Science Study Notes

Sustainable Earth-
Food Webs-

Respiration= Glucose + Oxygen  Carbon Dioxide + Water + Energy

C6H12O6 + 602  6CO2 + 6H2O + ATP
Photosynthesis= Carbon dioxide + Water  Glucose + Oxygen
6CO2 + 6H20  C6H12O6 + 602

Autotrophs= producers
Chemotrophs= do not live in sunlight, get energy from chemicals such as salt
Heterotrophs= consumers

Sustainability-

Sustainability- renewable, keeping something in a certain condition, using less non-

renewable resources, balance of actions/ resources, ability to sustain something, reliable,
maintaining resources, enabling future generations to use/ appreciate resources.

Sustainable Resource- is a resource that can be renewed, or replenished faster than can be
used or consumed.

Earth Hour-
- Is a global process
- For one hour of the year all electricity is meant to be turned off
- The hour is used to raise awareness about climate change and how it is a major
issue.
- The 2017 Earth Hour is on the 25th of March
- It involves turning off electricity to marches and personal/community projects

Definitions-

Earth- The planet we live on, the world.

Ecosystem- A biological community off interacting organisms and their physical
environment.
Community- A group of people living in the same place or having a particular characteristic
in common.
Population- All the inhabitants of a particular place.
Species- A group of living organisms consisting of similar individuals capable of exchanging
genes or interbreeding. The species is the principal natural taxonomic unit, ranking below a
genus and denotes by a Latin binomial e.g. homo sapiens.
Organism- An individual animal, plant or single-celled life form.
 System- A set of things working together as parts of a mechanism or an interconnecting
network, a complex whole.
Organ- A part of an organism which is typically self- contained and has a specific vital
function.
Tissue- Any of the distinct types of material of which animals or plants are made, consisting
of specialised cells and their products
Cell- the smallest structural and functional unit of an organism, which is typically
microscopic and consists of cytoplasm and a nucleus enclosed in a membrane.
Organelle- Any number of organised or specialised structures within a living cell.
Molecule- A groups of atoms bonded together, representing the smallest fundamental
unit of a chemical compound that can take part in a chemical reaction.
Atom- The smallest particle of a chemical element that can exist.
Interdependent- Of two or more people or things dependent on each other.

Predator/Prey Relationships-

 A predator is an organism that eats another organism. The prey is the organism
which the predator eats. Some examples of predator and prey are lion and zebra,
bear and fish, and fox and rabbit.

Symbiotic-
Interactions between two species that either one or both species benefit from it.

Commensalism-
One organism benefiting from the other and the other not effected. An example is the
remora fish swimming with the shark and eating scraps and the shark is not effected.

Mutualism-
Two organisms benefiting from their relationship. An example is cleaner fish and larger fish,
the larger fish gets cleaned and the cleaner fish gets fed.

Parasitism-
One organism benefits from the other, it is harmful to the prey. A tick and a dog is an
example, the tick is the predator and the dog is the prey.

Factors That Affect Population Size-

 Predators  Natural disasters

 Deforestation  Invasive species
 Pollution  Changes to the food web
 Climate change
 Urbanisation  Tourism
 Agriculture  Births
 Habitat loss  Deaths
  Disease  Overpopulation- Leads to
 Migration competition for everything
 If the animal is nocturnal or diurnal

Estimating Population Size-

- Camera traps  Active,

More distances
Nocturnal animals

- Quadrants  Plants
Slow Moving
Rock platforms (starfish, oysters)

- Satellite tracking Marine species

Large distances

- Capture/ recapture (tag/ release)  Easy to capture

Don’t move large distances

- Transect  Slow moving animals

Count along a line

Biodiversity-

Definition: the variety of plant and animal life in the world or in a particular habitat, a high
level of which is usually considered to be important and desirable.

Top five reasons for biodiversity loss in Australia-

1. Agriculture  decrease in natural habitat
2. Introduced species
3. Climate change/ pollution
4. Natural disasters
5. Urbanisation/ humans

Photosynthesis-

Equation- 6CO2 + 6H2O  C6H12O6 + 6O2

6 carbon + 6 water glucose + 6 oxygen
- Leaves take in carbon dioxide (stomata) water comes from the roots (root hairs absorb
water), oxygen leaves through the leaves (stomata). Photosynthesis occurs in the
chloroplast in the leaves. They have chlorophyll, has a green pigment that makes the plants
green. It captures sunlight.
- Glucose is formed by planets absorbing CO2 in their leaves and H2O in their roots, which
travel to their leaves, light from the sun is absorbed by chlorophyll which results in glucose
and oxygen being formed in the chloroplast providing energy for the plants therefore
providing energy for the food web. Six carbon atoms, twelve hydrogen atoms and six oxygen
atoms combine to create glucose. (bonds break and reform)

- The carbon atoms in the carbon dioxide transform into the glucose as the six atoms go into
the six carbon atoms in glucose. The energy comes from sunlight that is absorbed through
the stomata. The transformation of light energy to chemical energy is very efficient as
nothing is lost and there is only one waste product.

- Plants get their energy though sunlight that is absorbing by the chlorophyll in the
chloroplast in the leaves of the plants which is used to transform into chemical energy that
is required or growth and reproduction. Green plants are green because they contain a
pigment called chlorophyll. Chlorophyll absorbs certain wavelengths of light within the
visible light spectrum. As shown in detail in the absorption spectra, chlorophyll absorbs light
in the red (long wavelength) and the blue (short wavelength) regions of the visible light
spectrum. Green light is not absorbed but reflected, making the plant appear green.

Question: Assess

- Making a judgement
- Does not need to be all of the criteria

Criteria: Value
Quality
Outcomes
Results
Size

Responding to Environmental Changes-

Q1) Describe how this multi-cellular organism responds to changes in its environment.

Q2) Describe how the coordinated function of its internal systems provides its cells with the
requirements for life, including gases, nutrients and water, and removes cell wastes.

A1) One way multicellular organisms respond to changes in the environment is by

behavioural adaptations. For example, the penguin has to change its number of feathers
and its density to reduce its body warmth.

A2) The coordinated function of its internal systems provides the cells with the
requirements for life, including gases, nutrients and water, and removes cell wastes. For
example, each cell has a specialised job that all comes together to contribute to the
organism.
Respiration- oxygen + glucose  carbon dioxide + water
6O2 + C6H1206  6CO2 + 6H2O

Evidence Is Everything

Structure of the Earth-

Valid Reliable
- Tested hypotheses - Tested theories multiple times
- Develop a hypothesis - Used large sample sizes
- Gather data: observations
- Collated data: trends, made links to
what had already been found
(secondary source data)
- Controlled variables: (fair test)

Secondary Source Data- Secondary Source Data-

- Source of information: education, - Cross check it with other valid

degree in the field, is it a recognised sources and if consist, it is reliable.
valid institution e.g. university,
government, education sites.
- Current information (from recent
years)
- Relevant to the topic/ hypothesis.
- Was the data gathered using an
appropriate method and measuring
devices.
- Look at any bias

Scientifically accurate evidence= Needs to have scientific accurate evidence for it to be

deem valid. You can not have a theory without evidence. You need evidence to have a
theory.

Hypothesis- prediction
Theory- evidence
Law – very mathematical

- Theories can change

Glossary-

Mantle- Is the part of the earth between the core and the crust is the MANTLE. It is about
2,900 km thick and makes up nearly 80 percent of the Earth's total volume. The mantle is
made up of magma and rock.

Crust- Is the outermost layer of a planet. The crust of the Earth is composed of a great
variety of igneous, metamorphic, and sedimentary rocks

Volcano- A mountain or hill, typically conical, having a crater or vent through which lava,
rock fragments, hot vapour, and gas are or have been erupted from the earth's crust.

Lava- Hot molten or semi-fluid rock erupted from a volcano or fissure, or solid rock resulting
from cooling of this. (outside the crust)

Magma- Hot fluid or semi-fluid material below or within the earth's crust from which lava
and other igneous rock is formed on cooling. (inside the crust)

Continent- A large, continuous, discrete mass of land, ideally separated by an expanse of

water.

Crustal plate- Crustal plates form the outer layer of the Earth. There are seven major plates
and many smaller plates. These tectonic plates are formed from the Earth's crust and
uppermost part of the mantle.

Convection current- The transfer of heat by the mass movement of heated particles into an
area of cooler fluid.

Geology- The science which deals with the physical structure and substance of the earth,
their history, and the processes which act on them.

Atmosphere- The gaseous envelope surrounding the earth; the air.

Hydrosphere- All the waters on the earth's surface, such as lakes and seas, and sometimes
including water over the earth's surface, such as clouds.

Lithosphere- The rigid outer part of the earth, consisting of the crust and upper mantle.

Biosphere- The regions of the surface and atmosphere of the earth or another planet
occupied by living organisms.
 1.

2.

3.

4.

1. The Inner Core is about 5000-6000 degrees Celsius. The Inner Core is the hottest layer.
The inner core is believed to consist primarily of a nickel-iron alloy and some light elements.
It is 250 km thick and is the second smallest layer of the Earth.

2. The Outer Core is about 4000-5000 degrees Celsius. It is mainly liquid iron and nickel. The
Outer Core is about 2200 km thick. It is the second largest layer and made entirely out of
liquid magma.

3. The average temperature of the mantle is 3000° Celsius. The mantle is composed of
silicates of iron and magnesium, sulphides and oxides of silicon and magnesium. The mantle
is about 2900 km thick. It is the largest layer of the Earth, taking up 84% of the Earth.

4. The Crust's thickness can vary from wherever you are. From a continent to the edge of
the crust is about 60 km. From the bottom of the ocean to the edge of the crust is about 10
km. The Crust is composed of mainly granite, basalt, and diorite rocks. The Crust's
temperature is different throughout the entire crust. The temperatures start at about 200°
Celsius and can rise to 400° Celsius.

The Difference Between a Hypothesis, Fact, Scientific Theory and Scientific

Law-

Hypothesis:

- A supposition or proposed explanation made on the basis of limited evidence as a starting

point for further investigation.
- A hypothesis is a guess of what is happening or what will happen based on past evidence.
It links experiments, ideas and more to explain why something else happens or conclude
what the cause and effect is of an experiment.

Fact:

- A thing that is known or proved to be true. In science, an observation that has been
repeatedly confirmed and for all practical purposes is accepted as “true.” Truth in science,
however, is never final and what is accepted as a fact today may be modified or even
discarded tomorrow.

- Fact is an observation that has been viewed in an experiment or simply in the world
around us, although it is different to scientific law. Scientific law uses facts to explain some
sort of phenomenon and has been proven to be true through vigorous experimentation.
Theory is unlike fact as it is an explanation or prediction with evidence to back it up, but is
not always true.

Scientific Theory:

- A well-substantiated explanation of some aspect of the natural world, based on a body of

facts that have been repeatedly confirmed through observation and experiment.

