or MegaBLAST.
Requirement:
The source database may be in FASTA format. Copy the db file to your db directory of installed
blast, also place formatdb in this directory, if it not present here.
Unzip/uncompress compressed databases
Default command line:
formatdb -i filename -p F -o T
Example : alu.n is input db file
formatdb -i alu.n -p F -o T
This will generate some supporting file that is used by BLAST algorithm for BLAST search.

Additional command line options for formatdb:

-t Title for database file [String]
Optional
-i Input file for formatting (this parameter must be set)
[File In]
-l Logfile name: [File Out]
Optional
default = formatdb.log
-p Type of file
T - protein
F - nucleotide [T/F] Optional
default = T
-o Parse options
T - True: Parse SeqId and create indexes.
F - False: Do not parse SeqId. Do not create indexes.
[T/F] Optional default = F
If the "-o" option is TRUE (and the source database is in FASTA format), then the database
identifiers in the FASTA definition line must follow the convention of the FASTA Definition line
Format.
-a Input file is database in ASN.1 format (otherwise FASTA is expected)
T - True
F - False
[T/F] Optional default = F
-b ASN.1 database in binary mode
T - binary
F - text mode
[T/F] Optional default = F

130
Beacon Designer 5.10 Technical Information

A source ASN.1 database may be represented in two formats - ascii text and binary. The "-b"
option, if TRUE, specifies that input ASN.1 database is in binary format. The option is ignored in
case of FASTA input database.
-e Input is a Seq-entry [T/F]
Optional
default = F
-n Base name for BLAST files [String]
Optional
-v Number of sequence bases to be created in the volume [Integer]
Optional
default = 0
-s Create indexes limited only to accessions - sparse [T/F]
Optional
default = F
-A Create ASN.1 structured deflines [T/F]
Optional
default = F
-L Create an alias file with this name use the gifile arg (below) if set to calculate db size use the
BLAST db specified with -i (above) [File Out] Optional
-F Gifile (file containing list of gi's) [File In] Optional
-B Binary Gifile produced from the Gifile specified above [File Out] Optional

Test the added database through Beacon Designer

1. Launch BLAST search dialog.

2. Select the Local BLAST search option.
3. Select the "added database" in the Database dropdown menu.
4. If "added database" is not visible in Database dropdown menu, refer to Server configuration file
syntax.

131
Beacon Designer 5.10 Technical Information

Configuration Files
Local

Server configuration file and log file

Default configuration file is "blast.rc" and logfile "wwwblast.log" located at installed blast directory.
Setting tag WWW_BLAST_TYPE to specific value may change these names. Here is a sample
configuration file comes with this distribution:
# Number of CPUs to use for a single request
NumCpuToUse 4
#
# Here is list of combination program db1 db2 db3..., that are allowed by BLAST
# service. Format: ...
#
blastn test_na_db
blastp test_aa_db
blastx test_aa_db
tblastn test_na_db
tblastx test_na_db
To add your newly formatted db in local BLAST server, append your db input file name at the end
of its corresponding program separated by a space.
For example, if you format file alu.n then append "alu.n" at the end of line
blastn test_na_db. Now the database alu.n is associated with blastn program.
Changed program/database (s) combination looks as follows:
blastn test_na_db alu.n
blastp test_aa_db
blastx test_aa_db
tblastn test_na_db
tblastx test_na_db

132
Beacon Designer 5.10 Technical Information

System Requirements
System Requirements;

RedHat Linux 7.2 Server requirements:

For RedHat Linux 7.2 Required Recommended

CPU 486DX processor Pentium

RAM 32 MB 64 MB

Hard Disk Drive Space 1.0 GB 2.0 GB

Local BLAST Server Space 50 MB 50 MB

Depends on number of
Space for Local Databases -
databases for Local BLAST

Note : If the input FASTA file is about 500 MB then it needs around 170-200 MB additional hard
disk space for translated BLAST database. At least another 100-200 MB should be allowed for
memory consumption by the actual BLAST program.

133
Beacon Designer 5.10 Technical Information

Troubleshooting

1. Network connection
Make sure the client and server computers are connected through a network.
Use ping command at the command prompt
ping IP address/Server name
If sever and clients aren't connected, the following messages are generated
Request timed out (on Windows)
Destination Host Unreachable (on UNIX)
Please consult System administrator.

2. Apache Webserver
a) Check if the Apache webserver is running
Use the following command to verify that Apache webserver is running
ps -A | grep "httpd"
Output line(s) with "httpd" string indicate Apache webserver is running.
If not, please Restart Apache webserver
b) Check "testapache.html" is in the DocumentRoot directory.
c) Check directory directive corresponding to DocumentRoot. It gives access to pages in the
DocumentRoot directory. Please refer to DocumentRoot
If server does not accepts requests from your system, access to testapache.html file is denied. It
may be due to Firewall being implemented by RedHat Linux Server. Please consult System
administrator.

3. Extract BLAST server

During untar, if a message appears "UnExpected End of file", it indicates that the downloaded file
is either corrupted or incompletely downloaded. Please download it again.

4.Main BLAST page

Check the URL used.
a) Proper Server IP address.
b) Make sure "DocumentRoot" directory is the parent directory of blast directory or BLAST server
has been extracted in the directory which is being used as DocumentRoot.
c) Address should consists of 3 parts ("http://Server name/blast/blast.html")
http protocol
Server name or Server IP address
main page location in the blast directory

5.BLAST Search
Request method POST is not allowed for the URL
While BLASTing, if the message "Request method POST is not allowed for the URL
blast/blast.cgi" is generated,
a) "AddHandler cgi-script .cgi" is not uncommented. Find the command and uncomment it in the
httpd.conf file. Please refer AddHandler
b) CGI executables scripts of BLAST server does not have executable permissions. Please refer
to ScriptAlias

6. Server / Client machine IP address

Use the following commands at the command prompt to get the IP address of your server / client
machine:
1. ipconfig (on Windows 98/ME/2000/XP)
2. ifconfig (on RedHat Linux server)

134
Beacon Designer 5.10 Technical Information

1. IP address on Windows machine

ipconfig [press Enter] on Windows gives
IP Address. . . . . . . . . . . . . . : 192.168.30.18
Subnet Mask . . . . . . . . . . . . : 255.255.255.0
Default Gateway . . . . . . . . .. : 192.168.30.1
192.168.30.18 is client machine's IP address.

2. IP address on RedHat Linux machine

ifconfig [press Enter] on RedHat Linux gives
eth0 Link encap:Ethernet HWaddr 00:10:B5:F8:DC:0A
inet addr:192.168.30.4 Bcast:192.168.30.255 Mask:255.255.255.0
UP BROADCAST RUNNING MULTICAST MTU:1500 Metric:1
RX packets:992240 errors:0 dropped:0 overruns:0 frame:0
TX packets:1464662 errors:0 dropped:0 overruns:0 carrier:0
collisions:0 txqueuelen:100
Interrupt:11 Base address:0xc000
lo Link encap:Local Loopback
inet addr:127.0.0.1 Mask:255.0.0.0
UP LOOPBACK RUNNING MTU:3924 Metric:1
RX packets:130 errors:0 dropped:0 overruns:0 frame:0
TX packets:130 errors:0 dropped:0 overruns:0 carrier:0
collisions:0 txqueuelen:0
192.168.30.4 is server machine's IP address.

7.Uncompress the compressed database

If database archive ends with ".Z" then uncompress "blast.linux.tar.Z" with gunzip command.
For example : gunzip -d blast.linux.tar.Z
If database archive ends with ".gz" then uncompress "blast.linux.tar.gz" with following commands.
For example :
gzip -d blast.linux.tar.gz
tar -xvpf blast.linux.tar

8. Specify valid Server name/IP address

Please specify valid Server name/IP address.
1. If main BLAST page is not accessible through browser. Refer to Main BLAST page
troubleshooting
2. If main BLAST page is accessible through browser and Beacon Designer generates an error, It
may be due to one of the following reasons:
a) When you specify the IP address, please exclude "http://" from it.
b) The BLAST page name is included in the IP address. Please refer to BLAST server path and
IP address troubleshooting.
c) Given IP address/server name does not exist. Please refer to Server / Client machine IP
address troubleshooting.
d) Given server IP address or server name is incorrect. Please refer to Server / Client machine IP
address troubleshooting.
e) Client and server are not connected through local network. Please refer to Network connection
troubleshooting.
f) BLAST server may not exist in the server's DocumentRoot directory. Please refer to
BLAST server path and IP address troubleshooting.

