Thanks to visit codestin.com
Credit goes to www.scribd.com

0% found this document useful (0 votes)
39 views3 pages

tmpD28C TMP

This document describes a cost-effective method for constructing high-quality cDNA libraries that combines reverse transcriptase template switching with assisted recombination cloning. The method anchors both ends of the cDNA, synthesizes the second strand without digestion or subcloning, and clones the cDNA directly into an entry vector through recombination. This eliminates labor-intensive steps from commercial methods and results in higher clone yields at substantially lower time and cost compared to standard methods. The method was validated using grapevine mRNA, producing over 100 million clones with an average library titer of 10^8 cfu/mg cDNA.

Uploaded by

Frontiers
Copyright
© © All Rights Reserved
We take content rights seriously. If you suspect this is your content, claim it here.
Available Formats
Download as PDF, TXT or read online on Scribd
0% found this document useful (0 votes)
39 views3 pages

tmpD28C TMP

This document describes a cost-effective method for constructing high-quality cDNA libraries that combines reverse transcriptase template switching with assisted recombination cloning. The method anchors both ends of the cDNA, synthesizes the second strand without digestion or subcloning, and clones the cDNA directly into an entry vector through recombination. This eliminates labor-intensive steps from commercial methods and results in higher clone yields at substantially lower time and cost compared to standard methods. The method was validated using grapevine mRNA, producing over 100 million clones with an average library titer of 10^8 cfu/mg cDNA.

Uploaded by

Frontiers
Copyright
© © All Rights Reserved
We take content rights seriously. If you suspect this is your content, claim it here.
Available Formats
Download as PDF, TXT or read online on Scribd
You are on page 1/ 3

Biomolecular Engineering 24 (2007) 419421

www.elsevier.com/locate/geneanabioeng

Short communication

Cost effective method for construction of high quality cDNA libraries


Andreia Figueiredo *, Aladje Balde, Helia Cardoso 1, Maria Salome Pais
Unit of Molecular Biology and Plant BiotechnologyICAT (Institute for Applied Science and Technology) Ed. ICAT,
Campo Grande, 1749-016 Lisbon, Portugal
Received 29 March 2007; accepted 22 May 2007

Abstract
A PCR-based method for the synthesis of high quality cDNA is described. This method combines the reverse transcriptase template switching
with the assisted recombination cloning. It enables 50 end enrichment, cDNA synthesis from limiting starting material, elimination of digestion and
subcloning steps and substantial time and cost savings.
# 2007 Elsevier B.V. All rights reserved.
Keywords: cDNA library; Recombination; Cloning; Reverse transcription

Reverse transcription of cDNA from mRNA is one of the


most widely used methods in molecular biology. Conventional
cDNA library construction methods (Gluber and Hoffman,
1983) have been substituted by new leading technologies such
as the SMART and the Gateway methods, which rely on the
reverse transcriptase template switching properties (Zhu et al.,
2001) and on the site-specific recombination assisted method
(Hartley et al., 2000; Ohara and Temple, 2001; Ohara et al.,
2002), respectively. Both methods are commercially available
but are either rather laborious or expensive.
Our approach intended to combine the best of this two
leading technologies, by developing a method that is time and
cost effective and allows high throughput isolation of cDNA
clones for microarray application. In our method, we used the
reverse transcriptase template switching properties (Zhu et al.,
2001) and eliminated all the digestion and subcloning steps
replacing them by direct recombination assisted cloning. This
substitution was achieved through the design of a new adaptor
oligonucleotide sequence with the recombination attB sites.
Our method is highly effective when working with high
throughput technologies such as cDNA microarrays, where
thousands of cDNA clones have to be isolated and where
reduction of labor and costs are pursued.

* Corresponding author.
E-mail address: [email protected] (A. Figueiredo).
1
Laboratory of Molecular BiologyICAM (Institute for Mediterranean
Agrarian Sciences) Evora University, Polo da Mitra, 7002-554 Evora, Portugal.
1389-0344/$ see front matter # 2007 Elsevier B.V. All rights reserved.
doi:10.1016/j.bioeng.2007.05.004

Our procedure allows both ends of the first cDNA strand to


be anchored as distinct recombination sites are added to each
end during reverse transcription. The 30 end of the first cDNA
strand is anchored with the help of a template switching
oligonucleotide which contains the attB1 recombination site.
When reverse transcriptase reaches the 50 end of the mRNA, the
terminal transferase activity of the enzyme adds additional
nucleotides (predominantly dCTP) that are not encoded by the
template (Clark, 1988; Kulpa et al., 1997). The attB1 primer
contains three consecutive G nucleotides at the 30 end that will
act as a second template for the reverse transcriptase. When
reverse transcriptase reaches the 50 end of the mRNA, the
complementary interaction of the (G)3 stretch at the 30 end of
the attB1 primer and the dC-rich extended sequence of the
cDNA promotes the template switching. The reverse transcriptase transcribes the oligonucleotide while adding the attB1
recombination site. This procedure, similar to the one used by
the SMART method, allows the full-length cDNA enrichment.
The second strand cDNA cloning is performed by site-specific
recombination reaction, avoing the use of a restriction enzyme
and the cloning in an intermediate vector (Fig. 1).
To validate the effectiveness of our method, we used 1 mg of
mRNA isolated from grapevine leaves (Vitis vinifera L.). To
prepare the first cDNA strand we combined the following
reagents 1 mg of poly(A)+ RNA, 20 pmol of attB1 primer: 50 GGGGACAAGTTTGTACAAAAAAGCAGGCTGGCCGGG30 , 20 pmol of attB2-oligo(dT) primer: 50 -GGGGACCACTTTGTACAAGAAAGCTGGGT(T)18(V)-30 . The underline highlights
the attB1 and attB2 recombination site sequences, respectively.