- Every scientific theory, is initially a hypothesis. If enough evidence accumulates to support

a hypothesis, it moves to the next step – known as a theory. It then becomes accepted as a
valid explanation. A scientific theory is the framework for observations and facts. Theories
may change, or the way they are interpreted nay change, but the facts themselves don’t
change. A scientific theory is not the end result of the scientific method. Theories can be
improved or modified as more information is gathered so that the accuracy of the prediction
becomes greater over time. Theories and laws have separate and distinct roles in the
scientific method, A law is a description of an observed phenomenon. A theory on the other
hand, explains observations that re gathered during the scientific process.

- Scientific theories are similar to hypothesis but still have their differences. A scientific
theory is something that has been theorised or predicted with evidence to back it up, unlike
a hypothesis which forms based on other evidence. Scientific theories such as the famous
one created by Charles Darwin in 1859, the theory of Evolution by natural selection. It has
evidence and tests to back it up but isn’t proven. This theory is that rather than a religious
explanation to the world, humans came to be through evolution and natural, random
events. We could never prove this wrong but there is a lot evidence to say that we evolved
through millions of years and species.

Scientific Law:

A law in science is a generalised rule to explain a body of observations in the form of a

verbal or mathematical statement.
- A scientific law is similar to fact as it has been proven to be true, however, unlike fact a
scientific law is a generalised rule which is used to help explain a body of observations. The
way this information is represented is either in a verbal or mathematical statement.

Theory of Continental Drift-

What is it?

- The Continental Drift theory was a hypothesis created by Alfred Wegener in 1912 that
stated the continents were all a part of one “Pangaea” (the name Alfred Wegener gave the
one supercontinent) which is the greek word for “all the land”, that fit together like a jigsaw.
Pangaea started to break up into two smaller supercontinents, called Laurasia and
Gondwanaland, during the Jurassic period. By the end of the Cretaceous period, the
continents were separating into land masses that look like our modern-day continents. As
time went on, the supercontinent broke off and spread out to what place they are today.

- Wegener’s evidence gave points that would give a reason for why similar plants and animal
fossils, and rock formations were located on different parts of the world. However, many
other geologists and meteorologists disagreed with his theory as there wasn’t a reliable
model.

Fossils-

- A fossil can be known as the remains or impression of a prehistoric plant or animal

embedded in rock, that have been preserved.

- There are many examples of fossils found on separate continents, suggesting the
continents were once joined. Glossopteris is a fossil plant that was found throughout India,
South America, southern Africa, Australia, and Antarctica.

- Fossils of Mesosaurus (one of the first marine reptiles, even older than the dinosaurs) were
found in both South America and South Africa. These finds, plus the study of sedimentation
and the fossil plant Glossopteris in these southern continents led Alexander duToit, a South
African scientist, to bolster the idea of the past existence of a supercontinent in the
southern hemisphere.

Jigsaw-

- The theory about Continental Drift shows evidence about how the continents of the earth
fit together like pieces of a puzzle.
- For example the east coast of South America fits together with the west coast of Africa,
and the rock layers also fit together. The two places are similar in geology as well.
- Basically, all the landmass on Earth is one giant puzzle.
Sea Floor-

- Continental drift is the theory of how the whole lithosphere formed and spread apart. The
Continental Drift Theory states that parts of the Earth’s crust slowly drifts atop of the Earth’s
liquid core. This hypothesis asserts that the continents consist of lighter rocks that rest on
heavier crustal material. The theory states that the continents are moving at a rate of about
99.44em per century.

- Seafloor spreading is a process that occurs at mid-ocean ridges, where new oceanic crust if
formed through volcanic activity and then gradually moved away from the ridge. Seafloor
spreading was a major contributor in finding reasons for continental drift and the theory of
plate tectonics.

- Seafloor spreading is a process that occurs at mid-ocean ridges, where new oceanic crust is
formed through volcanic activity and then gradually moves away from the ridge. Seafloor
spreading helps explain continental drift in the theory of plate tectonics.
- There is evidence that shows that seafloor spreading supports the Theory of Continental
Drift. Seafloor spreading is when the Earth’s plates move away from each other and as
magma rises in the gap a new plate is formed. This is also known as Divergent Plate
Tectonics. Seafloor spreading supports the theory of continental drift as the one of the ways
the continents could have drifted apart would have been due to the sea floor splitting or
spreading resulting in the continents moving. The seafloor moving is a vital factor in the
theory of continental drift. Evidence had been discovered to support this theory. Samples of
seafloor rocks also show that the rocks are estimated to be around 200 million years in old
in contrast to the continental rocks which are believed to date back to 3 billion years. This
piece of evidence supports the fact that seafloor spreading occurred and may have been a
vital factor in the theory of continental drift.

- Further evidence can be found in the middle of the Atlantic ocean, where there is a rift. It's
called the Mid-Atlantic Ridge. When two oceanic plates drift apart, magma underneath the
crust is allowed to flow upwards and make new rock. This usually forms a kind of mountain
range, split in the center by a rift valley. Since the Mid-Atlantic Ridge spreads so slowly
(about 2.5 centimeters, or around an inch, per year) the valley is huge. In more quickly-
spreading faults there is little to no rift valley.

Plate Tectonics-

- Plate tectonics explains the features and movement of Earth's surface in the present and
the past. Plate tectonics is the theory that Earth's outer shell is divided into several plates
that glide over the mantle. Developed from the 1950s through the 1970s, plate tectonics is
the modern version of continental drift, a theory first proposed by scientist Alfred Wegener
in 1912.

Geothermal Energy-

- Geothermal activity is caused by the transfer of heat from depth to the earth's surface.

- Wegener found rocks of the same type and age on both sides of the Atlantic Ocean. He
thought that the rocks formed side by side. These rocks then drifted apart on separate
continents.

- Wegener also matched up mountain ranges across the Atlantic Ocean. The Appalachian
Mountains were just like mountain ranges in eastern Greenland, Ireland, Great Britain, and
Norway. Wegener concluded that they formed as a single mountain range. This mountain
range broke apart as the continents split up. The mountain range separated as the
continents drifted.

- As geothermal activity includes volcanic activity, the formation of rocks from the magma
and lava is also included. To continue, each volcano is slightly different and therefore
creates a slightly different magma/lava. Therefore the type, age and other qualities of the
rocks formed is different.

- This illustrates that the exact same rock can not be formed on the opposite side of the
world. Therefore, these rocks formed together and then drifted apart when the continent
Pangaea separated.
- Wegener matched mountain ranges on different continents to each other. He stated that
the Appalachians of the United States and Canada were the same as mountain ranges in
Norway, Ireland, Great Britain and Greenland.

- Based on these findings and the fact that the same rocks have to be formed at the same
time and in the same place, he came to the conclusion that these mountains were once a
single mountain range that has since been separated as the continents drifted apart.

Plate Tectonics-

Convergent Boundary- Semester

2

Divergent Boundary-

Transform Boundary-

Plate Boundaries-

Pushing and Shoving-

- Deep inside the earth heat pushes outwards.

- Convection is the movement of heat.
- Heat drives convection currents in the mantle.
- Tectonic plates push against each other. When its sea floor and sea floor its 50/50 chance
with one goers beneath. If its sea floor and continent, the continent always wins. (due to
density)
- Faults are when rocks spilt due to pressure/ movement.

- The crust thickness varies, the lower layers are semi-molten and molten material lies
underneath. The crust also has cracks, and consists of 7 larger plates (and several smaller
ones), rather than one giant piece.
- The Theory of causes Plate Tectonics says that forces within the Earth cause these giant
plates to move. It is thought that molten rock moves to the surface at the mid-ocean ridges
(underwater mountain chains) and forms new crust. This movement pushes the crustal
plates outwards from the mid-ocean ridges.

- At the other sides of the crustal plates, the plates of the crustal plates, the plates are
colliding into each other, or one plate is disappearing under the other. New crust is
continually being formed and old crust is being destroyed at the rate of 2cm per year. The
top plate buckles, bends and cracks as it rises over the sinking plate, causing mountain
ranges to form.

- Some geologist think the forces moving the crustal plates are caused by huge convection
currents which move through the earth. As the molten magma rises (towards the mid-ocean
ridges) it pushes cooling magma (new crust) out of its way. This forms mid-ocean ridges and
also forces the crustal plates apart. Crust at the other edges of the plate sinks and melts
again to take place of the moving magma.

- Ocean ridges are formed where plates diverge, magma from the mantle spews out onto
the Earth's surface and forms a ridge of volcanoes.

- When plates slide past each other earthquakes are caused The plates do not slide
smoothly; they get jammed together and the pressure builds up. Suddenly, the plates jolt
past each other and start sliding again.

- If one plate is made from oceanic crust and the other plate is continental crust, the edge of
the oceanic plate sinks under the lighter continental plate. The areas where this happens
are called subduction zones. Deep ocean trenches form along subduction zones. When
plates sink under each other, huge amounts of heat and friction are produced. The heat and
friction result in earthquakes and volcanic activity.

- At diverging plate boundaries, earthquakes occur as the plates pull away from each other.
Volcanoes also form as magma rises upward from the underlying mantle along the gap
between the two plates. We almost never see these volcanoes, because most of them are
located on the sea floor.

Convection Currents-
Shake, Rattle and Roll-

- A seismic wave is formed from the convection currents in the mantle cause the tectonic
plates to move past each other, away from each other or underneath one another.
However, this motion is by no means smooth, and sometimes the plates lock together and
jam in position. As the convection currents are still trying to make the plates move,
enormous strain builds up in these jammed plates. As the strain increases, the rocks of the
plate get distorted. When the strain forces finally get big enough to overcome the jamming
of the plates, the plates suddenly snap into a new position. This rapid movement causes
rocks in the plate to break and energy to be released. About 5 per cent of this energy travels
through the Earth in the form of waves. These are called seismic waves and it is the
vibration of the Earth in response to the passage of these waves that we call an earthquake.

- The movement of tectonic plates can cause earthquakes. For example, the moving past
each other, away from each other and underneath one another. The world's major
earthquakes occur near plate boundaries. Smaller earthquakes can occur wherever there is
movement in the ground, such as along a fault line.

3 Types of Waves-

Wave Description Speed Where they travel?

P P-waves (or primary waves) are They are the fastest As the P-waves are
compression waves, moving of the seismic waves able to travel
through the Earth in the same and so are the first through the interior
way that sound waves move waves to arrive at a of the Earth, they
through air. seismometer. are said to be body
waves.
S The second sets of waves to be They are the second As the S-waves are
detected are the secondary fastest of the able to travel
waves or S-waves. These travel in seismic waves and through the interior
the form of transverse waves. reach the of the Earth, they
The ripples on the surface of a seismometer are said to be body
pool when a rock has been second. waves.
dropped into it form transverse
waves.
L L-waves are surface waves and They travel much L-waves travel
travel around the Earth. L-waves more slowly than around the earth on
are responsible for the majority either the P-waves its surface.
of an earthquake's destructive or S-waves.
power. This is because all of the
L-wave energy is distributed
across the surface of the Earth
rather than being spread out
through the Earth's interior as in
 the case of P- and S-waves.

- An earthquake is measured by the waves travelling from the focus can be detected using a
device called a seismometer. The record of seismic activity obtained from a seismometer is
called a seismogram on which the P-, S- and L-waves appear as a continuous sequence of
wriggles. The height of these wriggles indicates the intensity of the waves that are being
recorded, with larger amplitudes coinciding with more energetic waves.