9. BLAST server path and IP address

Suppose your server IP address or host name is "MyServer".
1. Default BLAST server path
If BLAST server is installed in the DocumentRoot directory, then main BLAST page should be
accessible by the following URL
http://MyServer/blast/blast.html

135
Beacon Designer 5.10 Technical Information

Beacon Designer expects "MyServer" as Server IP address.

2. User defined server path
If BLAST server is not installed in the DocumentRoot directory and main BLAST page is
accessible by the following URL
http://MyServer/../blastparent/blast/blast.html
Beacon Designer expects "MyServer/../blastparent" as Server IP address.
For example
If main BLAST page is accessible by the following URL
http://MyServer/blastparent/blast/blast.html
Beacon Designer expects "MyServer/blastparent" as the Server IP address.

136
Beacon Designer 5.10 Technical Information

Standalone WWW BLAST for Mac

Standalone WWW BLAST Server is available for UNIX/Mac OS X web servers. The following
steps are necessary to set up a Standalone WWW BLAST server on Mac.

Download BLAST Binaries

Install Standalone WWW BLAST Server

Setup Standalone WWW BLAST Server

Format databases

Update Standalone WWW BLAST Server configuration files

System Requirements

Troubleshooting

137
Beacon Designer 5.10 Technical Information

Download Blast Binaries for Mac

Connect to the NCBI server as an anonymous user via ftp link

ftp://ftp.ncbi.nlm.nih.gov/blast/executables/

Download the wwwblast-xxx-xxx-Your_platform.tar.gz from "LATEST_WWWBLAST" folder. For

example for Mac platform, download "wwwblast-xxx-powerpc-macosx.tar.gz" file.

138
Beacon Designer 5.10 Technical Information

Install Standalone WWW BLAST Server for Mac

After downloading the file "wwwblast-xxx-xxx-Your_platform.tar.gz", place it in the document

directory of HTTPD server. This is the DocumentRoot directory (e.g.
“/Library/WebServer/Documents”) specified in the Apache config file httpd.conf and uncompress it
with the commands :
gzip -d wwwblast-xxx-xxx -Your_platform.tar.gz
tar -xvpf wwwblast-xxx-xxx -Your_platform.tar

Note : The parameter "p" in tar options is significant. It will preserve file access options stored in
the distribution.

For Mac platform, the commands are:

gzip -d wwwblast-xxx-powerpc-macosx.tar.gz
tar -xvpf wwwblast-xxx-powerpc-macosx.tar

If the distribution file is uncompressed successfully, a 'blast' directory will be created in the
DocumentRoot directory (e.g. "/Library/WebServer/Documents" directory).

Download Format db

Extract BLAST server troubleshooting

139
Beacon Designer 5.10 Technical Information

Setup Standalone WWW BLAST Server for Mac

To set up Standalone WWW BLAST, we need to make some more changes in httpd.conf file. The
default location of httpd.conf file is "/etc/httpd/httpd.conf".

Note: Only root or super user can modify this file.

Following directives need to be setup in the httpd.conf file

1. ScriptAlias
2. Add Handler

ScriptAlias
#
# ScriptAlias: This controls which directories contain server scripts. ScriptAliases are
# essentially the same as Aliases, except that documents in the reaLNA(TM)me directory
# are treated as applications and run by the server when requested rather than as
# documents sent to the client. The same rules about trailing "/" apply to ScriptAlias
# directives as to Alias.
#

add following lines after </Directory> and before </ifModule> existed in ScriptAlias

ScriptAlias /cgi-bin/ "your DocumentRoot Directory/blast/"

<Directory "your DocumentRoot directory/blast/">

Options +ExecCGI

</Directory>

Example :

ScriptAlias /cgi-bin/ "/Library/WebServer/Documents/blast/"

<Directory "/Library/WebServer/Documents/blast/">

Options +ExecCGI

</Directory>

2. Add Handler
#
# AddHandler: It allows you to map certain file extensions to "handlers", actions
# unrelated to file type. These can be either built into other server or added with the
# Action command (see below)
#
# If you want to use server side includes, or CGI outside ScriptAliased directories,
# uncomment the following lines, by removing # from its start.
AddHandler cgi-script .cgi

Test Standalone WWW BLAST Server

Now access the main BLAST page using your web browser by entering the address:
http://your Mac machine server IP address/blast/blast.html

140
Beacon Designer 5.10 Technical Information

Example :
http://192.168.30.3/blast/blast.html
It launches the main BLAST search page.
Refer to the Main BLAST page troubleshooting if you can not access it.

Enter a sequence and BLAST search against the test database test_na_db. If search results are
displayed, the local BLAST is set up correctly. If not, refer to BLAST search troubleshooting

Download Databases

The following steps are required to obtain databases for local BLAST search:

1. Connect to the NCBI server as anonymous user via ftp link ftp://ftp.ncbi.nlm.nih.gov/blast/db/.
Databases can be downloaded from any standard source.
2. Download the databases.
3. Extract the database in /blast/db directory.
4. Format the database.

141
Beacon Designer 5.10 Technical Information

Format Databases for Mac

Database Formatting Tool

1. For BLAST Server released before Jan 2002, the formatdb program exists in the /blast/db
directory.
2. For BLAST Server released in Jan 2002, formatdb, makemat and copymat binaries have been
removed from the archive - they should be downloaded from the ftp site
ftp://ftp.ncbi.nlm.nih.gov/blast/executables/release/ . This connects to the NCBI server as an
anonymous user. For Mac, download the archive blast-x.x.x-powerpc-macosx.tar.gz. Copy the
blast-x.x.x-powerpc-macosx.tar.gz file to the blast/db directory. Uncompress it using the following
commands
gzip -d blast-x.x.x-powerpc-macosx.tar.gz
tar -xvpf blast-x.x.x-powerpc-macosx.tar
It will extract the formatdb file.

Format Databases

Formatdb must be used to format nucleotide source databases before they can be searched by
blastall, blastpgp or MegaBLAST.

The source database may be in FASTA format. Copy the db file to your db directory of installed
blast, also place formatdb in this directory,

Unzip/uncompress compressed databases

with the command :

./formatdb -i filename -p F -o T

Example : alu.n is input db file

./formatdb -i alu.n -p F -o T

This will generate some supporting files that are used by the BLAST algorithm for BLAST search.

Additional command line options for formatdb:

-t Title for database file [String]

Optional

-i Input file for formatting (this parameter must be set)

[File In]

-l Logfile name: [File Out]

Optional

default = formatdb.log

-p Type of file

142
Beacon Designer 5.10 Technical Information

T - protein

F - nucleotide [T/F] Optional

default = T

-o Parse options

T - True: Parse SeqId and create indexes.

F - False: Do not parse SeqId. Do not create indexes.

[T/F] Optional default = F

If the "-o" option is TRUE (and the source database is in FASTA format), then the database
identifiers in the FASTA definition line must follow the convention of the FASTA Definition line
Format.

-a Input file is database in ASN.1 format (otherwise FASTA is expected)

T - True

F - False

[T/F] Optional default = F

-b ASN.1 database in binary mode

T - binary

F - text mode

[T/F] Optional default = F

A source ASN.1 database may be represented in two formats - ascii text and binary. The "-b"
option, if TRUE, specifies that input ASN.1 database is in binary format. The option is ignored in
case of FASTA input database.

-e Input is a Seq-entry [T/F]

Optional

default = F

-n Base name for BLAST files [String]

Optional

-v Number of sequence bases to be created in the volume [Integer]

Optional

default = 0

-s Create indexes limited only to accessions - sparse [T/F]

Optional

default = F

143
Beacon Designer 5.10 Technical Information

-A Create ASN.1 structured deflines [T/F]

Optional

default = F

-L Create an alias file with this name use the gifile arg (below) if set to calculate db size use the
BLAST db specified with -i (above) [File Out] Optional

-F Gifile (file containing list of gi's) [File In] Optional

-B Binary Gifile produced from the Gifile specified above [File Out] Optional

Test the added database through Beacon Designer.