420

A. Figueiredo et al. / Biomolecular Engineering 24 (2007) 419421

Fig. 1. Schematic representation of the cDNA library construction method reported. (A) The first strand synthesis is achieved in two steps: first, the attB2-oligo(dT)
primer hybridizes to the mRNA poly(A)+ tail and then, the Superscript II reverse transcriptase synthesizes the first strand of the cDNA, using the poly(A)+ RNA as a
template, adding a (dC) tailing where the attB1 primer hybridizes. (B) The resulting cDNA was treated with RNAseH. (C) In a PCR reaction using the first strand
cDNA as a template and the 50 attB1 and attB2-oligo(dT) as primers, the second strand is synthesized and the attB recombination sites are created. (D) The cDNA
flanked by the attB1 and attB2 recombination sites is transferred to the entry vector pDNORTM221 by the Gateway BP recombination reaction creating an entry
library and a by-product.

The mixture was incubated at 68 8C for 5 min and immediately


cooled on ice. The volume was then adjusted to 20 ml with the
following reagents: 20 mM dNTPs, 5 first strand buffer
(250 mM TrisHCl pH 8.3, 15 mM MgCl2, 375 mM KC),
20 mM DTT and 400 U of Superscript II reverse transcriptase
(200 U/ml) (Invitrogen). Reverse transcription and template
switching were carried out at 50 8C for 1 h. RNAwas degraded by
adding 4 U of RNAse H (2 U/ml) and incubating for 20 min at
37 8C.
For the second strand synthesis, 3 ml of the synthesized first
strand cDNA was used as template. The second strand synthesis
was performed in a 100 ml mixture composed by 10 Long
Distance PCR buffer (0.4 M Tricine, 150 mM KOAc, 35 mM
MgOAc, 200 mg BSA, 0.1% Tween20, 0.1% Nonidet-P40),
20 mM dNTPs, 20 pmol 50 attB1 primer: (50 -GGGGACAAGTTTGTACAAAAAAGC-30 ) 20 pmol attB2-oligo(dT)
primer and 10 U Taq DNA polymerase (Invitrogen), in a

termocycler (T1-termoblock Biometra). The PCR program


consisted on 20 s at 95 8C and 20 cycles of 5 s at 95 8C and of
6 min at 68 8C. Second strand cDNA synthesis was visually
analyzed on 1.2% agarose/ethidium bromide gel and size
fractionated by column chromatography (Chroma Spin-400
columns, Clontech).
On the second strand synthesis the full-length cDNAs
are preferentially amplified because the 50 attB1 primer
(located within the attB1 primer sequence) and the attB2oligo(dT) primer are located in the 50 and 30 end,
respectively.
The cDNA library was cloned into pDNORTM221 (Invitrogen) by the recombination assisted method (BP recombinase,
Invitrogen), following manufacturers instructions (www.invitrogen.com/content/sfs/manuals/gatewayman.pdf). The recombination yielded 2.17  108 cfu/mg of cDNA and the average
library titter was 108 cfu/mg of cDNA.

A. Figueiredo et al. / Biomolecular Engineering 24 (2007) 419421

Our method has important advantages such as elimination of


digestion and subcloning steps present in commercial methods
and substitution of those steps by direct highly efficient
recombinational cloning of cDNA into an entry vector. This
procedure, when compared to standard cDNA library construction methods, results on a much higher number of primary clones,
allowing the production of high yield and quality double-stranded
cDNA and eliminating the number of chimeric clones. With this
method we have obtained high quality results, but with substantial
time and cost savings (up to 30%). Our wide experience in the
construction of cDNA libraries from herbaceous and woody plant
species using the traditional methods enables us to consider that
the method here described provides a good solution for isolating
cDNA clones for microarray application as it enables the
production of 100% recombinant clones.
Acknowledgements
We wish to thank Jorge Boehm for supplying the plant
material. This work has been carried out in the project
RESISTEVID funded by the Agencia de Inovacao, S.A
and Fundacao para a Ciencia e Tecnologia for the grants:

421

SFRH/BD/3060/2000, SFRH/BPD/11510/2002 and SFRH/


BD/12403/2003.
References
Clark, J.M., 1988. Novel non-template nucleotide addition reactions catalysed
by prokaryotic and eukaryotic DNA polymerases. Nucleic Acids Res. 16,
96779686.
Gluber, U., Hoffman, B.J., 1983. A simple and very efficient method for
generating cDNA libraries. Gene 25, 263269.
Hartley, J.L., Temple, G.F., Brash, M.A., 2000. DNA cloning using in vitro sitespecific recombination. Genome Res. 10, 17881795.
Kulpa, D., Topping, R., Telesnitsky, A., 1997. Determination of the site of first
strand transfer during Maloney murine leukaemia virus reverse transcription
and identification of strand transfer-associated reverse transcriptase errors.
EMBO J. 16, 856865.
Ohara, O., Temple, G., 2001. Directional cDNA library construction assisted by
the in vitro recombination reaction. Nucleic Acids Res. 29, e22.
Ohara, O., Nagase, T., Mitsui, G., Kohga, H., Kikuno, R., Hiraoka, S.,
Takahashi, Y., Kitajima, S., Saga, Y., Koseki, H., 2002. Characterisation
of size-fractionated cDNA libraries generated by the in vitro recombinationassisted method. DNA Res. 9, 4757.
Zhu, Y.Y., Machleder, E.M., Chenchik, A., Li, R., Siebert, P.D., 2001. Reverse
transcriptase template switching: a SMART approach for full-length cDNA
library construction. Biotechniques 30, 892897.

You might also like