An Introduction To Information Theory and Entropy: Tom Carter CSU Stanislaus
An Introduction To Information Theory and Entropy: Tom Carter CSU Stanislaus
Tom Carter
CSU Stanislaus
http://astarte.csustan.edu/˜ tom/SFI-CSSS
[email protected]
Santa Fe
September 3, 2014
1
Contents
Measuring complexity 5
Some probability ideas 9
Basics of information theory 15
Some entropy theory 22
The Gibbs inequality 28
A simple physical example (gases) 36
Shannon’s communication theory 47
Application to Biology (genomes) 63
Some other measures 79
Some additional material
Examples using Bayes’ Theorem 87
Analog channels 103
A Maximum Entropy Principle 108
Application: Economics I 111
Application: Economics II 117
Application to Physics (lasers) 124
Kullback-Leibler information measure 129
References 135
2
The quotes
} Science, wisdom, and counting
} Being different – or random
} Surprise, information, and miracles
} Information (and hope)
} H (or S) for Entropy
} Thermodynamics
} Language, and putting things together
} Tools
To topics ←
3
Science, wisdom, and
counting
“Science is organized knowledge. Wisdom is
organized life.”
- Immanuel Kant
- John Haldane
- Edward Gibbon
4
Measuring complexity ←
• Workers in the field of complexity face a
classic problem: how can we tell that the
system we are looking at is actually a
complex system? (i.e., should we even be
studying this system? :-)
5
• Various approaches to this task have been
proposed, among them:
7
Being different – or
random
“The man who follows the crowd will usually
get no further than the crowd. The man who
walks alone is likely to find himself in places
no one has ever been before. Creativity in
living is not without its attendant difficulties,
for peculiarity breeds contempt. And the
unfortunate thing about being ahead of your
time is that when people finally realize you
were right, they’ll say it was obvious all along.
You have two choices in life: You can dissolve
into the mainstream, or you can be distinct.
To be distinct is to be different. To be
different, you must strive to be what no one
else but you can be. ”
-Alan Ashley-Pitt
10
3. In some (possibly many) cases, we may
be able to find a reasonable
correspondence between these two
views of probability. In particular, we
may sometimes be able to understand
the observer relative version of the
probability of an event to be an
approximation to the frequentist
version, and to view new knowledge as
providing us a better estimate of the
relative frequencies.
11
• I won’t go through much, but some
probability basics, where a and b are
events:
P (not a) = 1 − P (a).
P (a or b) = P (a) + P (b) − P (a and b).
We will often denote P (a and b) by
P (a, b). If P (a, b) = 0, we say a and b are
mutually exclusive.
• Conditional probability:
12
• If two events a and b are such that
P (a|b) = P (a),
we say that the events a and b are
independent. Note that from Bayes’
Theorem, we will also have that
P (b|a) = P (b),
and furthermore,
P (a, b) = P (a|b)P (b) = P (a)P (b).
This last equation is often taken as the
definition of independence.
13
Surprise, information, and
miracles
“The opposite of a correct statement is a
false statement. The opposite of a profound
truth may well be another profound truth.”
- Bill Hirst
n/m n
I(p )= ∗ I(p)
m
4. And thus, by continuity, we get, for
0 < p ≤ 1, and a > 0 a real number:
I(pa) = a ∗ I(p)
17
• Summarizing: from the four properties,
1. I(p) ≥ 0
4. I(1) = 0
18
• Thus, using different bases for the
logarithm results in information measures
which are just constant multiples of each
other, corresponding with measurements
in different units:
19
• For example, flipping a fair coin once will
give us events h and t each with
probability 1/2, and thus a single flip of a
coin gives us − log2(1/2) = 1 bit of
information (whether it comes up h or t).
20
Information (and hope)
“In Cyberspace, the First Amendment is a
local ordinance.”