1. Launch BLAST search dialog.

2. Select the Local BLAST search option.

3. Select the "added database" in the Database dropdown menu.

4. If "added database" is not visible in Database dropdown menu, refer to Server configuration file
syntax.

144
Beacon Designer 5.10 Technical Information

Configuration Files for Mac

Server configuration file and log file

The default configuration file is "blast.rc" and the logfile is "wwwblast.log" are located in the
installed blast directory. Setting tag WWW_BLAST_TYPE to a specific value may change these
names. Here is a sample configuration file that comes with this distribution:

# Number of CPUs to use for a single request

NumCpuToUse 4

# Here is list of combination program db1 db2 db3..., that are allowed by BLAST

# service. Format: ...

blastn test_na_db

blastp test_aa_db

blastx test_aa_db

tblastn test_na_db

tblastx test_na_db

To add your newly formatted db to the local BLAST server, append your db input file name at the
end of its corresponding program separated by a space.

For example, if you format file alu.n then append "alu.n" at the end of line

blastn test_na_db. Now the database alu.n is associated with blastn program.

The new program/database (s) combination looks like :

blastn test_na_db alu.n

blastp test_aa_db

blastx test_aa_db

tblastn test_na_db

tblastx test_na_db

145
Beacon Designer 5.10 Technical Information

System Requirements for Mac

Mac OS X 10.3 Server requirements:

For Mac OS X 10.3 Required Recommended

CPU IMac Power PC G3 350 IMac Power PC G3 350

RAM 256 MB 384 MB

Local BLAST Server

50 MB 50 MB
Space

Space for Local Depends on number of

-
Databases databases for Local BLAST

Note : If the input FASTA file is about 500 MB then it needs around 170-200 MB additional hard
disk space for the translated BLAST database. At least another 100-200 MB should be allowed
for memory consumption by the actual BLAST program.

146
Beacon Designer 5.10 Technical Information

Troubleshooting for Mac

1. Extract BLAST server

During untar, the message "UnExpected End of file", indicates that the downloaded file is either
corrupted or incompletely downloaded. Please download it again.

2. Main BLAST page

Check the URL used.
a) Proper Server IP address.
b) Make sure "DocumentRoot" directory is the parent directory of blast directory or BLAST server
has been extracted in the directory which is being used as DocumentRoot.
c) Address should consists of 3 parts ("http://Server name/blast/blast.html")
http protocol
Server name or Server IP address, and
main page location in the blast directory

Note: We can use localhost host in place of IP Address if we are using it as a client and server
both.

3. BLAST Search
Request method POST is not allowed for the URL
While BLASTing, if the message "Request method POST is not allowed for the URL
blast/blast.cgi" is generated,
a) "AddHandler cgi-script .cgi" is not uncommented. Find the command and uncomment it in the
httpd.conf file. Please refer Add Handler
b) CGI executables scripts of BLAST server does not have executable permissions. Please refer
to ScriptAlias

4. Uncompress the compressed database

If database archive ends with ".Z " then uncompress "blast.Your_Platform.tar.Z" with gunzip
command.
For example : gunzip -d blast.Your_Platform.tar.Z
If database archive ends with ".gz " then uncompress "blast.Your_Platform.tar.gz" with gzip
commands.
For example :
gzip -d blast.Your_Platform.tar.gz
tar -xvpf blast.Your_Platform.tar

5. Specify valid Server name/IP address

Please specify valid Server name/IP address.
1. If main BLAST page is not accessible through browser. Refer to Main BLAST page
troubleshooting.
2. If main BLAST page is accessible through browser and Beacon Designer generates an error, It
may be due to one of the following reasons:
a) When you specify the IP address, please exclude "http://" from it.
b) The BLAST page name is included in the IP address. Please refer to BLAST server path and
IP address troubleshooting.
c) BLAST server may not exist in the server's DocumentRoot directory. Please refer to
BLAST server path and IP address troubleshooting.

6. BLAST server path and IP address

Suppose your server IP address or host name is "MyServer".
1. Default BLAST server path
If BLAST server is installed in the DocumentRoot directory, then the main BLAST page should be

147
Beacon Designer 5.10 Technical Information

accessible by the following URL

http://MyServer/blast/blast.html
or
http://localhost/blast/blast.html(if using as client server both)
Beacon Designer expects "MyServer" as Server IP address.

2. User defined server path

If BLAST server is not installed in the DocumentRoot directory and main BLAST page is
accessible by the following URL

http://MyServer/../blastparent/blast/blast.html

Beacon Designer expects "MyServer/../blastparent" as Server IP address.

For example

If main BLAST page is accessible by the following URL

http://MyServer/blastparent/blast/blast.html

Beacon Designer expects "MyServer/blastparent" as the Server IP address.

148
Beacon Designer 5.10 Technical Information

Algorithm and Formulae

Formula for Melting Temperature Calculation

The Tm for the primer is calculated using the following:

C - Primer concentration: 0.25 nM (acceptable range 0.1 - 100 nM)

Mg++: 3.0 mM for beacon and 5.0mM for TaqMan(R) design (acceptable range 0 - 100 mM)

Monovalent ion concentration: 50 mM (acceptable range 0 - 1000 mM)

[Na+] Equivalent Algorithm: The sodium equivalent is calculated by:

[Na+] = Monovalent ion concentration + 4 X (Free Mg2+)1/2 (all in molar concentration)

dH Calculation:
The dH is found by adding up all the di-nucleotide pairs values from the table below. If the primer
begins with a G or a C, then the init G-C correction is added, otherwise the init A-T correction is
added. The same is done for the base at the end of primer.

dS Calculation:
The same method as the dH is used. An addition salt correction term is added where N is the
number of nucleotide pairs in the primer (primer length - 1):

dS (salt corrected) = dS (1 M NaCl) + 0.368 * N * ln ([Na+])

Tm Algorithm:
The Tm for a primer is calculated from its H, S, R the gas constant (1.987 cal/kmol), and C the
primer concentration:

Tm = dH / (dS + R * ln C)

Example:
Here is an example of a Tm calculation using: Salt equiv: 204.92 mM

Primer Sequence: CAGAAGTCCACTCATTCTCG

CA AG GA AA AG GT TC CC CA AC

dH = - ( 8.5 + 7.8 + 8.2 + 7.9 + 7.8 + 8.4 + 8.2 + 8.0 + 8.5 + 8.4

CT TC CA AT TT TC CT TC CG

7.8 + 8.2 + 8.5 + 7.2 + 7.9 + 8.2 + 7.8 + 8.2 + 10.6 ) = -156.1 kcal/mol

Now we add in init G-C+ init G-C = -156.1kcal/mol + 0.1 kcal/mol + 0.1 kcal/mol = -155.9
kcals/mol

CA AG GA AA AG GT TC CC CA AC

dS = - (22.7+ 21.0 + 22.2 + 22.2 + 21.0 + 22.4 + 22.2 + 19.9 + 22.7 + 22.4

CT TC CA AT TT TC CT TC CG

21.0 + 22.2 + 22.7 + 20.4 + 22.2 + 22.2 + 21.0 + 22.2 + 27.2) = -419.8 cal/K-mol

149
Beacon Designer 5.10 Technical Information

Now we add the init G-C + init G-C =-419.4 cal/kmol + -2.8 + -2.8 = -425.4 cal/K-mol

Now we add salt correction,

NaEqiv = Na+ + 4 x sqrt(Mg++) (all concentrations molar)

= 0.05 + 4 x sqrt (0.0015)= 0.20492M

dS= -425.4 + .368 x N x ln [Na]

= -425.4 + .368 x 19 x ln .20492

= -425.4 + .368 x 19 x (-1.585)

= -436.48 cal/K-mol

Tm= H/(S + R ln C)

= -155.9 kcal/mol / (-436.48 cal/K-mol + 1.987 cal/kmol * ln(0.25e-9))