- The epicentre of an earthquake is determined by it being the point on the surface directly
above the focus.

- The strength of an earthquake can be measured in a number of ways. The most well-
known way of measuring the strength of earthquakes is the Richter scale. The Richter scale
measures the amount of energy released during an earthquake. The higher the Richter scale
measurement, the more intense the earthquake. Each increase on the scale represents a 30
times increase in the energy released during the quake. So, an earthquake of magnitude 5
releases 30 times more energy than one that measures 4 on the scale.

The Richter Scale-

- Earthquakes occurring under the ocean or near a coastline can cause the formation of
giant ocean waves called tsunamis. A tsunami is not a single wave; in fact it is made up of a
series of waves that travel across the ocean at speeds of up to 800 km/h.

- A tsunami is formed when a wave series forms when the water, which is displaced by an
underwater earthquake or landslide, travels outwards from the disturbance just like ripples
that form when a stone is dropped into a pond. In deep water, the waves are only a metre
or so in height and separated by as much as 100 km. As the waves enter the shallow water
along a coastline, they slow down. The waves further back start to catch up to the ones in
front, causing the waves to increase in height as they bunch up. These waves can reach
heights of 30 metres before they break onto the land. The massive body of water then
moves inland, causing severe flooding and considerable loss of life and property.

Evolution-

Evolution- It is the idea that all organism arose from a common ancestor.

 There is change over time of a species.

 Existed from earlier forms
 Physical features over time.

Natural selection- Is as process of evolution

1. Variation in the population to start
2. Selective pressure is applied (environmental changes e.g. drought/excessive rainfall)
3. Those best suited to survive
4. Reproduce
5. Whole population has evolved to suit environment

- Evolution is the idea that all organism arose from a common ancestor. The Earth is about
4,500 million years old. There is evidence that living things existed on Earth at least 3,500
million years ago. The main theory is that living things developed from molecules that could
replicate, or copy, themselves, rather like DNA does. There are two possible origins for these
replicating molecules:
 They were produced by the conditions on Earth at the time
 They came from somewhere else, such as another planet in our Solar System, or
further out in space

- Multicellular life evolves 2.2 billion years ago, 1.7 billion years after first life arises on Earth.
Charles Darwin as an English naturalist who studied variation in plants and animals during a
five-year voyage around the world in the 19th century. He explained his ideas on evolution
in a book called, 'On the Origin of Species', published in 1859. Darwin's ideas caused a lot of
controversy, and this continues today, because they can be seen as conflicting with religious
views about the creation of the world and the creatures in it.

- The basic idea behind the theory of evolution is that all the different species have evolved
from simple life forms. The theory of evolution states that evolution happens by natural
selection. The key points are that:

 Individuals in a species show a wide range of variation

 This variation is because of differences in their genes
 Individuals with characteristics most suited to the environment are more likely to
survive and reproduce
 The genes that allow these individuals to be successful are passed to their offspring

DNA-

- The human body contains about 100 trillion cells, each working together in a complex
symphony of interactions. With the exception of red blood cells. Which contains no nucleus
and no nuclear DNA, every one of these cells contains the human genome – a string of three
billion A’s, C’s, G’s and T’s. and in every one of the 100 trillion cells the sequence of these
four letters, or basses, is nearly identical. Although the DNA code from cell to cell is the
same, there are many different types of cells within the body, each with a specific function.

-Within every cell (except red blood cells) is a nucleus – a sphere like structure separated
from, the rest of the cell by a membrane. The nucleus acts as the cell’s control centre,
regulating its growth, metabolism and reproduction. At the heart of this control centre is
the human genome. The nucleus contains instructions in the form of DNA, DNA stands for
Deoxyribonucleic Acid.
- The human genome is comprised of two sets of 23 chromosomes – 46 chromes in all. Each
parent contributes a set. About 97% of the genome consists of sequences that don’t code
for proteins and have no known function. Within the rest of the genome are an estimated
70,000 genes.

When stained, chromosomes show bands of light and dark areas, the dark areas. The dark
bands indicate areas where the structure of the chromosome is dense. Each of the 23
chromosome types has a unique banding pattern. (a chromosome pair has identical
banding.)

Genes determine whether you have brown eyes or blue, curly hairy or straight, and much
more. Genes also control everything from how your cells grow to how they interact with
one another. A single gene can range in light from as few as 100 DNA bases to as many as
several million.

There’s a lot of DNA within the nucleus – about 3 metres if you could unravel it and stretch
it end to end. To fit such a long molecule within a tiny space of the nucleus, DNA bends and
loops in serval ways. The largest of these loops results from the helical coiling of chromatin
(the thick line in diagram 1). This coiling causes the chromosome to resemble a spring.
Chromatin refers to proteins that help organise the long DNA molecule, the protein in
diagram 1 supports and organises small loops of DNA.

Diagram 1

- In a DNA strand, the DNA is wrapped around histones (protein structures) histones carry a
slight positive charge, and DNA carries a slight negative charge. Since opposite charges
attract, the DNA is pulled in toward the histones. A nucleosome is a segment of the DNA
wrapped around a core of histones.

- A double helix is a pair of parallel helices intertwined about a common axis. The double
helix shown in diagram 2, is the structure of a naked DNA, DNA without all the proteins that
organise it into chromatin.
 Diagram 2

- The DNA molecule is made up of four bases – adenine (A), cytosine (C), guanine (G) and
thymine (T). each rug of the DNA ladder consists of two bases. In the DNA molecule, A
always pairs up with T, and C always pairs up with G.

Diagram 3

- The sides of the DNA ladder consist of a long string of sugar and phosphate molecules, to
which the bases are attached. Each sugar-phosphate-base combination ids called a
nucleotide.

Nucleotide.

A DNA strand is made letters:

ATGCTCGAATAAATGTCAATTTGA
The letters make words:
ATG CTC GAA TAA ATG TCA ATT TGA
The words make sentences:
<ATG CTC GAA TAA> <ATG TCA ATT TGA>

- These sentences are called genes, genes tell the cell to make other molecules called
proteins. Proteins enable a cell to preform special functions, such as working with other
groups of cells.
What is a Protein?

- Proteins are the machines that make all living things function. Every cell in the body
contains thousands of different proteins, which work together like machines to run the cell.
Examples of different proteins include receptor proteins that are about of our nervous
system and structural proteins that help cells extend branches and hold them in place.

- Cells use the information encoded in the genes for making proteins. Each gene in the DNA
encodes information about how to make an individual protein. When a cell needs to make a
protein, the cell’s nucleus reads the gene and then uses that information to produce a
molecular message in the form of RNA, a molecule very similar to DNA. RNA then moves
form the nucleus into the cytoplasm and then to the ribosome. The ribosome then reads the
message and produces a protein that exactly matches the specifications laid out in the gene.
Once made, the protein travels to the part of the cell where it is needed and begins to work.

What is a Chromosome?

- Each cell in our body contains a lot of DNA, this DNA is packed into compact units called
chromosomes. The packaging of DNA into a chromosome is done in serval steps, starting
with the double helix of DNA. Then the DNA is wrapped around some proteins. These
proteins are packed tightly together until they form a chromosome, chromosomes are
efficient storage units for DNA.

- Each human cell has 46 chromosomes. All the DNA is organised into two sets of 23
chromosomes. There are two sex chromosomes that determine whether you are male or
female. In the picture the sex chromosomes are labelled “X” and “Y”. the set of
chromosomes in this picture are from as male – you can tell because females do not have a
Y chromosome. Instead they have two X chromosomes.
Heredity-

The passing of traits from parents to child is the basis of heredity. A trait is a notable feature
or quality in a person. Our genes encode the instructions that define our traits Each of us
have thousands of genes, which are made of DNA and reside in our chromosomes. The
environment we grow up and live in also help define our traits. For example, while a
person’s genes may specify a certain hair colour, exposure to chemicals or sunlight can
change that colour.

Passing of Traits-

- When parents conceive a child, they each contribute one complete set of chromosomes to
the child. Every child receives half the chromosomes from the mother and half from the
father. This transfer takes place at conception. While most cells in our bodies contain n two
sets of chromosomes (2 x 23 = 46), sperm and egg cells each have only one set (23). When
they join, there create a single cell, called a zygote, which has two sets of chromosomes
(46).

- each parent contributes one complete set of chromosomes to the child. This set can
contain chromosomes from both the parent’s two sets. The only rule is that the child must
receive exactly one of each chromosomes. Since the parents contribute chromosomes
randomly to each new child every child inherits a unique set of chromosomes. As a result,
every child will have a unique combination of traits. Some will resemble the mother, and
some will resemble the father, still others will be unique ,a product of the new combination.

Types of Traits-
  Physical traits- are characteristics of one’s physical makeup. These include hair
colour, eye colour and height.
 Behavioural traits- are characteristics of the way one acts. A sheepdog’s herding
instinct and a retriever’s desire to fetch are good examples of behavioural traits.
 Predisposition to a medical condition- an increased risk of getting a certain type of
disease is also a type of trait that can be passed parent to child, some examples o
such diseases include heart disease, cancer and certain types of mental illness.

What Defines Our Traits?

- The instructions encoded on our genes play a role in defining traits. But non-genetic or
environmental influences in our lives are just as important in shaping our traits. Examples
include:
Genetics: Our genes determine our natural hair colour.
Environment: Exposure to sun or hair dyes can easily change the colour.
Genetics: People breed retrievers to chase things and bring them back.
Environment: You can train a retrieve to instead roll over when you toss a ball.
Genetics: A person may be born with an increased risk of heart disease.
Environment: Eating healthy foods and exercising can reduced this risk.

Alleles-

- Scientists describe the set of genetic information for each form of a trait as an allele
(capital letter and little letter in punnet squares). Scientists use the word homozygous to
describer having two of the same allele for a trait. The capital letter is the dominant allele
and the little letter is the recessive allele. A recessive allele needs to have two of the gene to
be passed on. Scientists use the word heterozygous to describe having two different alleles
for a trait (one capital letter and one little letter). Punnet squares can be uses to show how
alleles can be passed on from parent to child.