H. Poincare, 1908
21
Some entropy theory ←
• Suppose now that we have n symbols
{a1, a2, . . . , an}, and some source is
providing us with a stream of these
symbols. Suppose further that the source
emits the symbols with probabilities
{p1, p2, . . . , pn}, respectively. For now, we
also assume that the symbols are emitted
independently (successive symbols do not
depend in any way on past symbols).
22
• What we really want here is a weighted
average. If we observe the symbol ai, we
will get be getting log(1/pi) information
from that particular observation. In a long
run (say N ) of observations, we will see
(approximately) N ∗ pi occurrences of
symbol ai (in the frequentist sense, that’s
what it means to say that the probability
of seeing ai is pi). Thus, in the N
(independent) observations, we will get
total information I of
n
X
I= (N ∗ pi) ∗ log(1/pi).
i=1
But then, the average information we get
per symbol observed will be
n
X
I/N = (1/N ) (N ∗ pi) ∗ log(1/pi)
i=1
n
X
= pi ∗ log(1/pi)
i=1
24
• Another worthwhile way to think about
this is in terms of expected value. Given a
discrete probability distribution
P = {p1, p2, . . . , pn}, with pi ≥ 0 and
Pn
i=1 pi = 1, or a continuous R
distribution
P (x) with P (x) ≥ 0 and P (x)dx = 1, we
can define the expected value of an
associated discrete set F = {f1, f2, . . . , fn}
or function F (x) by:
n
X
< F >= fi pi
i=1
or
Z
< F (x) >= F (x)P (x)dx.
25
Several questions probably come to mind at
this point:
26
H (or S) for Entropy
“The enthalpy is [often] written U. V is the
volume, and Z is the partition function. P
and Q are the position and momentum of a
particle. R is the gas constant, and of course
T is temperature. W is the number of ways
of configuring our system (the number of
states), and we have to keep X and Y in case
we need more variables. Going back to the
first half of the alphabet, A, F, and G are all
different kinds of free energies (the last
named for Gibbs). B is a virial coefficient or a
magnetic field. I will be used as a symbol for
information; J and L are angular momenta. K
is Kelvin, which is the proper unit of T. M is
magnetization, and N is a number, possibly
Avogadro’s, and O is too easily confused with
0. This leaves S . . .” and H. In Spikes they
also eliminate H (e.g., as the Hamiltonian). I,
on the other hand, along with Shannon and
others, prefer to honor Hartley. Thus, H for
entropy . . .
27
The Gibbs inequality ←
• First, note that the function ln(x) has
derivative 1/x. From this, we find that
the tangent to ln(x) at x = 1 is the line
y = x − 1. Further, since ln(x) is concave
down, we have, for x > 0, that
ln(x) ≤ x − 1,
with equality only when x = 1.
28
• We can use the Gibbs inequality to find
the probability distribution which
maximizes the entropy function. Suppose
P = {p1, p2, . . . , pn} is a probability
distribution. We have
n
X
H(P ) − log(n) = pi log(1/pi) − log(n)
i=1
n
X n
X
= pi log(1/pi) − log(n) pi
i=1 i=1
n
X n
X
= pi log(1/pi) − pi log(n)
i=1 i=1
n
X
= pi(log(1/pi) − log(n))
i=1
n
X
= pi(log(1/pi) + log(1/n))
i=1
n !
X 1/n
= pi log
i=1 pi
≤ 0,
with equality only when pi = n1 for all i.
0 ≤ H(P ) ≤ log(n).
We have H(P ) = 0 when exactly one of
the pi’s is one and all the rest are zero.
We have H(P ) = log(n) only when all of
the events have the same probability n 1.
30
The maximum information the student
gets from a grade will be:
Pass/Fail : 1 bit.
A, B, C, D, F : 2.3 bits.
31
We ought to note several things.
32
• Second, it is important to recognize that
our definitions of information and entropy
depend only on the probability
distribution. In general, it won’t make
sense for us to talk about the information
or the entropy of a source without
specifying the probability distribution.