= -155.9 kcal/mol / ( -436.48 cal/ K-mol + 1.987 cal/kmol * -22.109)

= -155.9 kcal/mol /(-480.41 cal/K-mol)

= 324.51 oK

= 324.51 - 273.15 = 51.36 oC

Tm for primer as predicted by Primer Premier using Breslaur values: 52.5 oC

Dinucleotide Table Values:

Dinucleotide Sequence H kcal/mol S cal/k mol

AA OR TT -7.9 -22.2

AT -7.2 -20.4

TA -7.2 -21.3

CA OR TG -8.5 -22.7

GT OR AC -8.4 -22.4

CT OR AG -7.8 -21.0

GA OR TC -8.2 -22.2

CG -10.6 -27.2

GC -9.8 -24.4

GG OR CC -8.0 -19.9

150
Beacon Designer 5.10 Technical Information

Init w G-C 0.1 -2.8

Init w / term 2.3 4.1

151
Beacon Designer 5.10 Technical Information

Melting Temperature Calculation For LNA(TM) Probes

Formula for Melting Temperature Calculation

The Tm for the primer is calculated using the following:

C - Primer concentration: 50 nM (acceptable range 0.1 - 100 nM)

Mg++:1.8 mM for TaqMan(R) design (acceptable range 0 - 100 mM)

Monovalent ion concentration: 50 mM (acceptable range 0 - 1000 mM)

[Na+] Equivalent Algorithm: The sodium equivalent is calculated by:

[Na+] = Monovalent ion concentration + 4 X (Free Mg2+)1/2 (all in molar concentration)

dH Calculation:
The dH is found by adding up the (LNA(TM)/DNA) di-nucleotide pairs values from the table below
and DNA/DNA dinulceotide pair values from Santa Lucia values. If the primer begins with a G or
a C, then the init G-C correction is added, otherwise the init A-T correction is added. The same is
done for the base at the end of primer.

dS Calculation:
The same method as the dH is used. An addition salt correction term is added where N is the
number of nucleotide pairs in the primer (primer length - 1):

dS (salt corrected) = dS (1 M NaCl) + 0.368 * N * ln ([Na+])

Tm Algorithm:
The Tm for a primer is calculated from its H, S, R the gas constant (1.987 cal/kmol), and C the
primer concentration:

Tm = dH / (dS + R * ln C)

Example :
Here is an example of a Tm calculation using: Salt equiv: 538.18 mM
tccTcaCgcacggca

tc cc cT Tc ca aC Cg gc ca ac cg gg gc ca

Delta H Calculation :

Delta H = - (8.2 + 8.0 + 7.432 + 7.01 + 8.5 + 7.275 + 11.434 + 9.8 + 8.5 + 8.4 + 10.6 + 8.0 + 9.8 +
8.5 ) Kcal/mole
Delta H = - 121.451 Kcal/mole

Now we add in init = 2.3 + 2.3 + (-121.451)

Delta H = 116.851 Kcal/mole

Delta S Calculation :

Delta S = - (22.2 + 19.9 + 19.214 + 17.576 + 22.7 + 17.48 + 28.051 + 24.4 + 22.7 + 22.4 + 27.2 +
19.9 + 24.4 + 22.7)
Delta S = - 310.821cal/mole

152
Beacon Designer 5.10 Technical Information

Now we add in init = 4.1 cal/mole + 4.1cal/mole+ - 310.821cal/mole

Delta S = 302.621cal/mole

Now we add salt correction,

NaEqiv = Na+ + 4 x sqrt(Mg++) (all concentrations molar)

= 50 + 4 x sqrt (0.0018)= 0.21971 M

dS= -302.621 + .368 x N x ln [Na]

= -302.621 + .368 x 14 x ln 0.21971

= -302.621 + .368 x 14 x -1.515

= -302.621 + -7.808

= -310.429 cal/mole

Tm= H/(S + R ln C)

= 116.851 x 1000 / ( -310.429 + 1.987x (ln 50 x 1exp - 9))

= 116.851 x 1000 / ( -310.429 + -33.40)

= 116.851X1000 / -343.833

= -339.848 o K

= 334 -273

= 66.70 oC

Delta S calculation :

Delta H and Delta S values : These values are obtained by adding ddH and ddS correction
values to DeltaH and DeltaS values mentioned in "Sequence-Dependent Thermodynamic
Parameters for Locked Nucleic Acid (LNA(TM))-DNA Duplex Formation" By Patricia M.
McTigue,&Raymond J. Peterson,and Jason D. Kahn.

Delta H values (kcal/mol)

DNA a t g c
Bases/LNA(TM)
Base

A -6.682 -6.123 -8.634 -7.21

T -5.982 -6.823 -9.334 -7.01

G -6.982 -7.323 -8.834 -8.61

C -7.282 -6.723 -11.434 -6.81

153
Beacon Designer 5.10 Technical Information

LNA(TM) A T G C
Base/DNA
Base

a -6.775 -6.075 -6.675 -7.275

t -5.527 -6.227 -6.827 -6.527

g -8.715 -8.915 -8.515 -10.315

c -8.132 -7.432 -10.232 -7.632

Delta S values (cal/mol)

DNA a t g c
Bases/LNA(TM)
Base

A -17.474 -16.149 -21.851 -17.776

T -16.574 -17.949 -23.551 -17.576

G -17.474 -18.149 -20.751 -19.776

C -17.974 -16.749 -28.051 -15.276

LNA(TM) A T G C
Bases/DNA Base

a -17.28 -15.48 -16.08 -17.48

t -15.384 -16.284 -16.784 -16.284

g -22.072 -22.272 -19.772 -24.272

c -20.914 -19.214 -25.414 -18.114

154
Beacon Designer 5.10 Technical Information

Formula for Calculating TaOpt

Beacon Designer displays calculated optimal annealing temperature Ta Opt for current primer
pair in the Primer Preperties tab. It is the recommended annealing temperature in the PCR
reaction and is expected to yield the best PCR product yield with minimal false product
production.
We use the following formula1:
Ta Opt = 0.3 * Primer Tm + 0.7 * Product Tm – 14.9 oC
where Primer Tm is the melting temperature of the less stable primer and Product Tm is the
melting temperature of the PCR product in oC. The less stable primer is the primer with lower Tm
of the two primer Tm's.
The Ta Opt is generally lower than the Tm of the less stable primer by around 5 oC. For
templates with high GC content, the calculated Ta Opt may be too high, even higher the Tm of
the less stable primer. Running the reaction at this high temperature may result in reduced or
unspecific annealing, and smaller or unspecific product yield may result. The best method to
avoid these deleterious effects is to increase the concentration of the less stable primer
with respect to the other in the reaction. We highly recommend following this suggestion.
1 Rychlik, W., Reference (13) in Appendix D.

155
Beacon Designer 5.10 Technical Information

Formula for Free Energy

Entropy and enthalpy calculations are based upon the thermodynamic library of all 10 Watson-
Crick DNA nearest-neighbor interactions determined by SantaLucia et al. (1). Using this method,
the free energy of an oligo is calculated from the enthalpies and entropy of each dinucleotide in
the oligo and the temperature defined in the Reaction Conditions Window. The temperature
setting on the Reaction Conditions Window should be set to ambient room temperature. The
experiments are based on a 1M NaCl concentration in the PCR reaction.

dG = dH - T * dS

dH is the enthalpy.

T is the temperature.

dS is the entropy.

156
Beacon Designer 5.10 Technical Information

Formula for Rating

In Beacon Designer the sophisticated search algorithm calculates all properties of every possible
primer and probe within the allowed length and positional boundaries and rates them. Tm is
calculated based on nearest neighbor thermodynamic theory using SantaLucia values. Beacon
Designer then calculates the self-dimer and hairpin stability of each primer. To quantify the merit
of each primer, a rating number is calculated based on a number of parameters; Tm , the stability
of possible secondary structures and the location of each primer compared to the specified site
and all of their individual tolerances. The rating determines how well the designed oligo meets the
search parameters relative to the tolerance limits specified for each parameter. The parameters
included in arriving at the rating are maximum hairpin dG, maximum self-dimer dG, maximum
run/repeat length, maximum Cross-dimer dG and Tm mismatch.