- Alleles can also work together to producer incomplete dominance. For example, crossing a
red flower with a white flower can produce a pink flower.
 Home Renovations-

Energy Sources-

Renewable Energy Sources Non-Renewable Energy Sources

- Solar energy - Fossil fuels
- Hydropower - Coal
- Biofuel - Petroleum
- Biomass - Natural gas
- Geothermal - Nuclear energy
- Tidal power
- Wave power
- Wind power

Non-Renewable Energy Sources

Advantages Disadvantages
- Non-renewable sources are cheap and - Non-renewable sources will expire some
easy to use. You can easily fill up your car day and we have to us our endangered
tank and power your motor vehicle. resources to create more non-renewable
- You can use small amount of nuclear sources of energy.
energy to produce large amount of power. - The speed at which such resources are
- Non-renewable have little or no being utilized can have serious
competition at all. For eg: if you are driving environmental changes.
a battery driven car your battery gets -Non-renewable sources release toxic
discharged then you won’t be able to gases in the air when burnt which are the
charge it in the middle if the road rather it major cause for global warming.
is easy to find a gas pumping station. - Since these sources are going to expire
- They are considered as cheap when soon, prices of these sources are soaring
converting from one type of energy to day by day.
another. - Older plants (without emissions filters)
generate large amounts of pollution
- Generated smoke can cause health
conditions such as emphysema
- Sulphur dioxide and nitrogen emissions
can bind to water creating acid rain
- Coal miners can be affected by black lung
disease or pneumoconiosis and also
emphysema if they breathe in too much of
the coal dust

Renewable Energy Sources

Advantages Disadvantages
- The sun, wind, geothermal, ocean energy - It is not easy to set up a plant as the initial
are available in the abundant quantity and costs are quite steep.
free to use. - Solar energy can be used during the day
 - The non-renewable sources of energy that time and not during night or rainy season.
we are using are limited and are bound to - Geothermal energy which can be used to
expire one day. generate electricity has side effects too. It
- Renewable sources have low carbon can bring toxic chemicals beneath the earth
emissions, therefore they are considered as surface onto the top and can create
green and environment friendly. environmental changes.
- Renewable helps in stimulating the - Hydroelectric provide pure form of energy
economy and creating job opportunities. but building dams across the river which is
The money that is used to build these quite expensive can affect natural flow and
plants can provide jobs to thousands to affect wildlife.
millions of people. - To use wind energy, you have to rely on
- You don’t have to rely on any third strong winds therefore you have to choose
country for the supply of renewable suitable site to operate them. Also, they
sources as in case of non-renewable can affect bird population as they are quite
sources. high.
- Renewable sources can cost less than
consuming the local electrical supply. In the
long run, the prices of electricity are
expected to soar since they are based on
the prices of crude oil, so renewable
sources can cut your electricity bills.
- Various tax incentives in the form of tax
waivers, credit deductions are available for
individuals and businesses who want to go
green.

Electricity-

How is it formed?
- Coal is transported to the power plant by trains, then through a number of conveyor belts,
it is transported to the pulveriser. The coal is then crushed into dust and then transported to
the furnace. It is then burned and the heat creates steam. This steam is then transported to
the turbine. This steam turns the wheels in the turbine causing the generator to create
energy. This energy is then transported to the transformer where more electricity is made.
This electricity is then sent to the power lines and out to the world.

Energy Conservation-

Types of Energy-

 Kinetic (movement)
 Potential – Chemical storage
– Elastic
– Gravitational
 Electrical
 Sound
 Light
 Heat
 Nuclear

- The thicker the arrow in a diagram, the greater the energy.

- Energy transfer- Energy moves from one object to another without changing form
Energy transformation - One form of energy is converted to another.

- The law of conservation of energy, a fundamental concept of physics, states that the total
amount of energy remains constant in an isolated system. It implies that energy can neither
be created nor destroyed, but can be change from one form to another.

- Energy efficiency is about using less energy to achieve the same outcomes, like running
appliances or heating and cooling a home. Improving energy efficiency is also a cost-
effective way of reducing greenhouse gas emissions.

- When energy transformation occurs, energy loss also happens. This mainly occurs in the
form of heat or sound energy. For example, when a light bulb is on, heat energy is also
released as wasted energy. Also, if an appliance is not energy efficient, energy loss will occur
more.

Light Globes-

Incandescent Light-

- The incandescent light bulb or lamp is a source of electric light that works by
incandescence, which is the emission of light caused by heating the filament. They are made
in an extremely wide range of sizes, wattages, and voltages. An incandescent bulb typically
consists of a glass enclosure containing a tungsten filament. An electric current passes
through the filament, heating it to a temperature that produces light.

Compact Fluorescent Light (CFL)-

The compact fluorescent light bulb or lamp is a type of fluorescent lamp generally designed
as a replacement for incandescent or halogen lamps. There are two major types of compact
fluorescent lamp, screw-in and plug-in. Screw in lamps are self-ballasted and can generally
be placed in an existing screw socket without any additional equipment, plug-in bulbs
require a ballast and a socket that corresponds to their specific base configuration. These
are also sometimes referred to as integrated (screw base) and non-integrated (plug base).
Both come in a wide variety of wattages, sizes, colour temperatures, and base types, and
they are known primarily for their efficiency, long life, low cost, and ease of upgrading.
Compact fluorescent lamps are functionally identical to linear fluorescent bulbs. Both are
gas-discharge lamps that use electricity emitted from cathodes to excite mercury vapour
contained within the glass envelope, using a process known as inelastic scattering.
Phosphors and a noble gas such as argon are also contained within the glass envelope. The
mercury atoms produce ultraviolet (UV) light, which in turn causes the phosphors in the
lamp to fluoresce or glow, producing visible light.

Light Emitting Diode (LED)-

For the purposes of practical lighting usage, the light produced must be roughly white. Since
unadulterated LEDs have historically only produced non-white colours, one of two methods
is used to create white light. For the purposes of practical lighting usage, the light produced
must be roughly white. Since unadulterated LEDs have historically only produced non-white
colours, one of two methods is used to create white light. The first is an RGB system, which
works by mixing light output from red, blue, and green diodes in close proximity in order to
create white light. The second is using phosphor-based LEDs, which involves coating an LED
with phosphor in order to shift the colour into the white spectrum. This is similar to the
technology used to create different hues of light from fluorescent lamps.

Halogen-

The halogen light bulb or lamp is a type of incandescent lamp which uses a halogen gas in
order to increase both light output and rated life. They are known for moderately high
efficiency, quality of light, and high rated life compared to regular incandescent lamps. A
halogen lamp functions identically to an incandescent lamp, with one notable exception:
The halogen cycle. In a typical incandescent lamp, tungsten slowly evaporates from the
burning filament. This causes blackening of the lamp, which decreases light output and
reduces life. Halogen lamps are largely able to eliminate this problem because the halogen
gas reacts chemically with the evaporated tungsten to prevent it from affixing to the glass.
Some tungsten is returned to the filament, which also serves to increase the rated life of the
lamp. Because the temperature required for this reaction is higher than a typical
incandescent bulb, halogen lamps must generally be manufactured using quartz.
Light Output Comparison-

Incandescent Halogen CFL/LED

Light Power Cost Power Cost Power Cost
Output (Watts) ($/Yr) (Watts) ($/Yr) (Watts) ($/Yr)
(lumens)
220 25 $7.70 18 $5.50 5-6 $1.50-
$180
420 40 $12.30 28 $8.60 7-9 $2.10-
$2.80
720 60 $18.40 42 $12.90 11-13 $3.40-
$4.00
930 75 $23 52 $15.90 13-15 $4.00-
$4.60
1300 100 $30.70 70 $21.50 18-23 $5.50-
$7.10

Running Costing for Downlights-

12V Halogen 12V LED CFL

Light Power Cost ($/Yr) Power Cost ($/Yr) Power Cost ($/Yr)
Output (Watts) (Watts) (Watts)
(lumens)
230 20 $7.70 4-5 $1.50- 7-9 $2.10-
$1.90 $2.80
500 35 $13.40 6-8 $2.30- 10-11 $3.10-
$3.10 $3.40
750 50 $19.20 10-12 $3.80- 13-15 $4.00-
$4.60 $4.60

Solenoids and Electromagnetism-

- Electromagnetism is the phenomenon of the interaction of electric currents or fields and

magnetic fields. If you map the magnetic field around the wire it proves the magnetic field.
It is also called electromagnetism.

- A solenoid is a cylindrical coil of wire acting as a magnet when carrying electric current. If
we twist a current carrying wire around and around to form a loop the magnetic field down
the centre is made stronger. The is called a solenoid.

- An electromagnet is a soft metal core made into a magnet by the passage of electric
current through a coil surrounding it.

- A magnet field is produced when an electric current flows along a wire. If you map the
magnetic field around the wire it proves the magnetic field. It is called electromagnetism.
If we twist a current carrying wire around and around to form a loop the magnetic field
down the centre is made stronger. The is called a solenoid.

- We can therefore create a magnet by simply running a current through a wire. When we
run a current through a solenoid, however, we get a super strong magnet because the
magnetic field is concentrated inside the coil. This can be incredibly useful in our everyday
lives. The greater the current the stronger the magnet.

- When a magnet is passed through the solenoid, electric current is caused to flow in the
circuit to which the coil is attached. If the magnet is withdrawn, the direction of the current
is reversed. Such currents are called INDUCED CURRENTS.
The size of the current depends on how fast the magnet moves in or out of the coil, and the
number of loops in the coil.

- As you can observe, when the north end of the magnet enters the coil, a current is induced
that travels around the coil in a counter-clockwise direction; when the magnet is then pulled
out of the coil, the direction reverses to clockwise.
Also notice that the current produced is stronger when the magnet is moved quickly rather
than gradually.

- The mechanical energy of the moving magnet is converted into electricity, because a
moving magnetic field induces a current. The current that has been induced in the wire, in
turn, generates another magnetic field around the wire.

Methods for Improving Energy Efficiency-

Using Materials for reducing heat loss in a house-

 Materials such as wood and other non-metal materials help reduce heat loss in a
house as they are insulators. The use of these materials reduces the amount of
conduction between materials, therefore in summer cool air stays in and in winter
cool air stays out.

How position of the windows can help reduce heat loss-

 The position of your windows can help reduce heat loss in summer and gather more
heat in winter as west facing windows are exposed to the hot afternoon sun, and
therefore allow more heat to enter the room compared to windows that face other
directions.

How insulation in walls, under floor and in the ceiling improves energy efficiency-
 Home insulation keeps a house cooler in summer and warmer in winter. This reduces
the need to use heating and cooling appliances, making the home more energy
efficient.

How curtains/blinds help-

 Curtains and blinds can help improve energy efficiency as closed curtains can stop
hot air in winter and cold air in summer in. As a single pane of glass can lose almost
10 times as much heat as the same area of an insulated wall, the curtains/blinds help
reduce this heat loss as the act as an insulator.

How double glazed windows help-

 Double glazed windows consist of two panels of glass, therefore significantly
reducing the amount of heat that enters or exits a house. This means that a house
will be cooler in the summer and warmer in the winter, decreasing the need to use
heaters and air conditioners.

How types of flooring can affect heat loss or heat gain e.g. tiles, carpet, wood-
 The warmest floorings for a house are carpet, cork, vinyl and natural stone. Carpet
has threads that protect the room from cold outdoor temperatures while also
insulating the room to avoid heat loss.
  Cork, especially if it is thick, is filled with tiny air pockets that act as cushions of
insulation to stop cold air from entering and warm air from exiting.
 Vinyl is a very resistant and, when paired with cork or foam underneath, is a good
home insulator.
 Natural stone also keeps a house cool, and when paired with underfloor heating, can
keep a house warm.

How colours impact on energy efficiency-

 During summer, a lighter coloured roof of a house is more efficient. This is because it
reflects all wavelengths of light, meaning that it is able to keep the house cooler
during the warm months of summer.
 During winter, however, a darker coloured roof would be more beneficial to the
energy efficiency of the house. This is due to the light-absorbing properties of darker
colours, which absorb more wavelengths of light. This increases the temperature on
the interior of the house, reducing the need for heating appliances.