34
Thermodynamics
“A theory is the more impressive the greater
the simplicity of its premises is, the more
different kinds of things it relates, and the
more extended its area of applicability.
Therefore the deep impression which classical
thermodynamics made upon me. It is the only
physical theory of universal content which I
am convinced that, within the framework of
the applicability of its basic concepts, it will
never be overthrown (for the special attention
of those who are skeptics on principle).”
- A. Einstein, 1946
- P. W. Bridgman, 1941
35
A simple physical example
(gases) ←
• Let us work briefly with a simple model
for an idealized gas. Let us assume that
the gas is made up of N point particles,
and that at some time t0 all the particles
are contained within a (cubical) volume V .
Assume that through some mechanism,
we can determine the location of each
particle sufficiently well as to be able to
locate it within a box with sides 1/100 of
the sides of the containing volume V .
There are 106 of these small boxes within
V . (We’ll obviously assume N >> 106,
perhaps N ≈ 1024 . . . )
37
There are several ways to think about this
example.
40
Let us start here:
41
which is a (comparatively :-) large
number. The entropy of each of these
configurations is:
42
number of such configurations is:
106 106!
6
=
10 /2 (106/2)!(106 − 106/2)!
106!
=
((106/2)!)2
√ 6
10 −106 √
2π(106) e 106
≈ √ q
( 2π(106/2) e106 /2 −(106 /2) 106/2)2
√ 6 106 −106 √ 6
2π(10 ) e 10
= 6 6
2π(106/2)10 e−(10 )106/2
10 6 +1 √
2 106
= √ √
2π 106
10 6
≈ 2
5
= (210)10
3∗10 5
≈ 10 .
45
Language, and putting
things together
“An essential distinction between language
and experience is that language separates out
from the living matrix little bundles and
freezes them; in doing this it produces
something totally unlike experience, but
nevertheless useful.”
- P. W. Bridgman, 1936
- David Bohm
46
Shannon’s communication
theory ←
• In his classic 1948 papers, Claude
Shannon laid the foundations for
contemporary information, coding, and
communication theory. He developed a
general model for communication
systems, and a set of theoretical tools for
analyzing such systems.
47
• In Shannon’s discrete model, it is
assumed that the source provides a
stream of symbols selected from a finite
alphabet A = {a1, a2, . . . , an}, which are
then encoded. The code is sent through
the channel (and possibly disturbed by
noise). At the other end of the channel,
the receiver will decode, and derive
information from the sequence of
symbols.
48
• One important question we can ask is,
how efficiently can we encode information
that we wish to send through the
channel? For the moment, let’s assume
that the channel is noise-free, and that
the receiver can accurately recover the
channel symbols transmitted through the
channel. What we need, then, is an
efficient way to encode the stream of
source symbols for transmission through
the channel, and to be sure that the
encoded stream can be uniquely decoded
at the receiving end.
50
Note that Nk cannot be greater than rk
(the total number of strings of length k,
whether they encode anything or not).
From this we can see that
nl
rk
Kn ≤
X
k
= nl − n + 1 ≤ nl.
k=n
r
or
n ! n !
X 1 X 1
pi log ≤ pi log .
i=1 pi i=1 Qi
54
• Shannon went on to generalize to the
(more realistic) situation in which the
channel itself is noisy. In other words, not
only are we unsure about the data stream
we will be transmitting through the
channel, but the channel itself adds an
additional layer of uncertainty/probability
to our transmissions.