From the formula it is evident that if all parameters were exactly on target or summation (S) of all
the variables is 0, the rating would be 100. On the other hand, if summation of all the variables
(parameters) is greater than zero then the rating can vary between 100 to 0. It would be 0 when
the summation of all the variables is equal to 1 or when all parameters were out at their tolerance
limits.

Tolerance is a permissible value of variation acceptable by the program for designing oligos from
a pre-set standard (Default) value. For instance variation of +/- 5°C is the tolerance value
specified for Target Tm parameter of 55°C.
The tolerance plays two related but distinct roles. First, it is used to reject primers with
parameters outside of the specified range. Then, for acceptable primers, the inverse tolerance is
the rating weight given to each parameter. There are no negative rating values because all
primers with one or more parameters out of limits are rejected.

The rating of a given probe, depends on two factors:

1. how close the probe is to the target value of each parameter.

2. how tightly the tolerances are specified.

The default tolerances provided in the program are chosen to represent the requirements of
typical experiments. Highly rated probes have most or all parameters near their ideal values and
are very likely to work well, but it is important to note that all designed primers and probes meet
all the specifications, no matter what their rating.

Target is a specified value for a particular given parameter. For instance if we specify a value for
Target Tm parameter as 55°C then this value is the Target value.

For instance one can specify the Tm tolerance, which corresponds to the acceptable range of
temperature over and below the optimal Tm for which primers are acceptable. Default for the
temperature tolerance is +/- 5 degrees.

Thus at a temperature of 55°C, the temperature will range from 50 to 60°C, allowing design of
more primers that fit into the five degree range. The primers qualifying as per criteria set will be
designed by the program. In other words, if tolerance increases then chances of primers
qualifying at majority of parameters increases and so rating also increases. Other parameters are

157
Beacon Designer 5.10 Technical Information

also considered by the program which determines the quality of any oligo for an experiment to be
a success.

NOTE: If you change the tolerance to 0, the program will display an error as: “Please enter a
number between 0.1 and 99.9”. For example, for a temperature selection of 55°C, if you give a
Tolerance of 0, the above error message is displayed.

For Beacon/ TaqMan(R) probe and primer search, the quality of the designed probe and primer is
displayed as Best, Good, Poor or Not Found in the Search Status tab. The probes and primers
having rating greater than or equal to 75 are termed Best, the probes with rating between 74 and
50 are termed as Good and those having rating below 50 are termed Poor. If no probe or primer
meeting the specified criteria is found, a "Not Found" status is displayed.

The search status appears in RED under Primer / Probe Properties tab.

For instance : Status: No primer pairs found : 294 rejected ( ProdLen: 188 TmMatch: 106)

indicates the total number of primer rejected and the parameters they failed on.

To find a suitable oligo, one may change the search parameters based on the search status
message. For the above example, one can increase both the product length and Tm to check if
its possible to design primers.

The rating assigned is just a facilitator for you to take an informed decision and indicates how
closely a primer or probe meets all the target values. When setting the tolerance limits, the sole
criteria should be acceptability. Though counter intuitive, specifying tolerances tightly does not
assure better results. A low rated probe would not necessarily fail. It may be worthwhile to
consider its properties relative to your experimental needs and decide whether the probe is
acceptable or whether the low rating is an artifact of narrow tolerances.

158
Beacon Designer 5.10 Technical Information

Appendix

Primer Design Guidelines For NASBA(R)

In NASBA(R) two primers P1 and P2 are used for amplification of RNA\DNA.

Common guidelines for P1 and P2 primers. Primers sequences should be chosen in such a
way that :

a) The melting temperature (Tm) of the primer should be 55 +/-5 oC.d.

b) Formation of internal structures/loops in the primers is not favored.

c) Primer dimerisation should be avoided.

d) Length of the primer should be 20-30 nucleotides.

e) Traces of more than 3 of the same nucleotide should be avoided.

f) Should have A as the final nucleotide at the 3' end.

g) G/C Clamp : Check the total number of Gs and Cs in the last 5 nucleotides at the 3’ end of the
primer. More than 2 Gs, 2 Cs or 1 GC is not recommended.

Guidelines for P1 Primer :

a) The 5'end of the P1 primer should be a T7 RNA polymerase promoter sequence consisting of
the following 25 nucleotides :

5'-AATTCTAATACGACTCACTATAGGG 3'

The T7 RNA polymerase promoter sequence is followed by a stretch of nucleotides that is:

a) Primer sequence should be complementary to a sequence on the target RNA.

b) In the first 10 nucleotide following the promoter sequence should be purine rich sequence.

c) GC content of 40-60%

d) Stretches of pyrimidine (C or T ) in the first 10-12 nucleotides of the P1 primer sequence

complementary to the target RNA sequence may cause abortive transcription. If no pyrimidine -
rich region is available in the target RNA (i.e. C or U residues in the target hybridizing to G or A
residues in the P1 primer), extra purine residues (for instance (AGA,AGG) can be inserted in the
P1 primer immediately after the final triplet of G residues in the T7 RNA polymerase sequence.

Molecular Beacon Design guidelines for NASBA(R) : Same as Molecular Beacon Design
guidelines for Standard Real Time PCR.

159
Beacon Designer 5.10 Technical Information

Beacon Design Guidelines

The Beacon Designer uses following universal molecular beacon design guidelines to design
most optimal beacons to successfully monitor PCR reactions. The molecular beacons should be
designed so that they hybridize to their targets at PCR annealing temperatures, whereas the free
molecular beacons stay closed and non-fluorescent at these temperatures. According to these
guidelines:

The molecular beacon probe region should be 15 to 33 nucleotides long.

Its melting temperature should be 7-10 oC higher than the PCR annealing temperature.

The loop sequence must be complementary to the target sequence of the assay.

It is important to design the molecular beacon in an area where there is minimal secondary
structure formation of the target. This will help prevent the template from preferentially annealing
to itself faster than to the molecular beacon.

It is recommended to design the molecular beacon such that it binds at or near the center of the
amplicon.

The distance between the 3' end of the upstream primer and the 5' end of the molecular beacon
(stem) should be greater than 6 nucleotides.

The melting temperature of the probe-target hybrid can be predicted using the percent GC rule.
The prediction should be made for the probe sequence alone before adding the stem sequences.

After selecting a probe sequence, two complementary arm sequences should be added, one on
each side of the probe sequence.

The stem sequences should not be complementary to the target sequence.

This stem region of the molecular beacon should be 5 to 7 bp long, with the GC content at 70-
80%.

The length, sequence and GC content of the stem should be chosen such that the melting
temperature is 7-10 oC higher than the annealing temperature of the PCR primers.

The melting temperature of stem is calculated using the Zuker hairpin folding formula: it is used to
estimate the free energy of the formation of the stem hybrid from which its melting temperature
can be predicted.

The higher the free energy, the more favorable and stable the structure. Free energy values
obtained with the Zuker program should usually range between -3 to +0.5 kcal/mole.

Since the G nucleotide may act as a quencher, it is best to avoid designing your molecular
beacon with a G directly adjacent to the fluorescent dye (typically at the 5' end of the stem
sequence). A cytosine at the 5' end of the stem is preferred.

The sequence of the molecular beacon and PCR primers should be designed so that there are no
regions of complementarity, which may cause the molecular beacon to bind to primers and
increase background.

The primers used during molecular beacon PCR experiments should be designed to produce a
relatively short amplicon generally less than 150 base pairs. The molecular beacon is an internal
probe, which must compete with the opposite strand of the amplicon for binding to its
complementary target. Having a shorter amplicon allows the molecular beacon to compete more

160
Beacon Designer 5.10 Technical Information

efficiently for binding to its target and, therefore, produces better results during molecular beacon
PCR experiments.

Presence of any secondary structure other than the hairpin stem can change position of
fluorophore with reference to quencher causing large background signals.