Presence of grass or trees around or close to a house-

 The presence of grass and trees around or close to a house can help reduce the
average heat temperature in the area. Trees and vegetation lower surface and air
temperatures by providing shade and through evapotranspiration. Shaded surfaces,
for example, may be 11–25°C cooler than the peak temperatures of unshaded
materials. Evapotranspiration, alone or in combination with shading, can help reduce
peak summer temperatures by 1–5°C.

Types of Waves-

Transverse Waves-

- Water waves
- The greater the frequency (Hz), the smaller the wavelength
- The higher the frequency, the higher the pitch
Longitudinal/Compression Waves-

- Sound waves
- The particles move back and further
- (Slinky)

- Sound is transmitted through gases, plasma, and liquids as longitudinal waves, also called
compression waves. It requires a medium to propagate. Through solids, however, it can be
transmitted as both longitudinal waves and transverse waves.

Definitions-

Crest- The highest point of a wave is called the crest.

Trough- The lowest point is called the trough.
Displacement- Distance from the origin to the top of the crest.
Amplitude- Is the distance between the midline of a wave and its crest or trough. Amplitude
measures how much energy is being transported by the wave. The larger the amplitude, the
more energy a wave has.
Wavelength- The distance between successive crests of a wave, especially points in a sound
wave or electromagnetic wave.
Frequency- Frequency (Hertz) equals the number of waves that passes a given point per
second. (measurement of sound)
Velocity- Frequency x wavelength

- The range of human hearing is generally considered to be 20 Hz to 20 kHz, but it is far

more sensitive to sounds between 1 kHz and 4 kHz.

Absorbing Sound Energy-

- Absorbent materials will be anything that can transmit sounds though themselves and
them absorb the sounds, converting it into small amount of friction energy. Any item that
will allow air to pass into it, and then be absorbed by a cellular structure, make a good
sound absorber.

- Practical ways that the transfer of sound energy can be reduced in the home include
adding materials such as carpet and trees to the home and double glazing windows can all
help reduce sound in the home.

Sound-

Sound-

- Sound energy is not carried as transverse waves but rather in the form of compression
waves. Sound is created by fast, back and forth movements called vibrations. When you
create sound by striking a drum, the drum skin causes air particles around the drum to be
pushed together, then a moment later spread apart. The energy of the vibrating drum skin is
transferred to the nearby air particles, making them vibrate as quickly as the drum skin. The
vibrating air particles bump into nearby air particles, making them vibrate as well. This
creates a series of compressions (a region of air particles that are close together) and
rarefactions (a region of air particles that are spread apart) that we call sound waves.

- In compression waves, the medium oscillates backwards and forwards parallel to the
direction in which the energy is transferred. Compression waves are also known as
longitudinal waves. The wavelength of a compression wave is the distance between the
centre of two adjacent compressions or two adjacent rarefactions.
- When a mobile phone rings in a bell jar, the sound can be heard clearly. When the air in
the bell jar is sucked out by a vacuum pump, the sound fades. If all of the air is removed, no
sound can be heard at all. This is because sound cannot travel through empty space. Sound
energy can only be transferred through a medium in which vibrating particles carry that
energy. In empty space, there are no particles to vibrate. Light on the other hand does not
require a medium to travel through. It can travel through a vacuum. So you can still see the
mobile phone, even if you can't hear it.

- The frequency of a vibration or wave is the number of complete waves generated per
second. Frequency is measured in hertz (Hz), a unit named after Heinrich Hertz, the German
physicist who, in 1887, was the first to detect radio waves. One hertz is equal to one
oscillation or wave per second, so a middle C note produced by a musical instrument creates
sound waves corresponding to 256 vibrations per second or a frequency of 256 hertz. The
frequency of a sound determines its pitch. High-frequency vibrations produce high pitch,
and low-frequency vibrations produce low pitch.
- As the frequency of a sound gets higher, that is, as more compressions are produced per
second, the compressions become closer together. Thus, low-frequency sounds have long
wavelengths and high-frequency sounds have short wavelengths.

- While the frequency of a sound wave determines its pitch, the amplitude determines its
loudness; higher amplitudes correspond with louder sounds.

The Speed of Sound-

- Sound energy is carried by compression waves and so relies on the collision of

neighbouring particles in a medium. In a medium in which the particles are more tightly
packed and have less distance to travel to collide, such as in a liquid or a solid, sound waves
travel faster. In air, sound travels at a speed of approximately 340 m/s, while in sea water
sound waves travel at 1533 m/s — well over 4 times faster than in air. Several ocean-
dwelling animals rely upon sound waves to communicate with other animals and to locate
food. These animals make use of this method of communication effectively over long
distances because sound travels so much faster in water. Dolphins for example use
echolocation (reflected sound) to locate food and to communicate with each other while
travelling in groups. They send out high frequency sound pulses, or ultrasound, that are
reflected back when they strike a target. This echo helps the dolphin to identify the size,
shape and direction that an object is moving.

- The speed of sound in gases depends on temperature. Sound travels faster in warm air as
the particles of mainly nitrogen and oxygen have more kinetic energy and so move more
quickly.

- The speed of sound through various materials is shown in the table below.
Ultrasound-

- While the human ear can detect sound frequencies between 20 and 20 000 Hz,
frequencies well beyond the range of human hearing are used in a variety of useful
technologies.

- Sound with frequencies higher than those that humans can hear is called ultrasound. This
image of an unborn baby is produced with ultrasound. To produce images like this, an
ultrasound is sent through the mother's body. Some of it is reflected from the surface of the
baby. A computer is used to change the reflected ultrasound into an image. The images are
used to check for problems during pregnancy.

- Ultrasound is also used in industry to check for cracks in metal, drill holes in glass and steel.

Sonar-

- Ultrasound is used in sonar to produce images of underwater objects or the ocean floor.

1. Ultrasound is sent down into the water.

2. Objects under the water (and the ocean floor) reflect some of the ultrasound.
3. A receiver detects the reflected ultrasound.

Measuring Sound-

- While we can hear sound waves, they are invisible. However, they can be studied by
converting the sound energy into electrical energy using a device called a cathode ray
oscilloscope (CRO). A microphone connected to the CRO measures the air pressure changes
associated with the compressions and rarefactions of a sound wave and produces a graph
on the CRO screen called a waveform. This allows us to record how quickly the sound wave
makes the air vibrate and compare the energy levels of sound waves.

- The pitch of a sound depends on how quickly it makes the air vibrate. High-pitched sounds
have a high frequency and make the air vibrate quickly. As a result, they produce ‘bunched-
up’ waveforms. Low-pitched sounds have a low frequency and make the air vibrate less
quickly, so the waveforms are more spread out.
 A computer uses the time taken
for the reflected ultrasound to
return to the ship to calculate
the depth of objects in the
water. It can also map the
ocean floor.

- As in all waves, frequency is measured in Hz. High-frequency sounds are more high pitched
than low-frequency sounds.

- Loud sounds produce a tall waveform on a CRO display. This is because more sound energy
produces a larger electrical signal. Soft sounds, on the other hand, produce a shorter
waveform.

- The decibel (dB) scale is commonly used to measure the sound level or loudness of sound.
On the decibel scale, the quietest audible sound is 0 dB. Each 10-fold increase in sound level
is an extra 10 dB higher. So a sound 1000 times more powerful than the quietest audible
sound is 30 dB. Some common sounds and their decibel ratings are shown below.
- Any sound above 85 dB can cause hearing loss, and the loss is related both to the loudness
of the sound as well as the length of exposure. You know that a sound exceeds 85 dB if you
have to raise your voice to be heard by somebody else.

The Ear and Hearing-

- The main function of the ear is to detect sound. It collects the energy of vibrating air and
changes it into electrical signals, which are sent to the brain. Each ear has three main parts
— the outer ear, the middle ear and the inner ear.

1. Semicircular canals-
- These three tubes have nothing to do with hearing. They control your sense of balance.
When you move, fluid in the tubes flows past cells that sense the movement. These cells
send signals to the brain. The signals tell you when you are moving and whether you are up,
down or on your side. When you move around in circles quickly, the fluid moves quickly —
even for a while after you stop. The messages from the cells in the semicircular canals tell
your brain that you are still moving. However, the messages from your eyes tell the brain
that you are not moving. These mixed messages to the brain make you feel dizzy.

2. Middle ear-
- The middle ear contains the three smallest bones in the body. Together, they are known as
the ossicles. These tiny bones send vibrations from the eardrum to the inner ear. They also
make the vibrations larger. One of the ossicles (the stirrup) presses against a thin layer of
skin called the oval window at the entrance to the inner ear.

3. Auricle-
- The outside part of the ear contains a spongy type of tissue called cartilage.

4. Outer ear-
- The outer ear collects the energy of the vibrating air and funnels it along the ear canal. The
air along the ear canal vibrates. That makes the eardrum vibrate. High-pitched sounds make
the eardrum vibrate quickly. Low-pitched sounds make the eardrum vibrate slowly.
5. Ear canal-
-The ear canal contains wax and tiny hairs to trap dust so that it doesn't get to the eardrum.
If the wax builds up enough to block your ear canal, a doctor can remove it.

6. Inner ear-
-The inner ear is filled with fluid. The vibrations are passed along the fluid into a snail-
shaped tube called the cochlea. The inside of the cochlea is lined with millions of tiny hairs.
Each hair is attached to a nerve receptor. When the fluid vibrates, the hairs move. The
receptors change the energy of the moving hairs into electrical energy and send signals
through the auditory nerve to the brain. You interpret those signals as sound.

7. Auditory nerve-
-Nerves from the receptors in the cochlea merge to form this large nerve that sends signals
to the brain.

8. Eustachian tube-
- This tube joins the middle ear to the nose and throat. It is usually closed. When the air
pressure on the eardrum is not the same on both sides, the tube opens. Air then moves
either into or out of the middle ear until the pressure is balanced again.

- When the air pressure on one side of the eardrum changes quickly, you can feel a ‘pop’ as
the Eustachian tube opens and air rushes through it. This happens when you are in a plane
that is climbing steeply. The air pressure in the plane becomes less than the air pressure in
your middle ear. The Eustachian tube then opens and some air moves from the middle ear
to the nose and throat so that the air pressure on your eardrum is balanced.

Light-

- Visible white is white light. It consists of all wavelengths of light. From 4x10 14 Hz (red) to
7x12014 Hz (violet).

- Consists of different colours of the rainbow:

 Red --- longest wavelength
 Orange
 Yellow
 Green
 Blue
 Indigo
 Violet --- shortest wavelength

- Black absorbs all visible wavelengths

- White reflects all wavelengths of white
- Yellow absorbs all colours but reflects yellow

- Travels in straight lines. Does not bend or go around corners  how shadows are made.
- The transverse waves created in a slinky or in water are easily seen because the medium
through which the wave travels is visible. Light is an example of an electromagnetic wave.
Like water waves, electromagnetic waves are also transverse but they are not quite so easily
seen.

- Like all waves, electromagnetic waves transfer energy from one place to another. All
electromagnetic waves travel through air at 300 000 kilometres per second. Unlike sound
waves and water waves, electromagnetic waves can travel through a vacuum.

