Epigenetic mechanisms, chromatin dynamics and cancer

Eric Van Dyck, PhD

DNA Repair and Chemoresistance Group

Department of Cancer Research
Luxembourg Institute of Health
OUTLINE

The structure of chromatin and its regulation

- The nature of the DNA double helix

- Genetics vs epigenetics
- Histone modifications
- Eu- versus heterochromatin
- DNA methylation
- Non-coding RNAs
- Chromatin remodeling factors

Methods for epigenetics studies

- antibodies and their applications

- DNA methylation analysis

Functional consequences of chromatin regulation – importance of epigenetic mechanisms

- DNA repair/maintenance of chromatin structure/genetic stability

- cancer and epigenetics
- epigenetic drugs
The nature of DNA double helix 4 bases
2 purines 2 pyrimidines
Adenine Thymine
Base pairing
Guanine Cytosine

Hydrogen bonds

Sugar phosphate backbone

Sugar (deoxyribose)
Phosphodiester bond

2 strands of
opposite polarity
UV radiations cause mutations in the sequence of our DNA
 UV radiations affect the primary structure of our DNA

B-DNA
(normal helical structure)
CPD 6-4PP

Block transcription
Block replication
Cause mutations
cyclobutane pyrimidine dimers (CPDs),
pyrimidine 6-4 pyrimidone photoproducts (6-4PPs)
Our DNA can undergo multiple types of lesions
Mutations affect the sequence of our DNA

WILD-TYPE (normal) GENE MUTANT GENE

Genetic code
(DNA->RNA->protein)

no protein

Normal protein Abnormal protein

Phenotype (disease, cancer)

Genetic changes affect the actual DNA sequence and can be heritable

Xeroderma Pigmentosum (XP)

familial, cancer-prone environment/lifestyle

DNA repair syndromes -induced mutations

Germline mutations Somatic mutations

are heritable occur in non-germline cells
 Clonal inheritance of changes in gene expression can
occur without any changes in DNA sequence :
Epigenetics
Position-Effect Variegation (PEV) in Drosophila
(Muller 1930)

genetic epigenetic
mutation change

mosaic gene silencing: a subset of cells

within the developing eye do not express
the white gene

X-ray-induced chromosomal rearrangements

Position-effect variegation (PEV): a gene normally in “euchromatin” is now juxtaposed

with “heterochromatin”, which causes its transcriptional silencing.

Epigenetic events regulate the activities of genes without changing the DNA sequence
Girton & Johansen (2008) Advances in Genetics, 61, 1-43
Elgin (2013) Cold Spring Harb Perspect Biol, 5:a017780
Su(var) and E(Var) mutations

Genetic studies in Drosophila have led to

the identification of nuclear mutations
that modify the PEV phenotype:

Single gene suppressor (Su(var)) or enhancer (E(var)) mutations were isolated

> identification of proteins that play a crucial

role in the structure and regulation of
chromatin: heterochromatin components,
enzymes that modify histones or non-histones
chromatin proteins, nuclear architectural
proteins

Examples:

Su(var) 3-9 is a H3K9 methyltransferase

Su(var) 205 is the heterochromatin associated
protein HP1

Schulze & Wallrat (2007) Ann. Rev. Entomol., 52, 171-192

Chromatin defines the context of epigenetic changes by
regulating the cellular function of DNA sequences

Different chromatin states dictate gene expression/repression

Epigenetic events shape the outcome of the genome

(Epigenetics book 1st edition, Allis CD et al)

12
The DNA double helix
Human DNA (diploid cell) : 2 m of DNA !

5’

3’

5’ DNA is negatively charged

3’
DNA condensation is required for its packing into the nucleus

Each human cell contains approximately 2 meters of

DNA if stretched end-to-end
5’

3’

The nucleus of a human cell, which contains the

DNA, is only about 5-10 μm in diameter.