n
X
H(A) = P (ai) ∗ log(1/P (ai))
i=1
m
X
H(B) = P (bj ) ∗ log(1/P (bj ))
j=1
X X
H(A|B) = p(bj ) p(ai|bj ) log(1/p(ai|bj ))
j i
n X
X m
= P (ai, bj ) ∗ log(P (bj )/P (ai, bj ))
i=1 j=1
n X
X m
H(A, B) = P (ai, bj ) ∗ log(1/P (ai, bj ))
i=1 j=1
H(A, B) = H(A) + H(B|A)
= H(B) + H(A|B),
and furthermore:
I(A; B) = H(A) + H(B) − H(A, B)
= H(A) − H(A|B)
= H(B) − H(B|A)
≥ 0
58
• If we are given a channel, we could ask
what is the maximum possible information
that can be transmitted through the
channel. We could also ask what mix of
the symbols {ai} we should use to achieve
the maximum. In particular, using the
definitions above, we can define the
Channel Capacity C to be:
I(ai; B) = C,
and thus, we can maximize channel use by
maximizing the use for each symbol
independently.
59
• We also have Shannon’s main theorem:
60
• Unfortunately, Shannon’s proof has a a
couple of downsides. The first is that the
proof is non-constructive. It doesn’t tell
us how to construct the coding system to
optimize channel use, but only tells us
that such a code exists. The second is
that in order to use the capacity with a
low error rate, we may have to encode
very large blocks of data. This means
that if we are attempting to use the
channel in real-time, there may be time
lags while we are filling buffers. There is
thus still much work possible in the search
for efficient coding schemes.
61
Tools
“It is a recurring experience of scientific
progress that what was yesterday an object of
study, of interest in its own right, becomes
today something to be taken for granted,
something understood and reliable, something
known and familiar – a tool for further
research and discovery.”
- Richard Feynman
62
Application to Biology
(analyzing genomes) ←
• Let us apply some of these ideas to the
(general) problem of analyzing genomes.
64
• In this exploratory project, my goal has
been to apply the information and entropy
ideas outlined above to genome analysis.
Some of the results I have so far are
tantalizing. For a while, I’ll just walk you
through some preliminary work. While I
am not an expert in genomes/DNA, I am
hoping that some of what I am doing can
bring fresh eyes to the problems of
analyzing genome sequences, without too
many preconceptions. It is at least
conceivable that my naiveté will be an
advantage . . .
65
• My first step was to generate for myself a
“random genome” of comparable size to
compare things with. In this case, I simply
used the Unix ‘random’ function to
generate a file containing a random
sequence of about 4 million A, C, G, T.
In the actual genome, these letters stand
for the nucleotides adenine, cytosine,
guanine, and thymine.
66
• My next step was to start developing a
(variety of) probability model(s) for the
genome. The general idea that I am
working on is to build some automated
tools to locate “interesting” sections of a
genome. Thinking of DNA as a coding
system, we can hope that “important”
stretches of DNA will have entropy
different from other stretches. Of course,
as noted above, the entropy measure
depends in an essential way on the
probability model attributed to the
source. We will want to try to build a
model that catches important aspects of
what we find interesting or significant.
We will want to use our knowledge of the
systems in which DNA is embedded to
guide the development of our models. On
the other hand, we probably don’t want
to constrain the model too much.
Remember that information and entropy
are measures of unexpectedness. If we
constrain our model too much, we won’t
leave any room for the unexpected!
67
• We know, for example, that simple
repetitions have low entropy. But if the
code being used is redundant (sometimes
called degenerate), with multiple
encodings for the same symbol (as is the
case for DNA codons), what looks to one
observer to be a random stream may be
recognized by another observer (who
knows the code) to be a simple repetition.
Ala: Alanine
Arg: Arginine
Asn: Asparagine
Asp: Aspartic acid
Cys: Cysteine
Gln: Glutamine
Glu: Glutamic acid
Gly: Glycine
His: Histidine
Ile: Isoleucine
Leu: Leucine
Lys: Lysine
Met: Methionine
Phe: Phenylalanine
Pro: Proline
Ser: Serine
Thr: Threonine
Trp: Tryptophane
Tyr: Tyrosine
Val: Valine
70
• For our first model, we will consider each
three-nucleotide codon to be a distinct
symbol. We can then take a chunk of
genome and estimate the probability of
occurence of each codon by simply
counting and dividing by the length. At
this level, we are assuming we have no
knowledge of where codons start, and so
in this model, we assume that “readout”
could begin at any nucleotide. We thus
use each three adjacent nucleotides.
