6/27/2022
School of Arts and Sciences
Department of Biological and Chemical Sciences
p.9
BIOL 365 – Genetics
General background
1
6/27/2022
Composition and structure of DNA
DNA is a polymer: large molecule that consist of many similar
smaller molecules, called monomers, linked together
Monomer
= Nucleotide
Polymer
= DNA
Composition and structure of DNA
What is a DNA Nucleotide ?
Nucleoside
PO42-
Pentose – 5C H
Nucleotide = Nucleoside phosphate
4
2
6/27/2022
Composition and structure of DNA
Composition and structure of DNA
What are the Nitrogenous bases ?
• Six-membered
• Single range structures
• Nine-membered
• Double range structures
3
6/27/2022
Composition and structure of DNA
Names of Base, Nucleoside and Nucleotide
4
6/27/2022
Composition and structure of DNA
What are the types of bonds ?
Monophosphate *
Covalently linked by
N-glycosidic bond
Covalently linked by at N9: purine base
Phosphodiester bond at N1: pyrimidine base
(5’-3’ bond)
Composition and structure of DNA
• The phosphodiester bonds are relatively strong, so the repeated
sugar-phosphate-sugar-phosphate backbone of DNA is stable
structure
• Polynucleotide chains have polarity, meaning that the 2 ends are
different: there is a 5’ carbon (with a phosphate group on it) at one
end, and a 3’ carbon (with a hydroxyl group on it) at the other end
• The end of a polynucleotide are referred to as the 5’ end and the 3’
end
10
5
6/27/2022
Composition and structure of DNA
One strand of Polynucleotide DNA chain Double strand of Polynucleotide DNA chain
“Complementary base pairs”
Hydrogen Bond *
5’ end
Phosphate group
3’ end
Hydroxyl group
11
Composition and structure of DNA
• A-T and G-C are called complementary base pairs
• A bonded with T => 2 hydrogen bonds
• G bonded with C => 3 hydrogen bonds
• Hydrogen bonds are relatively weak chemical bonds
• This makes easy to separate the 2 strands of DNA, for ex. by heating
12
6
6/27/2022
Composition and structure of DNA
13
Composition and structure of DNA
DNA: Double helix anti-parallel
5’ end
3’ end
3’ end 5’ end
14
7
6/27/2022
Features of the DNA
X-ray crystallography
Watson and Crick’s have developed the
double helix model of DNA based on the
X-ray crystallography data
15
Features of the DNA
Double helix model
• DNA molecule is 2 polynucleotide chains wound
around each other in a right-handed double helix
• The 2 chains are anti-parallel with opposite polarity
• The sugar-phosphate backbones are on the outside
of the double helix, with the bases oriented toward
the central axis
• The bases are flat structures oriented
perpendicularly to the long axis of the DNA
• The complementary base pairs are bounded
together by Hydrogen bonds
• The base pairs are 0.34 nm apart in the DNA helix
• A complete (360°) turn of the helix takes 3.4 nm
• The external diameter of the helix is 2 nm
• The results of the unequal space between the
backbones: Major groove and Minor groove
16
8
6/27/2022
Features of the DNA
Double helix model
• DNA molecule is 2 polynucleotide chains wound
around each other in a right-handed double helix
• 2 chains are anti-parallel with opposite polarity
• The sugar-phosphate backbones are on the
outside of the double helix, with the bases oriented
toward the central axis
• The bases are flat structures oriented
perpendicularly to the long axis of the DNA
• The complementary base pairs are bounded
together by Hydrogen bonds
• The base pairs are 0.34 nm apart in the DNA helix
• A complete (360°) turn of the helix takes 3.4 nm
• The external diameter of the helix is 2 nm
• The results of the unequal space between the
backbones: Major groove and Minor groove
17
Features of the DNA 3’
5’
Double helix model
• DNA molecule is 2 polynucleotide chains wound
around each other in a right-handed double helix
• The 2 chains are anti-parallel with opposite polarity