Following the above guidelines in the Beacon Designer the default length of probe length is 18 to
30 nucleotides. The actual implementations show that the beacon having melting temperature 10
o
C higher than PCR annealing temperature have better signal strength. The Beacon Designer by
default designs beacons that have Tm 9+ 5 oC higher than the PCR annealing temperature, so
that the melting temperature of resulting beacons is most appropriate. Both the probe and the
beacon melting temperatures are considered for beacon design. The probe melting temperature
is calculated using most accurate nearest neighbor thermodynamic calculation using Santa Lucia
values. And the beacon melting temperature of stem is calculated using the Zuker hairpin folding
formula at Quikfoldserver.

The designed beacons bind at or near the center of amplicon. These are checked for any
secondary structure such as alternate hairpins and dimers which can cause background signals.
To further reduce background signals, beacons are multiplexed with primers to check for regions
of complementarity with primers.

Primer design in the program is optimized for beacon applications; the default amplicon size is
150 bases, thereby allowing efficient detection of amplicons using molecular beacons.

Adapted from: "The molecular beacon design guidelines" developed by Dr. Sanjay Tyagi
(private communication).

161
Beacon Designer 5.10 Technical Information

TaqMan(R) Design Guidelines

The Beacon Designer uses following standard TaqMan(R) design guidelines to design most
optimal TaqMan(R) assay to successfully monitor PCR reactions. The TaqMan(R) probe is
designed such that it anneals between the upstream and the downstream primer in PCR. It is
recommended that the 3' end of the primer that lies on the same strand as the probe, should not
be not more than 10 bp away from the 5' end of the probe (ABRF design Guidelines). During the
amplification reaction, the 5' -3' exonuclease activity of the Taq polymerase cleaves the
fluorophore from the probe leading To emission of fluorescence . According to these guidelines:

The primer melting temperature (Tm) should be around 58-60 oC, and probes Tm should be 10 oC
higher than Primer Tm . The Tm of both primers should be equal.

Primers should be 15-30 bases in length.

The G+C content should ideally be 30-80%. If a higher G+C content is unavoidable, the use of
high annealing and melting temperatures, cosolvents such as glycerol, DMSO, or 7-deaza-dGTP
may be necessary.

The run of an identical nucleotide should be avoided. This is especially true for G, where runs of
four or more Gs are not allowed.

The total number of Gs and Cs in the last five nucleotides at the 3' end of the primer should not
exceed two. This helps to introduce relative instability to the 3' end of primers to reduce non-
specific priming. The primer conditions are the same for SYBR (R) Green Assays.

Maximum amplicon size should not exceed 400 bp (ideally 50-150 bases). Smaller amplicons
give more consistent results because PCR is more efficient and more tolerant of reaction
conditions (the short length requirement has nothing to do with the efficiency of 5' nuclease
activity).

The probes should not have runs of identical nucleotides (especially four or more consecutive
Gs), G+C content should be 30-80%, there should be more Cs than Gs, and not a G at the 5'
end. The higher number of Cs produces a higher normalized fluorescence values (DRn). The
choice of probe should be made first.

To avoid false-positive results due to amplification of contaminating genomic DNA in the cDNA
preparation, it is preferable to have primers spanning exon-exon junctions. This way, genomic
DNA will not be amplified.

If a TaqMan(R) probe is designed for allelic discrimination, the mismatching nucleotide (the
polymorphic site) should be in the middle of the probe rather than at the ends.

162
Beacon Designer 5.10 Technical Information

LNA(TM) Substituted TaqMan(R) Design Guidelines

1. Tm of the probe should optimally be 10 °C higher than Tm of the forward primer. In case of
single mutation detection the Tm-difference should be 7 °C. Maintain Tm with LNA(TM)
substitutions to match the Tm of the corresponding longer DNA probe.

2. Typical Tm of dual labeled probes: 65-70 °C (i.e. slightly lower than the extension
temperature). Typical Tm of PCR primers for dual labeled assays: 58-60 °C.

3. Optimal length of LNA(TM) substituted dual labeled probes: 15-18 nucleotides.

4. LNA(TM) should always be substituted in the central segment i.e two bases should be left from
3' end and 2 bases from 5' end.

5. Usually 4-6 LNA(TM) substitutions are required to obtain a useful Tm.

5. In case of single nucleotide mutations studies,select the probe sequence so that the mutation
is located centrally in the probe. Make a single LNA(TM) substitution at the position of the single
nucleotide mutation.

6. Avoid LNA(TM) substitutions participating in formation of secondary structures.

7. Position the dual labeled probe as close as possible to the forward primer. Avoid Guanine (G)
in the 5’-position next to the fluorophore.

8. Avoid longer stretches of identical nucleotides and especially G’s.

9. GC-content should be between 30-80 %.

163
Beacon Designer 5.10 Technical Information

FRET probe Design Guidelines

The Beacon Designer uses following standard FRET Probes design guidelines to design most
optimal FRET Probe assay to successfully monitor PCR reactions.

1. Probe length: Usually probes are 23 - 35 bases in length.

2. Probe position: At annealing temperature, two probes must hybridize close to each other to
allow proper transfer of energy for FRET to occur. The 3 end of the first probe (donor probe) must
be within 1-5 bases from the 5' end of the second probe (acceptor probe). Default = 1 base.

The probe target should be near the 5’ end of the target strand (i.e., as far as possible from the
5’primer-binding site on the same strand), but not overlapping the primer-binding site on the
opposite strand.

3. Probe Tm: The two probes Tm should be at least 5° -10° C above the primer Tm. The probe
Tm should not be > 10 to 20° C to avoid interference. The optimal T Tm difference between the
two probes for detection and quantification, should be the same (within 2ºC of each other). For
mutation detection, the difference between probe Tm is 5–10ºC. The probe with the lowest
stability should be positioned directly over the mutation to be detected.

4. Secondary structures: The probes should not contain repeats and runs, self complimentary
sequences, and clusters of G and C at either end.The probes should not form cross dimers with
primer.

5. GC %: The G/C content of probe should range between 38 -60%. (A/T rich probes tend to
hybridize poorly and G/C rich probes may bind too tightly to the target).

6. Probe modification: The 3' end of the probe must be modified to prevent probe extension. The
3' end of the acceptor probe is phosphorylated. The 3' end of donor probe is labeled with
fluorescein and thus cannot extend during PCR.

7. Probe label: The adjacent ends of the hybridization probes should be labeled with
fluorophores. Probe 1("donor" or 5’ probe) is labeled at 3’ end with Fluorescein (FITC, 3FL).
Probe 2 or ("acceptor" or 3’ probe) is labeled at 5’ end.

164
Beacon Designer 5.10 Technical Information

SYBR (R) Green Primer Design Guidelines

Other than the general primer design parameters Beacon Designer uses following standards for
designing most optimal primers for a SYBR (R) Green assay.

It is important that the SYBR (R) Green primers specifically anneal to the target and do not form
dimers. The following are the specific parameters that are to be considered.

Keep G-C contents in the 30-80% range. Default 50%

Avoid runs of an identical nucleotide. This is true especially for G and C, where runs of four or
more Gs & Cs should be avoided. Default 3

G/C Clamp : Check the total number of Gs and Cs in the last 5 nucleotides at the 3’ end of the
primer. More than 2 Gs, 2 Cs or 1 GC is not recommended.

The melting temperature (Tm) of the primer should be 55 +/-5 oC.

165
Beacon Designer 5.10 Technical Information

Glossary
Alternate Primer - A primer pair that is rated lower than the best primer pair. The best primer pair
is displayed in the Primer Properies tab

Amplicon - A PCR amplified segment of DNA.

Annealing Temperature - The temperature at which pairing of two complementary single-

stranded nucleic acids occurs to form a double-stranded (duplex) nucleic acid.

Antisense Primer - A primer that primes the sense strand of the DNA sequence. Alternatively
termed a reverse primer, or sometimes, a downstream primer.

Background Fluorescence - Refers to the fluorescence inherent in an assay or experiment due

to inefficient quenching of the reporter dye or spurious side reactions.