For example, given the DNA chunk:
AGCTTTTCATTCTGACTGCAACGGGCAATATGTC
we would count:
71
• We can then estimate the entropy of the
chunk as:
X
pi ∗ log2(1/pi) = 4.7 bits.
The maximum possible entropy for this
chunk would be:
72
Entropy of E. coli and random
window 6561, slide-step 81
73
• At this level, we can make the simple
observation that the actual genome
values are quite different from the
comparative random string. The values
for E. coli range from about 5.8 to about
5.96, while the random values are
clustered quite closely above 5.99 (the
maximum possible is log2(64) = 6).
74
• We could change the window size, and/or
step size. We could work to develop
adaptive algorithms which zoom in on
interesting regions, where “interesting” is
determined by criteria such as the ones
listed above.
79
• Expanding on these generalized entropies,
we can then define a generalized
dimension associated with a data set. If
we imagine the data set to be distributed
among bins of diameter r, we can let pi
be the probability that a data item falls in
the i’th bin (estimated by counting the
data elements in the bin, and dividing by
the total number of items). We can then,
for each q, define a dimension:
P q
1 log i pi
Dq = lim .
r→0 q − 1 log(r)
Three examples:
log(2k )
D0 = lim k
= 1.
k→∞ log(2 )
81
3. Consider the Cantor set:
log(2k ) log(2)
D0 = lim = ≈ 0.631.
k→∞ log(3k ) log(3)
The Cantor set is a traditional example
of a fractal. It is self similar, and has
D0 ≈ 0.631, which is strictly greater
than its topological dimension (= 0).
82
It is an important example since many
nonlinear dynamical systems have
trajectories which are locally the
product of a Cantor set with a
manifold (i.e., Poincaré sections are
generalized Cantor sets).
An interesting example of this
phenomenon occurs with the logistics
equation:
xi+1 = k ∗ xi ∗ (1 − xi)
with k > 4. In this case (of which you
rarely see pictures . . . ), most starting
points run off rapidly to −∞, but there
is a strange repellor(!) which is a
Cantor set. It is a repellor since
arbitrarily close to any point on the
trajectory are points which run off to
−∞. One thing this means is that any
finite precision simulation will not
capture the repellor . . .
83
• We can make several observations about
Dq :
85
←
86
Examples using Bayes’
Theorem ←
• A quick example:
Suppose that you are asked by a friend to
help them understand the results of a
genetic screening test they have taken.
They have been told that they have
tested positive, and that the test is 99%
accurate. What is the probability that
they actually have the anomaly?
88
We would like to calculate for our friend
the probability they actually have the
anomaly (Ha), given that they have
tested positive (Tp):
P (Ha|T p).
We can do this using Bayes’ Theorem.
We can calculate:
P (T p|Ha) ∗ P (Ha)
P (Ha|T p) = .
P (T p)
89
Suppose the screening test was done on
10,000,000 people. Out of these 107
people, we expect there to be
107/105 = 100 people with the anomaly,
and 9,999,900 people without the
anomaly. According to the lab, we would
expect the test results to be:
= 10−5
99 + 99, 999
P (T p) =
107
100, 098
=
107
= 0.0100098
P (T p|Ha) = 0.99
91
Thus, our calculated probability that our
friend actually has the anomaly is:
P (T p|Ha) ∗ P (Ha)
P (Ha|T p) =
P (T p)
0.99 ∗ 10−5
=
0.0100098
9.9 ∗ 10−6
=
1.00098 ∗ 10−2
= 9.890307 ∗ 10−4
< 10−3
92
• There are a variety of questions we could
ask now, such as, “For this anomaly, how
accurate would the test have to be for
there to be a greater than 50%
probability that someone who tests
positive actually has the anomaly?”