Differences Between Sound and Electromagnetic Waves

Sound Waves Electromagnetic Waves
- Compression (longitudinal) waves. - Transverse waves.
- Travel through all solids, liquids and gases, - Able to travel through most substances
but are unable to travel through a vacuum. including through a vacuum.
- Speed in air between about 330 m/s and - Speed in the air about 300000 km/s
350m/s, depending on temperature.

Reflection-

- Reflection of light can occur off an object e.g. mirror.

- A ray of light strikes an object and it is reflected. If it is a flat object it reflects as in the
diagram.

Diagram 1-
Diagram 2-

- Windows are transparent, solids are opaque, and translucent is in between. An example is
frosted windows in a bathroom. “Some surfaces allow just enough light to travel through to
allow objects to be detected on the other side, but they scatter so much light that the
objects are not clearly visible.”

Refraction-

Diagram 1-
Diagram 2-

- Refraction is the bending of light. Light bends because it travels at different speed in
different mediums. When light travels through a transparent substance and into another, it
refracts or bends when it moves into the new medium. Light refracts (bends) towards the
optically denser substance.

- Concave lenses diverge light rays

Converging lenses converge light rays.

- Light reflecting and refracting allows the human eye to see beams of lights. For example, a
red table will absorb all other colours and reflect red, making it appear red.

- When light travels through a transparent surface the light passes through the object and
the object can be clearly seen on the other side.

- When light travels through a translucent surface, only just enough light travels through the
object to allow objects to be detected on the other side, but the surface scatters so much
light that the objects are not clearly visible.

- When light travels through an opaque surface that light is absorbed by the surface,
allowing no light to pass through. However, it is shiny, the light is reflected, like a mirror.

Reflections-
- In one side of a shiny spoon you look the right way up, in the other side you look upside
down. Each side of the spoon acts like a mirror. Like all mirrors, it forms an image because of
the way in which it reflects rays of light.

The Law of Reflection-

- A ray of light striking a mirror is reflected as shown in the diagram. The line drawn at right
angles to the mirror is called normal, and it is from that line that the angles of the ray
striking and leaving the mirror are usually measured. When a ray of light is reflected: the
angle of incidence is equal to the angle of reflection: the ray us reflected from the mirror art
the same angle as it arrives.

- The fact that the rays all lie in the same plane means that they can be drawn on one flat
piece of paper.

Images in Flat Mirrors-

- The diagram shows rays of light leaving a lamp and being reflected from the surface of a
flat mirror. Thousands of rays leave each point of the lamp but for simplicity, only the rays
that enter the eye from a single point on the lamp have been drawn.

- The rays seem to come from a position as far behind the mirror as the lamp is in front: this
is where an image of the lamp is seen. The image is described as a virtual image rays as they
seem to come from behind the mirror though none actually pass through it.
The Periscope-

- The sailor in the submarine is using an instrument called a periscope to look at the ship on
the surface of the water. In the periscope two fat mirrors reflect light rays from the ship
down to the sailor. The sailor sees an image of the ship straight ahead.

Convex Mirrors-

- The surface of a convex mirror bulges outwards. Like a flat mirror a convex mirror forms a
virtual image of any object placed in front of it. However, the image seen in a convex mirror
is smaller than the object.
Concave Mirrors-

- The surface of a concave mirror curves inwards. The type of image formed by the mirror
depends on whether an object is placed close to the mirror or a long way from it.

Close Objects-

- When an object is placed just in front of a concave mirror, the virtual mirror seen in the
mirror is larger than the object. This magnifying effect makes a concave mirror very useful as
a shaving or make-up mirror.
Distance Objects-

- When rays of light from a distance are reflected they come to a focus; they converge
(come together) to form a small upside down image that can be picked up on a screen. This
image is described as a real image: the rays of light actually meet to form the image.

- The diagram below shows a few of the rays leaving one point on a distance object. the
complete image on the screen is formed by thousands of rays that leave each single point
on the object.

- Light rays from a very distant object are very nearly parallel to each other. A concave
mirror lets parallel rays of light to a focus at a point know as the principal focus. The
distance between the mirror and its principal focus is known as the focal length. Heavily
curved mirrors have short focal lengths.
Electricity-

- Form of energy
- Charged particles (electrons negative  around the outside of a particle)
- The flow of electrons through a competed circuit
- Conducting materials (metals  copper is a great conductor)

Components Symbol Function

Switch The purpose of a switch in
a series circuit is to make
it easy to open or close
the electrical circuit,
turning the flow of
electricity on or off.

Light bulb A light bulb in a series

circuit is used to
determine whether or not
electricity is flowing.
Power source (battery) The purpose of the battery
in a series circuit is to give
the circuit a source of
energy.
Wires The purpose of the wires
in a series circuit is to
allow the electricity to
flow from one device to
the next. Wire is used to
carry the flow of
electrons. Metal wire is a
very good conductor.
Materials that do not
allow electricity to flow
through are called
insulators or non-
conductors.
Ammeter An ammeter is an
instrument used for
measuring electric current
in units of amperes.
Voltmeter A voltmeter is an
instrument used for
measuring electrical
potential difference
between two points in an
 electric circuit.
Resistor The main function of
resistors in a circuit is to
control the flow of current
to other components. A
resistor is used to limit the
current.

Series and Parallel Circuits-

Circuit-
Series-

Parallel-

- The current decreased when more globes were added in series. As more globes were
added, more resistance was added, therefore the current decreased. Adding globes made
the series duller as the same amount of electricity spread over more globes.

- Adding globes in parallel made no difference to their brightness as the electricity had a
choice where to go and did not have to go through all of the globes.
 Series Parallel
Features - All on the same wire - Uses a lot more wires
- Cheaper - More extensive
Everyday example - Christmas tree lights - House lights
Analogy - marathon runners and - marathon runners and
then a one person bridge there are multiple bridges.
everyone slows down

Ohm’s Law-

- Resistance is measured in ohms and is represented by the symbol R. The resistance of a

component cannot be measured directly. It can only be calculated after measuring both
voltage and current- the voltage (V) (potential difference) needed to push current (I)
through the component. Resistance is calculated using the following equation.

R (ohms) = V (volts) / IM (amps)

V=RxI
I=V/R
R=V/I

- This relationship between current, voltage and resistance is known as Ohm’s law. It is
named after the German scientist Georg Simon Ohm (1787 – 1854) who discovered it.

- if we have a graph showing the relationship between the voltage across a resistor and the
current flowing through it then, by Ohm’s law, the resistance of the resistor is equal to the
gradient of the graph. Resistance is measured in ohms (symbol Ω).
- A close relationship exists between the voltage, current and resistance of a circuit. If you
increase the voltage supplied to a circuit, the current through it will increase. If you increase
the resistance of a circuit, the current will drop. For components that obey Ohm’s Law, a
line graph of voltage plotted against current produces as straight line. This is shown in the
diagram.

This close relationship can be summarised by Ohm’s Law, which states:

voltage = current x resistance

Or

V=CxR

Where: V = voltage (measured in volts)

I = current (measured in amperes)
R = resistance (measured in ohms)
Fuses-

- The purpose of a fuse in a circuit is to stop the flow of electricity so the current doesn't
blow and burst household appliances such as toasters, fridges or lights therefore enabling
safer household or working environment.

- The light darkened or began to turn off when a shorter circuit was introduced. The wire
began to burn and heat up so much that it turned red and orange.

- When a thicker fuse was used, the light became brighter and turned on. The fuse took
longer to short circuit (burn).

Definitions-

Electrical Plug- A plug is defined as the end piece of a cord for an electrical device with
prongs that fit into a wall socket. An example of a plug is what connects a laptop to a wall to
recharge its battery.

Socket- A socket is an electrical device receiving a plug or light bulb to make a connection.

Active Wire- The active wire carries current to the appliance at a high voltage.

Neutral Wire- The neutral wire completes the circuit and carries current away from the
appliance.

Earth Wire- The third wire, called the earth wire (green/yellow) is a safety wire and connects
the metal case of the appliance to the earth.

Fuse- A fuse is a safety device consisting of a strip of wire that melts and breaks an electric
circuit if the current exceeds a safe level.

Circuit breakers- A circuit breaker is an automatic device for stopping the flow of current in
an electric circuit as a safety measure.

Safety Switches- A safety switch is a device that quickly switches off the electricity supply if
an electrical fault is detected, to minimise the risk of electricity-related fires, electric shock,
injury and death.

Electricity-

- Discovered by Luigi Galvani in 1791, electricity exists because electrons exist. By

themselves, a build-up of electrons causes static electricity – electricity which does not flow.
If electrons are slowed to flow through wire we have dynamic electricity – a flow of eclectic
current.
- To acquire and use electrical energy we need a source of electrons – a power source, a
battery or a generator. The power source provides a source of electrons directly (a batter),
or builds up a temporary source while it is switched on (a generator). Both provide an
electromagnetic force (or EMF) which is needed to move electrons through wires. The EMF
is often called a voltage or the potential (energy) difference of the power source. It is
measured in volts, symbol v, using a voltmeter.

- In our homes we use electricity generated at power stations. In the laboratory we use
batteries r the ‘power source’ that changes the dangerous 240-volt electricity from the
power points in the laboratory to safe 1.5 to 12 volts. On setting A, the power pack delivers
about 1.5 V to a circuit.

- Electrical conductors (wires) are needed to carry the electrical from the power source to
wherever it is needed. All metals are conductors of electricity. Substances which do not
conduct electricity are called electrical insulators. All non-metallic substances (except
carbon) are insulators of electricity.

- A flow of electrons through wires is called an electric electric current. We measure electric
current in amperes (or amps for shot), symbol A, using an ammeter.

- A switch is needed to control when the electricity flows. A switch can be open (no current)
or closed (current flows).

- Electrical energy can be changed into the form of energy we want. The most common and
most simple device to do this is a resistor. Resistors change electrical energy into heat and
light energy in appliances like light globes, electric jugs, hot water systems, radiators and
toasters. The higher the resistance of the resistor, the more electrical energy it converts into
other forms, resistance is measured in ohms, symbol Ω.

- When all these components are joined together, we have a simple electric circuit like the
one shown below, in circuits, electrons flow from the negative terminal, through the circuit,
to the positive battery terminal.

LED Lights-

- LED stands for a light-emitting diode. A light-emitting diode (LED) is a two-lead

semiconductor light source. It is a p–n junction diode that emits light when activated. When
a suitable voltage is applied to the leads, electrons are able to recombine with electron
holes within the device, releasing energy in the form of photons.

- LEDs are mostly used for two things: illumination and indication. Illumination means to
"shine light onto something" - like a flashlight or headlights. Indication mean to "point
something out" - like a turn signal or brake lights on a car.