• The sugar-phosphate backbones are on the outside
of the double helix, with the bases oriented toward
the central axis
• The bases are flat structures oriented
perpendicularly to the long axis of the DNA
• The complementary base pairs are bounded
together by Hydrogen bonds *
• The base pairs are 0.34 nm apart in the DNA helix
• A complete (360°) turn of the helix takes 3.4 nm
• The external diameter of the helix is 2 nm
3’ 5’
• The results of the unequal space between the
backbones: Major groove and Minor groove
If one chain has the sequence
5’-TATTCCGA-3’ then the opposite,
antiparallel chain must bear the sequence
3’-ATAAGGCT-5’. 18
9
6/27/2022
Features of the DNA
Double helix model
• DNA molecule is 2 polynucleotide chains wound
around each other in a right-handed double helix
• The 2 chains are anti-parallel with opposite polarity
• The sugar-phosphate backbones are on the outside
of the double helix, with the bases oriented toward
the central axis
• The bases are flat structures oriented
perpendicularly to the long axis of the DNA
• The complementary base pairs are bounded
together by Hydrogen bonds
• The base pairs are 0.34 nm apart in the DNA helix
• A complete (360°) turn of the helix takes 3.4 nm *
• The external diameter of the helix is 2 nm
• The results of the unequal space between the
backbones: Major groove and Minor groove
19
Features of the DNA
Double helix model
• DNA molecule is 2 polynucleotide chains wound
around each other in a right-handed double helix
• The 2 chains are anti-parallel with opposite polarity
• The sugar-phosphate backbones are on the outside
of the double helix, with the bases oriented toward
the central axis
• The bases are flat structures oriented
perpendicularly to the long axis of the DNA
• The complementary base pairs are bounded
together by Hydrogen bonds
• The base pairs are 0.34 nm apart in the DNA helix
• A complete (360°) turn of the helix takes 3.4 nm
• The external diameter of the helix is 2 nm
• The results of the unequal space between the
backbones: Major groove and Minor groove *
20
10
6/27/2022
Different DNA structures
Three major types of DNA determined by analyzing DNA fibers and
crystals in vitro (X-ray crystallography analysis) : “ B, A and Z ”
B-DNA A-DNA
- Right-handed - Right-handed
- It forms under conditions - It is seen in condition of
of high humidity low humidity
- It is the structure that - It is present in DNA-
most closely corresponds protein complexes
to that of DNA in the cell
B-DNA is thinner and longer than A-DNA for the same number of base pairs
21
Different DNA structures
Z-DNA
- It is a left-handed helical structure
- It has a zigzag arrangement of the sugar-
phosphate backbone (it is formed by alternating
purines and pyrimidines, like GCGCGC)
- A small amount of the DNA in a cell exists in
the Z form
- This different structure is involved in some way
in regulation of some cellular function, but
conclusive evidence for or against this proposal
is not available yet.
Z-DNA is thin and elongated
22
11
6/27/2022
Different DNA structures
B-DNA : wide major groove / narrow minor groove (same depth)
A-DNA : narrow and very deep major groove / wide and shallow minor groove
Z-DNA : deep minor groove and not distinct major groove
23
DNA in the Cell
DNA in the cell is in solution, which is a different state from the DNA
used in X-ray crystallography experiments.
DNA in solution has 10.5 base pairs per turn, which is a little less twisted
than B-DNA.
Structure-wise, DNA in the cell most closely resembles B-DNA, and
most of the genome is in that form.
In certain DNA–protein complexes, though, the DNA assumes the A-
DNA structure.
Whether Z-DNA exists in cells has long been a topic of debate among
scientists. In those organisms where there is some evidence for Z-DNA,
its physiological significance is unknown.