Beacon Assays - A PCR type reaction that uses a probe partially complementary to the same
area that is being amplified and is labeled with a fluorescent dye on the 5 prime end and contains
a quencher on the 3 prime end. The probes sequence contains an extended sequence on the
ends that are complementary to each other. In solution, the ends bind together creating a hair-pin
structure that brings the dye and quencher very close together. If a complementary section in the
amplified DNA exists, the center section of the probe hybridizes and breaks apart the hair-pin
structure which separates the dye and quencher sufficiently for the dye to emit measurable light.

Beacon Tm - Melting temperature of the beacon hairpin structure, which includes both, the
beacon probe (loop) and the stem.

cDNA - complementary DNA, a DNA molecule generated by reverse transcription from an RNA
(generally mRNA) template.

Complementary - Refers to a nucleic acid sequence that matches and binds to another
sequence.

Complementary Beacon Sequence - Sequence complementary to the beacon probe sequence

used for beacon characterization.

Fluorophore - A class of molecules called reporter dyes that emit or fluoresce light of a particular
wavelength as a result of being irradiated with light of another particular wavelength that excites
the molecule.

Free energy -The relative energy associated with an energetic system.

FRET - Fluorescence Resonance Energy Transfer.

Run/repeat maximum length - Numerically, the GC Clamp is the number of Gs and Cs that exist
within the first five bases of the 3’ end. It imparts strong annealing at 3' end.

Hairpin - Hairpins are formed within single primer due to internal self complementarity. Hairpin is
said to be formed when the primer fold backs on itself and forms bonds at any other site.

Homology - Similarity in DNA or protein sequences between individuals of the same species or
amongst different species.

Hybridization - The process of joining two complementary strands of DNA or one each of DNA
and RNA to form a double-stranded molecule.

Molecular beacons - Molecular beacons are hairpin shaped molecules with an internally
quenched fluorophore whose fluorescence is restored when they bind to a target nucleic acid.

166
Beacon Designer 5.10 Technical Information

Multiplex - A sequencing approach that uses several pooled samples, greatly increasing
sequencing speed.

Oligonucleotide - a short, usually chemically synthesized polynucleotide. An oligonucleotide is

typically 10 to 30 bases in size, but may be over 100 bases long. Synthetic oligonucleotides are
frequently used as primers in Sanger dideoxy sequencing or PCR, or as probes to identify a gene
sequence of interest.

Optimal Annealing Temperature (Ta Opt) - The temperature for any given primer pair at which
the primer pair anneals to the complementary target in the sequence. Use of this temperature in
the annealing step of the PCR cycle usually results in an optimal PCR product yield with minimum
false priming.

Polymerase chain reaction or PCR - A series of reactions that result in the amplification of a
specific DNA.

Primers DNA oligonucleotides that are used in Polymerase Chain Reaction (PCR) amplify the
chosen fragment from a DNA sequence.

Primer Melting Temperature (Tm) - The temperature at which one half of the primer-template
DNA duplex will dissociate and become single stand DNA. The stability of the primer-template
DNA duplex can be measured by its melting temperature (Tm). OR The melting temperature of a
primer(Tm) refers to the temperature at which the primer is annealed to 50% of its exact
complement (template). The melting temperature is calculated by Nearest neighbor
thermodynamic stability using Santa Lucia or Bresulaur Values

Product Melting Temperature (Tm) - The temperature at which one half of the amplified DNA
duplex in PCR reaction will dissociate and become single stranded.

PCR Extension Step - This step occurs after the DNA strands have been separated by heat and
after the step where the primers have annealed (hybridized) to the ends of DNA template. In this
step, a thermal -stable DNA polymerase binds to and extends the ends of the primers using the
opposite strand as a template until it has made a complementary copy. Thermal-stable
polymerases are most active within a certain range of temperature.

Primers - DNA oligonucleotides that are used in Polymerase Chain Reaction (PCR) to determine
the ends of the amplified DNA fragment the reaction generates in the presence of a polymerase.

Primer dimer - Artifacts, non- target amplification products, caused by homologies within
primers.

Probes - Single-stranded DNA or RNA molecules of specific base sequence that are used to
detect the complementary base sequence by hybridization.

Probe Tm - Melting temperature of the beacon probe (loop) sequence that is complementary to
the target. Calculations do not include the stem of the beacon.

Quenchers - A class of molecules that can absorb the emission of a fluorescent dye when in
close proximity; these molecules are often fluorescent themselves.

Real Time PCR - The ability to monitor the real-time progress of the PCR, without the need for
post-PCR analysis. A fluorescent reporter is used to monitor the PCR in real time.

Single Nucleotide Polymorphisms (SNPs) - A single base pair difference in a DNA sequence
shared among individuals.

Sense Primer - A primer that primes the antisense strand, alternatively termed a forward primer
or, an upstream primer.

167
Beacon Designer 5.10 Technical Information

Secondary structures - These form due to intramolecular or intermolecular interactions of

primers or probe sequence, example: dimers and hairpins. They greatly reduce the availability of
primer for reaction.

Sensor and Anchor Probes - When FRET hybridization probes are used to detect mutations,
the probe detecting the mutation site is known as SENSOR probe, while the other probe
producing the fluorescent signal is known as ANCHOR probe.

TaqMan(R) / 5'-nuclease assays - A PCR type reaction that uses a probe complementary to an
area being amplified and is labeled with a fluorescent dye on the 5 prime end and contains a
quencher on the 3 prime end. If the probe binds to the DNA being amplified, TAQ polymerase
cuts off the 5 prime ends containing the fluorescent dye. Now free from the proximity of the
quencher, the free-dye which is proportional to the amount of amplified DNA, emits measurable
light.

5' to 3' orientation -the direction along a polynucleotide molecule as defined by proceeding from
the 5'-phosphate terminus towards the 3' -hydroxyl terminus or by extending a polynucleotide by
the addition of residues to the 3'-hydroxyl terminus.

168
Beacon Designer 5.10 Technical Information

System Specifications
Specifications;

Supported Operating Systems Microsoft’s Windows 98, ME, NT 4.0, 2000 and XP
Professional. Apple's Mac OS X 10.3.7.

System Requirements:

For Windows OS Required Recommended

CPU Pentium-II 400 MHz Pentium-III 650 MHz

RAM 128 MB 192 MB

Hard Disk Drive Space 40 MB 50 MB

Screen Resolution 800 X 600 > 800 X 600

For Macintosh OS X Required Recommended

CPU IMac Power PC G3 350 IMac Power PC G3 350

RAM 256 MB 384 MB

Hard Disk Drive Space 15 MB 25 MB

Screen Resolution 800 X 600 > 800 X 600

169
Beacon Designer 5.10 Technical Information

Software Limits

Software limits

Sequence Supported 15 MB

Sequence format Supported GenBank, FASTA, GenBank Like, dbSNP,

Text sequence

Primer Search limits

Search Range Supported 50,000 bp

Primer Search Range 25 bp

Minimum Primer length 10 bp

Minimum Amplicon length 50 bp

Maximum Amplicon length 5000 bp

Maximum Primer length 99 bp

Maximum Alternate Primer pairs 50

Beacon Search limits

Search Range Supported 50,000 bp

Maximum Sequence for Beacon Search 5

TaqMan® Search limits

Search Range Supported 10,000 bp

Length Range 15

Minimum length 10 bp

Maximum length 99 bp

Minimum Amplicon length 50 bp

Maximum Amplicon length 5000 bp

Maximum Alternate Primer pairs and 50

TaqMan® Probes

170
Beacon Designer 5.10 Technical Information

Maximum Sequence for TaqMan® Search 4

LNA(TM) Substituted TaqMan Search limits

Length Range 15

Minimum length 7

Maximum length 40

Minimum No. Of LNA(TM) 1

Maximum No. Of LNA(TM) 10

Minimum LNA(TM) Frequency 2

Maximum LNA(TM) Frequency 10

Minimum LNA(TM) Phase Off Value 2

Maximum LNA(TM) Phase Off Value 19

Multiplex TaqMan® Search limits

Sequence Range Supported 10,000bp

Length Range 15

Minimum Length
10bp

Maximum length 99bp

Amplicon Length Range difference 50bp

Minimum Amplicon Length 50bp

Maximum Ampliconlength 5000bp

Maximum Alternate Primer pairs and

50
TaqMan® Probes

Maximum Sequence for Multiplex 4

171
Beacon Designer 5.10 Technical Information

Search

Maximum Sequence selected as Number of Selected sequence for multiplex search

reference gene -1

FRET probe Search limits

Search Range Supported 10,000 bp

Length Range 15

Minimum length 10 bp

Maximum length 99 bp

Minimum Amplicon length

50 bp

Maximum Amplicon length 5000 bp

Maximum Alternate Primer pairs and FRET 50

Probes

Maximum Sequence for FRET Probe Search 1

SYBR (R) Green Primer Search limits:

Search Range Supported 50,000 bp

Primer Search Range 25

Minimum Primer length 10 bp

Minimum Amplicon length 50 bp

Maximum Amplicon length 5000 bp

Maximum Primer length 99 bp

Maximum Alternate Primer pairs 50

Maximum Sequence for SYBR (R) Primer 5

Search

172
Beacon Designer 5.10 Technical Information

BLAST limits:

Number of sequence searched at a time 1 Sequence

Number of requests sent to NCBI 1 query at a time.