93
• Another question we could ask is, “How
prevalent would an anomaly have to be in
order for a 99% accurate test (1% false
positive and 1% false negative) to give a
greater than 50% probability of actually
having the anomaly when testing
positive?”
94
• Note that the current population of the
US is about 280,000,000 and the current
population of the world is about
6,200,000,000. Thus, we could expect an
anomaly that affects 1 person in 100,000
to affect about 2,800 people in the US,
and about 62,000 people worldwide, and
one affecting one person in 100 would
affect 2,800,000 people in the US, and
62,000,000 people worldwide . . .
95
We can do the same sort of calculations.
0.80 ∗ 10 = 8 people.
0.20 ∗ 10 = 2 people.
96
Now let’s put the the pieces together:
1
P (Ha) =
100
= 10−2
8 + 198
P (T p) =
103
206
=
103
= 0.206
P (T p|Ha) = 0.80
97
Thus, our calculated probability that our
friend actually has the anomaly is:
P (T p|Ha) ∗ P (Ha)
P (Ha|T p) =
P (T p)
0.80 ∗ 10−2
=
0.206
8 ∗ 10−3
=
2.06 ∗ 10−1
= 3.883495 ∗ 10−2
< .04
98
• We could ask the same kinds of questions
we asked before:
99
• Some questions:
102
Analog channels ←
• The part of Shannon’s work we have
looked at so far deals with discrete (or
digital) signaling systems. There are
related ideas for continuous (or analog)
systems. What follows gives a brief hint
of some of the ideas, without much detail.
103
We can associate with each signal an
energy, given by:
1 2W
XT
E= x2
i.
2W i=1
The distance of the signal (from the
origin) will be
X 1/2
r= 2
xi = (2W E)1/2
We can define the signal power to be the
average energy:
E
S= .
T
Then the radius of the sphere of
transmitted signals will be:
r = (2W ST )1/2.
Each signal will be disturbed by the noise
in the channel. If we measure the power
of the noise N added by the channel, the
disturbed signal will lie in a sphere around
the original signal of radius (2W N T )1/2.
104
Thus the original sphere must be enlarged
to a larger radius to enclose the disturbed
signals. The new radius will be:
r = (2W T (S + N ))1/2 .
In order to use the channel effectively and
minimize error (misreading of signals), we
will want to put the signals in the sphere,
and separate them as much as possible
(and have the distance between the
signals at least twice what the noise
contributes . . . ). We thus want to divide
the sphere up into sub-spheres of radius
= (2W N T )1/2. From this, we can get an
upper bound on the number M of possible
messages that we can reliably distinguish.
We can use the formula for the volume of
an n-dimensional sphere:
π n/2rn
V (r, n) = .
Γ(n/2 + 1)
105
We have the bound:
π W T (2W T (S + N ))W T Γ(W T + 1)
M ≤
Γ(W T + 1) π W T (2W T N )W T
S WT
= 1+
N
The information sent is the log of the
number of messages sent (assuming they
are equally likely), and hence:
S
I = log(M ) = W T ∗ log 1 + ,
N
and the rate at which information is sent
will be:
S
W ∗ log 1 + .
N
We thus have the usual signal/noise
formula for channel capacity . . .
106
• An amusing little side light: “Random”
band-limited natural phenoma typically
display a power spectrum that obeys a
power law of the general form f1α . On the
other hand, from what we have seen, if
we want to use a channel optimally, we
should have essentially equal power at all
frequencies in the band. This means that
a possible way to engage in SETI (the
search for extra-terrestrial intelligence)
will be to look for bands in which there is
white noise! White noise is likely to be
the signature of (intelligent) optimal use
of a channel . . .