5’
3’ This is equivalent to packing 40 km of extremely fine
thread into a tennis ball!
DNA, nucleosomes and chromatin

within nucleosomes, histones positive charges screen

about 50% of the negative charges of DNA

Histones have evolved as highly basic proteins https://doi.org/10.1016/j.ceb.2019.02.003

to allow the compaction of the highly acidic DNA molecule.
DNA compaction

DNA
Double helix

chromatin

nucleosomes
DNA compaction: nucleosome and chromatin

nucleosomes 30 nm fiber

https://www.nature.com/scitable/topicpage/dna-packaging-nucleosomes-and-chromatin-310/
Epigenetic marks and determinants of chromatin structure

5’-CpG-3’
NH2
3’-GpC-5’
C CH3
DNA
N C
methylation
C C
O N
methyl-cytosine

DNA

dsRNA ssRNA
RNA
RNA-mediated
E regulation
small RNAs

Ac
nucleosome Ac Me Me
P Me Ac Me
AcMeMe
Ac Ac Me PMe
P H4 H3 S K K S KK K R

H2B H2A histone

Ac
Ub Ub Ac modifications

chromosome
histone
variants
 epigenetic marks
histone/DNA modifying enzymes
chromatin associated complexes

chromatin
states

transcription
DNA stability, repair, replication and recombination
The structure of chromatin and its regulation

-Concepts

- histone modifications, histone variants

- Eu- versus heterochromatin
- DNA methylation
- non-coding RNAs
- chromatin remodeling factors

Reviews:

Bannister and Kouzarides (2011) Cell Research 21,381-395

Taverna et al (2007) Nature Structural and Molecular Biology. 14, 1025-1040
 Nucleosomes: the basic unit of chromatin

DNA

nucleosome

chromosome

H3-tail

H3
H4
H2A
H2B

10 nm 5 nm
Luger et al. (1997) Nature
 Nucleosomes: the basic unit of chromatin

Digestion of chromatin with micrococcal nuclease

(Mnase: endo-exonuclease from S. Aureus)

 Release of nucleosomes

High-salt extraction

 Release of DNA (146 bp)

 Dissociation of histones

Molecular Biology of the Cell (B. Alberts)

Histones and nucleosomes
There are 4 canonical histones

The histone fold domain enables histones to

dimerize in specific antiparallel pairs

handshake interaction
between 2 histone fold domains
Molecular Biology of the Cell. 4th edition. Alberts
B, et al. New York: Garland Science; 2002.
Histone chaperones mediate the assembly and disassembly of nucleosomes

Step-wise assembly process

Histone variants and specialized nucleosomes

Histone variants replace canonical histones to carry out specialized

roles in replication, repair, transcription and heterochromatin
formation, which are distinct from those of the major core histones.

/repression

Canonical histones are assembled into nucleosomes behind the replication fork to
package newly synthesized DNA.

In contrast, histone variants are typically incorporated throughout the cell cycle.
Nature Reviews Molecular Cell Biology volume 18, pages 115–126 (2017)
 Histone 3 variants and their chaperones are mutated
or altered in several types of cancer

Alterations in H3 variants define subsets

of pediatric high-grade gliomas

Current Opinion in Genetics &

Development 2016, 37:82–89

Chris Jones et al., Neuro Oncology 2017

26
Free-moving, 3’ terminal tails of histones protrude from their nucleosomes

Wolffe & Hayes, NAR 1999.

 Histone tail modifications and chromatin structure

histone N-terminal tails can undergo several types of modification:

acetylation, methylation, phosphorylation, ubiquitylation, sumoylation, ADP-ribosylation

histone code:
epigenetic writers/erasers – histone modifications – epigenetic readers

http://www.epigentek.com/catalog/histone-modification.php
Histone tail modifications and chromatin structure

histone N-terminal tails are highly basic and

can undergo several types of modifications:
acetylation
methylation
phosphorylation
ubiquitylation
sumoylation
ADP-ribosylation …..
Histone tail modifications: Nomenclature

Paro et al. (2021) Introduction to Epigenetics

Histone acetylation: Lysine acetylation

- highly dynamic process mediated by the opposite action of

two families of enzymes : histone acetyltransferases (HAT)
and histone deacetylases (HDAC)

-HATs use acetyl CoA as cofactor, for transfer of acetyl group

HAT
on e-amino group of lysine side chain

HDAC

acetylation => neutralization of the lysine’s positive charge,

which can potentially weaken the interaction between
histones and DNA
 Histone acetylation promotes open chromatin and gene activation

HATs have the ability to neutralize positive charges on histone

=> disrupting electrostatic interactions between histones and DNA

=> destabilizing nucleosomes, creating a more open chromatin and enhancing accessibility of a given
promoter to the basal transcriptional machinery

HATs function in numerous transcriptional co-activator

complexes

http://academic.brooklyn.cuny.edu/biology/bio4fv/page/molecular%20biology/dna-structure.html
 Histone deacetylation: HDAC

HDAC oppose the effects of HATs, reverse lysine acetylation and restore the positive charge of lysine