RID Polling 30 sec for first time and every 60 sec after
that

In case of ISA/NTLM proxy 7000 bps

Other proxy and direct internet connection NO LIMIT

Template Structure limits:

Number of sequence searched at a time 1

Number of requests sent to QuikFold 1 query at a time.

Maximum length of bases 1200BP

Minimum length of bases 50BP

Additional Information:

Multiplex Primer -Primer 5 Sequences

Multiplex Beacon- Primers 5 Sequences

Multiplex TaqMan- Primers 4 Sequences

Multiplex FRET- Primers Not supported

Multiplexing of SYBR (R) Green Primers Not supported

Number of SNP selected per sequence 1

Number of SNP per sequence Unlimited

SNP format supported /replace="t"

Number of SNP deleted per sequence All

Number of Primers evaluated at once 1

173
Beacon Designer 5.10 Technical Information

Number of Beacons evaluated at once 1

SNP Position No limit

174
Beacon Designer 5.10 Technical Information

Terms of Use

Beacon Designer connects to the Quikfoldserver available at:

http://www.bioinfo.rpi.edu/applications/mfold/old/rna/form3.cgi

This server is run by Professor Michael Zuker at Rensselaer Polytechnic Institute. The
Quikfoldserver uses the mfold software, copyright Washington University, created by Professor
Zuker.

PREMIER Biosoft International assumes no liability for unauthorized or illegal use of this server.
Further information on the server is available at:
http://www.bioinfo.rpi.edu/applications/mfold/old/dna/form1.cgi

NCBI's Disclaimer and Copyright notice:

http://www.ncbi.nlm.nih.gov/About/disclaimer.html

BLAST Server - Terms of Use

Beacon Designer connects to the BLAST server at:

http://www.ncbi.nlm.nih.gov/blast/Blast.cgi

This server is run by the U.S. Government. The user will be responsible for following the
guidelines and policies set up by the U.S. Government for using the BLAST server.

PREMIER Biosoft International assumes no liability for unauthorized or illegal use of this server.

For your convenience, we urge you to strictly follow these guidelines:-

- Submit only a few thousand individual requests per day (not more than 2000 per day),

- Limit all large searches to the off peak hours of 9 PM to 5 AM Eastern Standard Time (USA).

For further information or queries please visit:

http://www.ncbi.nlm.nih.gov/BLAST/

175
Beacon Designer 5.10 Technical Information

Registered Tademarks:

TaqMan(R): TaqMan is a registered trademark of Roche Molecular Systems, Inc.

SYBR(R): SYBR(R) is the registered trademark of Molecular Probes INC.

NASBA®: NASBA® is the registered trademark of bioMérieux.

176
Beacon Designer 5.10 Technical Information

References

1. SantaLucia, J., Jr. (1998) "A Unified View of Polymer, Dumbbell, and Oligonucleotide
DNA Nearest-neighbor Thermodynamics", Proc. Natl. Acad. Sci. U.S.A. 95, 1460-1465.
2. Lathe, R. (1986) "Synthetic oligonucleotide probes deduced from amino acid sequence
data: theoretical and practical considerations", J. Mol. Biol. 183, 1-12.
3. Groebe, D.R., and Uhlenbeck, O. C. (1988) "Characterization of RNA hairpin loop
stability", Nucleic Acids Res. 16, 11725-11735.
4. Jung, V., Pestka, S. B., and Pestka, S. (1990) "Efficient cloning of PCR generated DNA
containing terminal restriction endonuclease recognition sites", Nucleic Acids Res. 18,
6156.
5. Zuker, Mathews, D.H., and Turner, D.H. (1999) "Algorithms and Thermodynamics for
RNA Secondary Structure Prediction", A Practical Guide In RNA Biochemistry and
Biotechnology.
6. Mathews, Sabina, J., Zuker, M., and Turner, D.H. (1999) "Expanded Sequence
Dependence of Thermodynamic Parameters Improves Prediction of RNA Secondary
Structure", J. Mol. Biol. 288, 911-940.
7. Kwok, S., Kellogg, D. E., McKinney, N., Spasic, D., Goda, L., Levenson, C., and Shinsky,
J. J. (1990) "Effects of primer-template mismatches on the polymerase chain reaction:
human immunodeficiency virus type I model studies", Nucleic Acids Res. 18, 999-1005.
8. Holton, T. A., and Graham, M. W. (1991) " A simple and efficient method for direct
cloning of PCR products using ddT-tailed vectors" Nucleic Acids Res. 19, 1156.
9. Freier, S.M., Kierzek, R., Jaeger, J.A., Sugimoto, N., Caruthers, M.H., Neilson T., and
Turner, D.H. (1986) "Improved free-energy parameters for predictions of RNA duplex
stability", Proc. Natl. Acad. Sci. USA 83, 9373-9377.
10. Dieffenbach, Lowe, T.M.J., and Dveksler, G.S. (1993) "General Concepts for PCR Primer
Design", PCR Methods and Applications.
11. Shirley, Kwok, Sheng-Yung Chang, John, J. Sninsky, and Wong, Alice (1994) "A Guide to
the Design and Use of Mismatched and Degenerate Primers", PCR Methods and
Applications.
12. Kenneth, H., Roux (1995) "Optimization and Troubleshooting in PCR", PCR Methods and
Applications.
13. Rychlik, W., Spencer, W.J., Rhoads, R.E. (1990) "Optimization of the annealing
temperature for DNA amplification in vitro", Nucleic Acids Research 18, 6409-6412.
14. Wetmur, J.G. (1991) "DNA Probes: Applications of the Principles of Nucleic Acid
Hybridization", Criti. Rev. in Biochem. And Mol. Biol. 26, 227-259.
15. Vinay K. Singh, Mangalam, A.K., Dwivedi, S., and Naik, S. (1998) "Primer
Premier: Program for Design of Degenerate Primers from a Protein Sequence",
BioTechniques 24, 318-319.
16. Belinda, A.J., Giesendorf, Jacqueline, A.M., Vet,,. Tyagi, Sanjay., Ewald J.M.G., Mensink,
Frans Trijbels, J.M., and Henk, J. Blom "Molecular beacons: a new approach for
semiautomated mutation analysis": Clinical Chemistry 44:3 482 -486 (1998).
17. Jacqueline A. M. Vet, Amit R. Majithia, Salvatore A. E. Marras, Tyagi Sanjay, Syamalima
Dube, Bernard J. Poiesz, and Fred Russell Kremer. (1999). "Multiplex detection of four
pathogenic retroviruses using molecular beacons" Proc. Natl. Acad. Sci. USA Vol. 96,
6394-6399.
18. Salvatore A.E. Marras, Fred Russell Kramer, Tyagi Sanjay (1999) "Multiplex detection of
single-nucleotide variations using molecular beacons". Genetic Analysis: Biomolecular
Engineering.14 151-156.
19. ABRF design guidelines : "The 3’ end of the primer that is on the same strand as the
probe should be, optimally, 5 bases from the 5’ end of the probe, but within 10 bases is
acceptable."

177