107
A Maximum Entropy
Principle ←
• Suppose we have a system for which we
can measure certain macroscopic
characteristics. Suppose further that the
system is made up of many microscopic
elements, and that the system is free to
vary among various states. Given the
discussion above, let us assume that with
probability essentially equal to 1, the
system will be observed in states with
maximum entropy.
108
• Suppose we have a set of macroscopic
measurable characteristics fk ,
k = 1, 2, . . . , M (which we can think of as
constraints on the system), which we
assume are related to microscopic
characteristics via:
X (k)
p i ∗ fi = fk .
i
Of course, we also have the constraints:
pi ≥ 0, and
X
pi = 1.
i
We want to maximize the entropy,
P
i pi log(1/pi ), subject to these
constraints. Using Lagrange multipliers λk
(one for each constraint), we have the
general solution:
X (k)
pi = exp −λ − λ k fi .
k
109
If we define Z, called the partition
function, by
X X (k)
Z(λ1, . . . , λM ) = exp − λk fi ,
i k
110
Application: Economics I (a
Boltzmann Economy) ←
• Our first example here is a very simple
economy. Suppose there is a fixed
amount of money (M dollars), and a fixed
number of agents (N ) in the economy.
Suppose that during each time step, each
agent randomly selects another agent and
transfers one dollar to the selected agent.
An agent having no money doesn’t go in
debt. What will the long term (stable)
distribution of money be?
says
X M
pi ∗ i =
i N
and
X
pi = 1.
i
112
• We now apply Lagrange multipliers:
X X M
L= pi ln(1/pi) − λ1 pi ∗ i −
i i N
X
− λ2 pi − 1 ,
i
from which we get
∂L
= −[1 + ln(pi)] − λ1 ∗ i − λ2 = 0.
∂pi
113
• Putting in constraints, we have
X
1 = pi
i
e−λe−λ1∗i
X
=
i
M
= e−λ e−λ1∗i,
X
i=0
and
M X
= pi ∗ i
N i
e−λe−λ1∗i ∗ i
X
=
i
M
= e−λ e−λ1∗i ∗ i.
X
i=0
We can approximate (for large M )
M Z M
1
e−λ1∗i ≈ e−λ1∗xdx ≈
X
,
i=0 0 λ1
and
M Z M
1
e−λ1∗i ∗ i ≈ xe−λ1∗xdx ≈
X
.
i=0 0 λ12
114
From these we have
λ 1
e ≈
1
λ1
and
λ M 1
e 1 ≈ .
N λ12
From this, we get
N
λ1 ≈ ≈ e−λ1 ,
M
and thus (letting T = M
N ) we have:
pi = e−λ1 e−λ1∗i
1 −i
= e T.
T
This is a Boltzmann-Gibbs distribution,
where we can think of T (the average
amount of money per agent) as the
“temperature,” and thus we have a
“Boltzmann economy” . . .
http://arxiv.org/abs/cond-mat/0001432
and
http://arxiv.org/abs/cond-mat/0004256
116
Application: Economics II (a
power law) ←
• Suppose that a (simple) economy is made
up of many agents a, each with wealth at
time t in the amount of w(a, t). (I’ll leave
it to you to come up with a reasonable
definition of “wealth” – of course we will
want to make sure that the definition of
“wealth” is applied consistently across all
the agents.) We can also look at the total
P
wealth in the economy W (t) = a w(a, t).
117
• In order to apply the maximum entropy
principle, we want to look at global
(aggregate/macro) observables of the
system that reflect (or are made up of)
characteristics of (micro) elements of the
system.
118
• We now apply Lagrange multipliers:
X X
L= pi ln(1/pi) − λ1 pi ln(Ri) − ln(R)
i i
X
− λ 2 pi − 1 ,
i
from which we get
∂L
= −[1 + ln(pi)] − λ1 ln(Ri) − λ2 = 0.
∂pi
120
When we are solving an extremal problem
of the form
Z
F [x, f (x), f 0(x)]dx,
we work to solve
!