24
12
6/27/2022
DNA versus RNA
DNA
RNA
25
DNA versus RNA
DNA and RNA: types of nucleic acid, polymers of nucleotides, same configuration
Both are found in all living things, DNA in nucleus and RNA in cytoplasm
26
13
6/27/2022
DNA versus RNA
27
RNA in the cell RNA:
Single-stranded molecules
RNA can fold up on itself (in a
secondary structure) to produce
region of anti-parallel double-stranded
mRNA RNA separated by segments of
unpaired RNA (this is the genome of
tRNA certain viruses) *
ncRNA
RNA rRNA Hydrogen Loop
bonding
siRNA
miRNA
28
14
6/27/2022
29
The Organization of DNA in Chromosomes
Chromatin fiber
(30 nm)
Fiber loops (200 nm)
30
15
6/27/2022
The Organization of DNA in Chromosomes
The Structure of Chromatin:
Chromatin is the stainable material in a cell nucleus: DNA and proteins.
Histones and nonhistones are two major types of proteins associated with DNA in
chromatin.
Both types of proteins play an important role in determining the physical structure of
the chromosome.
I- The histones are the most II- Nonhistones are all the proteins
abundant proteins in chromatin. associated with DNA, apart from the
They are small basic proteins histones.
with a net positive charge that Nonhistones are far less abundant than
facilitates their binding to the histones.
negatively charged DNA. Many nonhistones are acidic proteins—
Five main types of histones are proteins with a net negative charge.
associated with eukaryotic
Nonhistones include proteins that play a
nuclear DNA: H1, H2A, H2B,
role in the processes of DNA
H3, and H4. replication, DNA repair, transcription
Histones play a crucial role in (including gene regulation), and
chromatin packing recombination.
The structure of Chromatin
• Non-histones proteins are less abundant than histones.
• Many non-histones are acidic proteins (negative charge).
• They include proteins that play a role in the processes of :
DNA replication
DNA repair
Transcription (including gene regulation)
Recombination
• In contrast to the histones, the non-histone proteins differ in number and
type from cell type to cell type within an organism, at different times in
the same cell type, and from organism to organism.
32
16
6/27/2022
The structure of Chromatin
• The amino acid sequences of histones H2A, H2B, H3, and H4 are highly
conserved (even between distantly related species).
• Evolutionary conservation = strong indicator that histones perform the
same basic role in organizing the DNA in the chromosomes of all
eukaryotes.
• Histones play a crucial role in chromatin packing.
• Several levels of packing enable chromosomes that would be several
millimeters or even centimeters long to fit into a nucleus that is a few
micrometers in diameter.
33
The structure of Chromatin
• With the electron microscope, different chromatin structures are seen.
• The least compact form seen is the 10-nm chromatin fiber, which has a
characteristic “beads-on-a-string” morphology; the beads have a diameter
of about 10 nm.
• The beads are nucleosomes, the basic structural units of eukaryotic 34
chromatin.
17
6/27/2022
The structure of Chromatin
• A nucleosome is about 11 nm in diameter and consists of a core of 8
histone proteins (two each of H2A, H2B, H3, and H4).
• Around the nucleosome, a 147-bp segment of DNA is wound about
1.65 times.
• This configuration serves to compact the DNA by a factor of about 6.
35
The structure of Chromatin
• Individual nucleosomes are connected by
strands of linker DNA (variable length).
• The next level of chromatin condensation is
done by histone HI.
• The binding of HI causes the nucleosomal
DNA to assume a more regular appearance
with a zigzag arrangement.
• The nucleosomes themselves then compact
into a structure about 30 nm in diameter,
called the 30-nm chromatin fiber.
36
18
6/27/2022
The structure of Chromatin
• One possible model for the 30-nm fiber :
the solenoid model.
• It is an irregular zigzag of nucleosomes.
• Chromatin packing beyond the 30-nm
chromatin filaments is less well
understood : loops of DNA attached to a
protein “scaffold” with the characteristic
X shape of the paired sister chromatids.
• Scaffold-associated regions = SARs =
bind to the non-histone proteins to
determine the loops (spiral fashion).
37
The structure of Chromatin
Chromatin fiber
(30 nm)
Fiber loops (200 nm)
38
19
6/27/2022
Organization of Genetic material
p arm
q arm
39
Euchromatin and Heterochromatin
• The degree of DNA packing changes throughout the cell cycle.
The most dispersed state = during duplication = beginning of S
phase
The most highly condensed = within mitosis and meiosis.