- An ENERGY STAR-qualified LED bulb will last as much as 25 times longer than a comparable
traditional incandescent bulb. LEDs have no filaments, no metal fatigue, no oxidation and no
evaporation of electrical components. Both ILBs and CFLs are fragile and have to be handled
like eggs. On the other hand LEDs are robust, very rugged, solid state devices with no glass
to break. However, LEDs will stop working if placed next to an atomic explosion.
 Advantages Disadvantages
LED Lights Not only do LED holiday lights Disadvantages of using
consume less electricity, they traditional LEDs. High price:
also have the following LEDs are currently more
advantages: Safer: LEDs are expensive, price per lumen, on
much cooler than an initial capital cost basis,
incandescent lights, reducing than most conventional
the risk of combustion or lighting technologies. The
burnt fingers. Sturdier: LEDs additional expense partially
are made with epoxy lenses, stems from the relatively low
not glass, and are much more lumen output and the drive
resistant to breakage. circuitry and power supplies
needed.
Incandescent Lights - Good for lighting small -Not energy Efficient.
areas. -Not good for large areas.
- Cheap for the consumer. - Low lifespan compared to
- No toxic materials are other light bulbs.
present.
- Safe to handle.
- Fast on time.
- No flicker.

LED lights are ecofriendly as they are energy efficient, contain no toxic elements, less lights
are needed and the span is very large. LED lights are up to 80% more efficient than
traditional lighting such as fluorescent and incandescent lights. 95% of the energy in LEDs is
converted into light and only 5% is wasted as heat. This is compared to fluorescent lights
which convert 95% of energy to heat and only 5% into light. LED lights also draw much less
power than traditional lighting; a typical 84 watt fluorescent can be replaced by a 36 watt
LED to give the same level of light. Less energy use reduces the demand from power plants
and decreases greenhouse gas emissions. LED lights contain no toxic elements. Most offices
currently use fluorescent strip lights which contain noxious chemicals such as mercury. This
will contaminate the environment when disposed of in landfill waste. Disposal has to be
arranged through a registered waste carrier so switching to LED avoids the cost and time
implications required for compliant disposal – and helps to protect the environment from
further toxic waste. LEDs have a better quality of light distribution and focus light in one
direction as opposed to other types of lighting which waste energy by emitting light in all
directions, often illuminating areas where light isn’t required (such as the ceiling). This
means that less LED lights are needed to achieve the same level of brightness given off by
fluorescents and incandescent lights. Fewer lights will reduce energy consumption and will
therefore be a benefit to the environment. A longer life span means lower carbon
emissions. LED Lights last up to six times longer than other types of lights, reducing the
requirement for frequent replacements. This results in using fewer lights and hence fewer
resources are needed for manufacturing processes, packaging materials and transportation.
Therefore, LED lights are environmentally friendly.
World Traveller-

Disease-

- A disease is a condition that impairs, or has the potential to impair, the functioning of an
organism or any part of it.

Infectious disease-

- Infectious diseases are caused by pathogenic microorganisms, such as bacteria, viruses,

parasites or fungi; the diseases can be spread, directly or indirectly, from one person to
another. Zoonotic diseases are infectious diseases of animals that can cause disease when
transmitted to humans.

Non-infectious disease-

- Diseases that are not contagious are called non-infectious or non-communicable diseases
because they can't be spread from one person to another. So there's no vector for them to
move from one host to another, no virus, no bacteria, no pathogen. Instead, these diseases
are caused by other factors, such as genetics, environment, and lifestyle behaviours. Some
can be prevented, while others are completely out of your control. Many non-
communicable diseases are linked to our genes, such as autoimmune diseases. These are
diseases that cause the body to attack itself instead of simply fighting off foreign intruders.
Rheumatoid arthritis, multiple sclerosis, lupus, and celiac are all diseases that turn the body
on itself.

Schistosomiasis-

- Schistosomiasis, also known as bilharzia, is a disease caused by parasitic worms.

Symptoms - A rash, itchy skin, fever, chills, cough, headache, stomach pain, joint
pain and muscle aches are symptoms.

Can have no symptoms, but people may experience:

- Pain areas: In the abdomen, joints, or muscles
- Pain circumstances: Can occur during sexual intercourse or during
urination
- Gastrointestinal: Bloating, blood in stool, diarrhoea, or fluid in the
abdomen
- Whole body: Chills, fatigue, fever, or malaise
- Developmental: Learning disability or slow growth
- Urinary: Frequent urination or blood in urine
- Also common: Coughing, headache, infertility, itching, poor appetite,
skin rash, vaginal bleeding, or weight loss
Treatment - It is treatable by a medical professional, it requires a medical
 diagnosis, lab tests or imaging is always required and
a medication taken for one to two days can clear the infection.
Cause of - The fresh water becomes contaminated from infected animal or
Disease human urine or faeces. The parasites penetrate human skin to enter
the bloodstream and migrate to the liver, intestines and other organs.
Methods of - Boil drinking water- Bringing water to a rolling boil for 1 minute to kill
Prevention certain types of bacteria that cause disease.
Method of - The disease spreads through contaminated food or water.
Transmission

Spread of Infectious Diseases-

- Germs can spread through:

 The air as small droplets (droplet spread) or tiny aerosol particles (airborne spread)
 Contact with faeces (poo) and then with the mouth (faeco-oral spread)
 Contact with the skin or mucus membranes (the thin moist lining of many parts of
the body such as the nose, mouth and throat) (contact spread)
 Blood or other body fluids (for example, urine and saliva)
 Directly from person to person or
 Indirectly from an infected person to the environment (for example toys, door
handles, bench tops, bedding and toilets) and then to another person who comes in
contact with the contaminated environmental source.
 Though a vector such as mosquitoes. A vector is an organism that does not cause
disease itself but which spreads infection by conveying pathogens from one host to
another.

- The bite of infected mosquitoes is a major way by which infectious diseases can be spread
in many parts of the world. Potentially serious diseases which are spread by mosquitoes
include:
 Yellow Fever, which occurs in South America, Central America and Africa.
 Malaria, which occurs in Africa, Asia and South America and can be particularly
severe in people without previous exposure to the disease.
 Dengue Fever, which occurs in most urban centres in the tropics. Serious outbreaks
have occurred in Queensland when ill travellers have returned and infected local
mosquitoes.

- Rabies is a virus which can potentially infect any warm-blooded animal and is found in
most countries outside of Australia and New Zealand. It is spread through bites or scratches
from infected animals. The greatest risk is posed by the types of animals people interact
with commonly, such as dogs, but also includes monkeys, bats and rodents.

- Food-borne illness is a major cause of disease overseas and includes ‘traveller’s diarrhoea’
as well as more serious diseases such as hepatitis A or cholera. The sources of food-borne
illness are not always obvious. A glass of soft drink might be safe but the ice in the glass
could be made with contaminated water.
High risk foods include:

 Unpasteurised dairy products

 Ice
 Raw or minimally cooked meat or seafood
 Reheated food
 Salads
 Food which has been left exposed to flies
 Food prepared in premises with poor hygiene

Ross River Fever-

Symptoms-

 Painful and/or swollen joints (the most commonly affected joints are the wrists,
knees, ankles, fingers, elbows, shoulders and jaw). Pain usually develops quickly and
may be intense and more severe in different joints at different times. Joint pain is
much more common than swelling
 Sore muscles
 Aching tendons
 Skin rashes (although these tend to be more common to BFV disease)
 Fever
 Tiredness
 Headaches
 Swollen lymph nodes
 Sore eyes
 Sore throat
 Nausea
 Tingling in the palms of the hands or soles of the feet

- The method of transmission of the disease is by being bitten by an infected mosquito.

Ways to avoid being bitten by mosquito include:
 Use an effective repellent on exposed skin areas. Re-apply repellent every few hours,
according to the instructions, as protection wears off from perspiration, particularly
on hot nights or during exercise
 The best mosquito repellents contain diethyl toluamide (DEET) or picaridin. Botanical
based products (e.g. eucalyptus, citronella etc.) provide only limited periods of
protection
 Topical repellents are not recommended for use on children below the age of 3
months
 Note that prolonged or excessive use of repellents can be dangerous, particularly on
babies and young children. Avoid putting repellent near eyes and mouth, spread
sparingly over the skin, and rinse off once you are indoors
 Provide mosquito netting, where necessary, both indoors and outdoors
 Cover up as much as possible with loose fitting clothing and sensible footwear. Avoid
tight clothes
  Cover your clothes with repellent as mosquitoes can bite through material but be
careful as some repellents stain clothes
 Use mosquito coils outdoors and vaporising mats indoors. Note that devices that use
light to attract and electrocute insects have not been proven to be effective in
reducing mosquito numbers
 When camping, use flyscreens on caravans and tents or sleep under mosquito nets.

Epidemiology-

- Epidemiology is the study of the patterns, causes, and effects of health and disease
conditions in defined populations. It can identify risk factors for disease and help with
preventive healthcare.

Disease Infectious or non infectious Cause

Bronchitis It is an infectious disease. Bronchitis can be caused by
viruses, bacteria, or
breathing in smoke or dust.
Chickenpox (varicella) It is an infectious disease. Varicella-zoster virus (VZV)
causes the chickenpox
infection. Most cases occur
through contact with an
infected person.
Conjunctivitis It is an infectious disease. Conjunctivitis can be caused
by; bacterial infection, viral
infection, allergy, irritants
such as dust or chemicals
and a foreign body.
Measles It is an infectious disease. Measles is caused by a virus
that is spread from person
to person through droplets
in the air.
Mumps It is an infectious disease. Mumps is caused by the
mumps virus, which belongs
to a family of viruses known
as 'paramyxoviruses'. It's
spread by close contact or
by coughing and sneezing.
Paramyxoviruses are a
common source of
infection, particularly in
children.
Scurvy It is a non-infectious Scurvy is caused by vitamin
disease. C deficiency
Anaemia It is a non-infectious Anaemia is caused by iron
disease. deficiency
 Red-green colour vision It is a non-infectious Red-green colour vision
deficiency disease. deficiency is an inherited
disorder.
Cancer It is a non-infectious A cancer happens when
disease. cells begin to divide out of
control. They form tumours
that can sometimes be felt
as an unusual lump in the
body. Diet and lifestyle can
increase the risk of
developing certain cancers.
For example; smoking
increases the risk of lung
cancer, using sunscreen
reduces the risk of skin
cancer and eating more fruit
and vegetables reduces the
risk of bowel cancer.
Diabetes It is a non-infectious Type one diabetes is a
disease. hereditary disease and type
two diabetes is caused by
lifestyle choices.

- Doctors diagnose an infectious disease by suspecting an infection based on the person's

symptoms, physical examination results, and risk factors. Then laboratory tests are done to
identify the specific microorganism causing the disease. It is important to know the cause of
the disease so the doctor can give the right treatment and medication that will be effective
for that specific cause of the disease.

- It is important to know the diseases at specific locations around the world so that when
you go travelling to that location who know what the common diseases are and how you
can prevent them. There are so many diseases in Asia as Asia provides an easy liveable
environment for these diseases, the quality of food and water is much lower than countries
like Australia and vaccinations and precautions for these diseases are less common.

Quarantine-

- A state, period, or place of isolation in which people or animals that have arrived from
elsewhere or been exposed to infectious or contagious disease are placed. Quarantine
precautions used in highly effected cities prevents people living in these areas from moving
to other parts of the country and potentially increasing EVD transmission. However, it also
means that barriers to travel limit their access to food and other necessities. While
preventing further transmission of EVD is crucial, it is essential that people in those zones
have access to food, water, good sanitation and other basic supplies. These precautions are
taken to them and limit the spread of the disease.