∂F d ∂F
− = 0.
∂f (x) dx ∂f 0(x)
122
By L’Hôpital’s rule, the first term goes to
zero as R → ∞, so we are left with
#∞
1−λ
"
R 1 1
C ∗ ln(R) = = ,
1 − λ1 1 λ1 − 1
or, in other terms,
λ1 − 1 = C ∗ ln(R−1).
http://astarte.csustan.edu/˜ tom/SFI-
CSSS/Wealth/wealth-Milakovic.pdf
123
Application to Physics
(lasers) ←
• We can also apply this maximum entropy
principle to physics examples. Here is how
it looks applied to a single mode laser.
For a laser, we will be interested in the
intensity of the light emitted, and the
coherence property of the light will be
observed in the second moment of the
intensity. The electric field strength of
such a laser will have the form
124
proportional to BB ∗ and to the loss rate,
2κ, of the laser:
I = 2κBB ∗.
The intensity squared will be
I 2 = 4κ2B 2B ∗2.
125
• If we assume that B and B ∗ are
continuous random variables associated
with a stationary process, then the
information entropy of the system will be:
!
1
Z
H= p(B, B ∗) log d 2 B.
p(B, B ∗)
The two constraints on the system will be
the averages of the intensity and the
square of the intensity:
126
• Applying the general solution, we get:
∗ ∗ ∗
h i
2 2
p(B, B ) = exp −λ − λ12κBB − λ24κ (BB ) ,
or, in other notation:
q̇ = K(q) + F(t)
where q is a state vector, and the
fluctuating forces Fj (t) are typically
assumed to have
127
• The associated generic Fokker-Planck
equation for the distribution function
f (q, t) then looks like:
∂f X ∂ 1X ∂2
=− (Kj f ) + Qjk f.
∂t j ∂qj 2 jk ∂qj ∂qk
The first term is called the drift term, and
the second the diffusion term. This can
typically be solved only for special cases
...
128
Kullback-Leibler information
measure ←
• Suppose we have a data set, and we
would like to build a (statistical) model
for the data set. How can we tell how
good a job our model does in representing
the statistical properties of the data set?
One approach is to use ideas from
Information Theory (and in particular the
framework of the Gibbs inequality).
129
• One approach is to use the so-called
Kullback-Leibler information measure:
* !+
p(x)
KL(P ; Q) = log
q(x) P
Z ∞ !
p(x)
= log p(x)d(x)
−∞ q(x)
(in other words, the P -expected value of
the difference of the logs). The KL
measure has the nice properties that
0 <= KL(P ; Q) !
X p(x)
= p(x) log
x q(x)
! !
X 1 X 1
= p(x) log − p(x) log
x q(x) x p(x)
= H(P ; Q) − H(P )
(where H(P ; Q) is what is sometimes
called the “cross entropy” between P and
Q). In other words, the entropy of the
“true” distribution P (H(P )) is a lower
bound for the cross entropy. As we saw
131
elsewhere, H(P ) is a lower bound on
efficiency of encoding (a description of)
the data set. The Kullback-Leibler
measure can be thought of as the
(added) inefficiency of encoding the data
with respect to the distribution Q, rather
than the “true” distribution P .
132
Thus, we can minimize the KL measure
by maximizing
X
p(x) log(q(x)) = hlog(q(x))iP
x
which is often called the expected
log-likelihood.
134
←
References
[1] Bar-Yam, Yaneer, Dynamics of Complex Systems
(Studies in Nonlinearity) , Westview Press,
Boulder, 1997.
135
[8] Feynman, Richard, Feynman lectures on
computation, Addison-Wesley, Reading, 1996.
137
[26] von Neumann, John, Probabilistic logic and the
synthesis of reliable organisms from unreliable
components, in automata studies(
Shanon,McCarthy eds), 1956 .
To top ←
139