• Two forms of chromatin are defined, each on the basis of
chromosome-staining properties.
Euchromatin and Heterochromatin
40
20
6/27/2022
Euchromatin and Heterochromatin
• Euchromatin is the chromosomes or regions that show the normal
cycle of chromosome condensation and decondensation in the cell
cycle.
• Most of the genome of an active cell is in the form of euchromatin.
Euchromatic DNA is actively transcribed, meaning that the
genes within it can be expressed.
Euchromatin is devoid of repetitive sequences.
41
Euchromatin and Heterochromatin
• Heterochromatin = chromosomal regions that usually remain
condensed, more darkly staining than euchromatin—throughout
the cell cycle, even in interphase
• Genes within heterochromatic DNA are usually transcriptionally
inactive.
42
21
6/27/2022
Euchromatin and Heterochromatin
• There are 2 types of heterochromatin :
(1) Constitutive heterochromatin = present in all cells at identical
positions = consists mostly of repetitive DNA (centromeres and
telomeres).
(2) Facultative heterochromatin = varies in state in different cell types
and at different developmental stage (The Barr body , an inactivated X
chromosome).
Chromosome material that can be either heterochromatin or
euchromatin.
43
Dosage Compensation
(Xist gene)
Male Female
X Y X X
1 Dose (X) 2 Doses (2X)
XX
XX XX
All generations All generations
22
6/27/2022
Telomere and Centromere
• A telomere, a specific set of sequences at the end of a linear
chromosome, stabilizes the chromosome and is required for
replication.
• A centromere is the region of a chromosome containing DNA
sequences to which mitotic and meiotic spindle fibers attach. It is
responsible for the accurate segregation of replicated chromosomes
to the daughter cells during mitosis and meiosis.
45
Organization of Genetic material
p arm
q arm
46
23
6/27/2022
Classes of DNA sequence
In the genome, we find:
Unique-sequences DNA * Moderately repetitive DNA Highly repetitive DNA
They are present in They appear from few They appear from 105
one to just a few to about 105 copies to about 107 copies
copies in the genome
Repetitive-sequences DNA
They are most of the
genes we know Dispersed (or
about (the proteins- Tandemly repeated
coding genes) interspersed) repeated
DNA: clustered together
DNA: distributed at
and repeated in a row
irregular intervals
They are estimated
to make up
approximately 55-
60% of the genome
47
Classes of DNA sequence
GAAAATAGGGTATCATGCGCGAAAGTAACATTGACAGACAGGGTATCC
Dispersed repeated DNA:
- DNA sequence from 2 nucleotides
- DNA sequence from 7 nucleotides
GAAAATGCAAATGCAAATGCGACAGTACAATTGACAGACAGGGCATCC
Tandemly repeated DNA:
- DNA sequence from 6 nucleotides
48
24
6/27/2022
Classes of DNA sequence
In the genome, we find:
Unique-sequences DNA * Moderately repetitive DNA Highly repetitive DNA
They are present in They appear from few They appear from 105
one to just a few to about 105 copies to about 107 copies
copies in the genome
Repetitive-sequences DNA
They are most of the
genes we know Dispersed (or
about (the proteins- Tandemly repeated
coding genes) interspersed) repeated
DNA: clustered together
DNA: distributed at
and repeated in a row
irregular intervals
They are estimated
to make up LINE SINE
approximately 55- - Length vary
(1000-7000 (100-400 bp
60% of the genome - Gene or not *
bp long) long)
49
Classes of DNA sequence
• In prokaryotes, all of the genome is present as unique-sequence DNA
(with the exception of the rRNA, tRNA and a few other sequences). In
contrast, eukaryotic genomes consist of both unique-sequence and
repetitive-sequence DNA
• We have sketchy information about the distribution the various classes of
repetitive sequences in the genome.
• All eukaryotic organisms have LINE and SINE, with a wide variation in
their relative proportions
• Tandemly repeated DNA is common in eukaryotic genomes, but with
different sequences, number of copies and number of types
50
25