Natural Disasters-
- Five potential natural disasters that a person needs to be aware of when travelling are
earthquakes, floods, volcanic eruptions, tsunami and avalanches. The risk factors for
increased infectious diseases transmission and outbreaks are mainly associated with the
after-effects of the disasters rather than to the primary disaster itself or to the corpses of
those killed. These after-effects include displacement of populations (internally displaced
persons and refugees), environmental changes and increased vector breeding sites.
Unplanned and overcrowded shelters, poor water and sanitation conditions, poor
nutritional status or insufficient personal hygiene are often the case. Consequently, there
are low levels of immunity to vaccine-preventable diseases, or insufficient vaccination
coverage and limited access to health care services.

Direct Contact-

- Infectious diseases are often spread through direct contact. Types of direct contact
include:
 Person to person contact
 Droplet spread

Indirect Contact-

- Infectious diseases can also be spread indirectly through the air and other mechanisms. For
example:
 Airborne transmission
 Contaminated objects
 Food and drinking water
 Animal to person contact
 Animal reservoirs
 Insect bites
 Environmental reservoirs

Virus and Bacteria

Virus-

- A virus consists of a piece of DNA or RNA wrapped in a protein coat.

Bacteria-

- Bacteria are single-celled organisms whose DNA is not contained inside a membrane-
bound nucleus.

Bacteria Virus
 Size - 0.2–5 μm (micrometre) - 20–300 nm (nanometre)
bigger
Shape

rod shaped
circular
spiral
Method of Reproduction - Bacterial reproduction - Viruses cannot reproduce
most commonly occurs by a unless inside a host cell.
kind of cell division called
binary fission. Binary fission - Once attached to a host
involves the division of a cell, a virus injects its
single cell, which results in nucleic acid into the cell.
the formation of two cells The nucleic acid takes over
that are genetically the normal operation of the
identical. host cell and produces
multiple copies of the virus's
protein coat and nucleic
acid.

Examples - Scarlet fever, - AIDS, influenza (the flu),

meningococcal meningitis, hepatitis, SARS, measles
impetigo, tuberculosis,
leprosy, some throat and
middle ear infections

Types of Infectious Causes-

 Bacteria - Bacteria are single-celled organisms whose DNA is not contained inside a
membrane-bound nucleus.
 Virus - A virus consists of a piece of DNA or RNA wrapped in a protein coat. Viruses
cannot reproduce unless inside a host cell.
 Protozoans - Protozoans are single-celled organisms whose DNA is inside a
membrane bound nucleus.
 Fungi - Fungi are made up of one or more cells that have a cell wall, true nucleus and
no chloroplasts.
 Macroparasites - Macroparasites can be seen without a microscope.
 Prions - Prions are thought to be incorrectly folded proteins.

Different Shapes of Bacteria-

Rod-shaped bacteria of called Bacilli and examples of a diseases caused by it are:
 Tetanus
 Anthrax
 Tuberculosis
 Bubonic plague
 Typhoid
 Leprosy
 Whooping cough
 Diphtheria
 Salmonella

Round-shaped bacteria are called cocci and examples are:

 Gonorrhoea
 Blood poisoning
 Boils
 Dysentery
 Tonsillitis
 Scarlet fever
 Pneumonia
 Sore throat

Spiral-shaped bacteria are called spirilla and examples are:

 Cholera
 Meningitis

- You should avoid food that has been left in a warm area as it provides the right conditions
for salmonella to grow rapidly. Some bacteria called botulism can survive in sealed
containers as their do not need oxygen.

- Bacteria is becoming resistant to antibiotics as they have been exposed to the antibiotic
and survived being killed by it. This means that they are genetically different from the
bacteria that have been killed by the antibiotic they have then reproduced and passed their
genes and resistance on to their offspring. (natural selection).

Syphilis Gonorrhoea Cholera

Transmission - It is passed on - The disease is passed - For the first 7-14 days,
of the through sexual contact on by sexual contact. An the infection is passed on
 Disease with has person who infected woman can through faeces, which can
has that disease. pass the disease onto be found in food and
her baby at birth. water. The bacteria can
survive on food for up to
five days, and resist
freezing.
Signs and - Some people do not - Some people have no - Some people have no
Symptoms know they have the signs or symptoms. In signs or symptoms. Others
disease. Others, some males, a yellow experience vomiting and
painless sores appear discharge occurs from large amounts of watery
at the site of infection.the penis and urinating diarrhoea, which can lead
These disappear in 4 is painful. In women, a to severe dehydration.
weeks. Without discharge may occur
treatment, the disease from the vagina and
develops into a body urinating is painful. If
rash, fever, hair loss left untreated it can
and tiredness. spread to the heart,
joints and brain and can
cause infertility.
Prevention/ - Safe sex practices can - Safe sex practices can - A person can be given
Treatment prevent this disease, prevent this disease, antibiotics and fluids. There
antibiotics such as antibiotics can cure it. is a vaccine.
penicillin can cure it.

Food Borne Pathogens-

- Foodborne illness (also foodborne disease and colloquially referred to as food poisoning) is
any illness resulting from the food spoilage of contaminated food, pathogenic bacteria,
viruses, or parasites that contaminate food, as well as toxins such as poisonous mushrooms
and various species of beans that have not been checked or cooked properly. Examples of
diseases that are food borne pathogens are:
 E.Coli - Diarrhoea (often bloody), abdominal cramps
 Salmonella - Headache, fever, abdominal cramps, diarrhoea, vomiting and nausea

They cause food poisoning through:

 Salmonella - Undercooked poultry, raw egg desserts and mayonnaise, sprouts, tahini
 E. coli - properly cooked beef, unpasteurised milk and juice, sprouts and
contaminated water

Microorganisms that cause disease:

 Microbe Type of pathogen. Picture Size of microbe (um)
Name (Bacteria, Virus, Fungi,
Protozoa, Algae)

Rhinovirus Virus 30 nanometers

Varicella Virus From just above

zoster 124,000 bp to more
than 126,000 bp

Rubella Virus From 40 nm

(nanometres) to 80 nm

Bordetella Bacteria Approximately 0.8 μm

pertussis by 0.4 μm

Yersinia pestis Bacteria 0.5-0.8 µm in width

and 1-3 µm in length

Bacteria-

- Binary fission (division in half), asexual reproduction by a separation of the body into two
new bodies. In the process of binary fission, an organism duplicates its genetic material, or
deoxyribonucleic acid (DNA), and then divides into two parts (cytokinesis), with each new
organism receiving one copy of DNA.
Types of Bacteria-
Putting up Defences-

- Microbes and other disease-causing organisms are everywhere. It's a wonder we don't get
sick all the time. Fortunately our bodies are quite good at fighting diseases.

1. Lachrymal glands near the eye produce tears to wash away dust, dirt, and foreign
particles.

2. The linings of the body openings, like the nose and throat, produce a sticky mucus to help
trap foreign particles.

3. The lymph nodes are lters or traps for foreign particles and contain white blood cells.

4. The stomach produces an acid that kills many microbes before they reach the intestines.

5. The skin is a surface barrier to most diseases.

6. Saliva produced by the salivary glands in the mouth contains substances to help resist and
remove microbes.
Lines of Defence-

- Pathogens or pathogenic agents can cause disease, preventing or stopping the body from
working well. A healthy body helps you to defend yourself against infectious diseases by
setting up natural barriers, or lines of defence. The first and second lines of defence are
described as being non-specific. They fight the same way for all infections, regardless of
whether they have encountered them before. The third line of defence is specific. It fights
differently for different types of invaders and may react differently if it has been exposed to
them before.

The First Line of Defence-

- Your body's first line of defence is designed to prevent the entry of invading pathogens.
Some of these defences are physical barriers (such as skin, coughing, sneezing, cilia and
nasal hairs) and others are chemical barriers (body fluids such as saliva, tears, stomach acid
and acidic vaginal mucus).

- The skin is very effective at keeping out germs. It is waterproof and, unless you have a cut,
microbes cannot pass through it. It is dry and slightly acidic; this prevents the growth of
many bacteria and fungi on the skin. If your skin does become cut, the hole is very quickly
patched up. A blood clot forms to seal the cut, then a scab forms and eventually the skin
heals.

- The parts of the body not covered by skin, including the inside of the mouth, nose, throat
and vagina are covered with mucous membranes. As the name indicates, these surfaces
produce mucus in which microbes become trapped. In the respiratory system there are also
small hairs called cilia that beat and sweep the mucus out of the body. Another way to get
the mucus out of the lungs is by coughing. This brings the mucus up to the mouth where it is
swallowed.

- The food we eat contains many microbes. A large number of these are killed by the
hydrochloric acid in our stomach. Unfortunately the acid does not kill all microbes, so you
can get very sick from eating food ridden with pathogens. Food such as undercooked meat
can contain very harmful bacteria.

The Second Line of Defence-

- Some pathogens manage to get past the first line of defence and enter the body. This is
where the second line of defence steps into action. Have you ever had a cut that became
infected, or an ear infection? The affected area becomes red, warm and swollen. This is a
sign of inflammation, which is part of the second line of defence. Blood flow to the affected
area is increased and the blood vessels become more permeable (they become more
‘leaky’). White blood cells are sent to the area and they move out of the blood vessels to the
site of infection. Some of these white blood cells are phagocytes. Phagocytes are white
blood cells that can engulf and destroy pathogens.
- Fever is also part of the second line of defence. Normal body temperature is about 37°C. A
temperature over 37.8°C is considered to be a fever and indicates an infection. A fever can
help your body fight an infection; in cases of a mild fever doctors may sometimes
recommend that you just wear light clothing, rest, drink plenty of water and monitor the
fever. If the fever rises to a very high temperature or lasts a long time it can be dangerous,
particularly in young children, and paracetamol or ibuprofen may be recommended.

Cholera-

- Cholera id a serious, infectious disease which can be fatal. It is caused by a bacteria called
the vibrio-cholerae bacteria (or vibrio for short). Cholera can become an epidemic in
Southeast Asia, India, Pakistan, and parts of Africa, killing thousands of people.

- The vibrio enters the body via the mouth, usually in contaminated water or food. When
the vibrio enters the intestine, it creates a toxin in the lining of the stomach. After 12 to 28m
hours, the disease starts with diarrhoea, followed by vomiting. This makes the patient very
dehydrated, as the body loses the fluids it needs for survival. The skin becomes cold, blood
pressure falls, the pulse becomes faint, and muscle cramps can become intense. If not
treated, the patient may fall into a coma and die. Chorea runs its course in 2 to 7 days.

- Cholera is treated by preventing dehydration. The quickest way to rehydrate a patient is to

give them an alkaline solution of sodium chloride (salt). Antibiotics can be administered to
lessen the diarrhoea.

- Recently, scientists have discovered that vibrio-cholera bacteria live in the sea. They are
eaten by tiny plankton called copepods, and they infect drinking water. There is a simple
way to remove through a folded sari removes up to 90% of infected copepods.

- The only way to prevent cholera is to ensure that the water supply is clean and free from
bacteria. In developing countries, safe drinking water is a major priority, however there is
not enough money to solve this problem quickly. Developed countries like Australia can help
in the prevention of cholera by donating money to overseas aid organisations.