=> stabilization of local chromatin architecture : HDACs are predominantly transcriptional repressors

=> typically present in multiple distinct complexes, often regrouping several HDAC members
(HDAC1 and HDAC2 in NuRD, Sin3a, and Co-REST complexes)
Histone methylation : lysine and arginine methylation

process mediated by opposite action

of histone methyltransferases (HMT)
and histone demethylases (HDM)

methylation => no alteration of amino acid charge

level of complexity: mono-, di-, tri-methylation
Histone methylation marks can be activating or repressive

Methylated Arg H3 (17, 23) H4 (3) Activation

Methylated Lys H3 (4, 36, 79) Activation
H3 (9, 27) H4 (20) Repression
 Histone methylation and demethylation

- lysine methylation :
- most HKMT have SET domain
- HKMTs are relatively specific and modify their substrate to a specific degree (intrinsic property)

- arginine methylation:
-two types of enzymes : 11 members (PRMTs)

- demethylation mechanisms:
Phosphorylation of H2AX (g-H2AX) : an early event in DNA repair

H2A
H2AX
H2A-containing S139
H2AX-containing nucleosome ATM P ATR
nucleosome DNA-PKcs

transducing kinases (ATM, ATR, DNA-PK)

P P P P

g-H2AX foci in IR-treated cells

(JA Taylor)
Biological function of histone modifications

PROCESS WHICH HISTONE IS INVOLVED

DNA damage Phosphorylation of H2AX (S139)
Mitosis Phosphorylation of H3 (S10)
Development/differentiation Histone H2A, H2B, H3, H4
Chromatin structure/dynamics Acetylation/methylation of H3 and H4
Gene activation
Gene repression
Mode of action of histone tail modifications
Mode of action of histone modifications

1: Structural perturbations

> Acetylation and phosphorylation reduce the positive charge of histones, disrupting interaction between
histones and DNA

> Histone acetylations enriched at enhancer elements and gene promoters

> Histone ubiquitylation (76 aa) can also affect chromatin structure directly

> Small, neutral modifications such as methylation are unlikely to perturb chromatin structure directly
Mode of action of histone modifications : the histone code

2: Regulating the binding of chromatin factors/effectors

Epigenetic writers/erasers – histone modifications – epigenetic readers

Mode of action of histone modifications : the histone code

2: Regulating the binding of chromatin factors/effectors

Epigenetic writers/erasers – histone modifications – epigenetic readers

Modified histones act as dynamic binding platforms to recruit/repel specific chromatin-associated factors :

histone modification factors (HAT-HDAC-HMT-HDM -…)

DNA methylation building factors (DNMT – MeBP)

chromatin architecture factors (chromatin remodelers – chromatin assembly factors)

silencing factors (sequence-specific transcriptional silencers, co-repressors, …)

activators (transcriptional activators, transcription initiation complex, co-activators, ….)

(hetero) chromatin fundation factors (HP1, PolyComb group proteins, …)

Mode of action of histone modifications : the histone code

Epigenetic writers/erasers – histone modifications – epigenetic readers

Histones modifications are recognized by distinct protein modules in their readers

HP1 chromodomain
with H3K9me3

Taverna et al (2007) Nature Structural and Molecular Biology. 14, 1025-1040

10.1126/science.1069473
Acetylated lysines are bound by
bromodomains, which are often found in
HATs and chromatin remodelling
complexes that open chromatin Several protein domains can recognize lysine methylation
(even the same modified histone lysine) using a different
binding motif

Phosphorylation of H3S10 inhibits the

activity of JMJD2A (demethylase)
towards H3K9me3

Certain proteins can dimerize (HP1), leading to multivalent

chromatin binders and nucleosome crosslinking,
directly affecting chromatin condensation

Histone modifications can also block the interaction between

the histone and a chromatin factor:
H3K4me3 (activating mark) prevents binding of NuRD H3

(chromatin remodelling and HDAC repressor complex) HP1 H3

HP1
Fine tuning of chromatin structure and dynamics

cross-talk between histone modifications combination of binding sites on

histone modification readers
 Euchromatin and heterochromatin domains are morphologically distinct

Heterochromatin Euchromatin and Heterochromatin

(dark patches) nuclear envelope

The DNA in the nucleus exists in two

forms that reflect the level of
transcriptional activity of the cell.

Heterochromatin appears as small, darkly-

stained and irregular patches scattered
throughout the nucleus or accumulated at
the nuclear envelope. Corresponds to
silenced regions.

Euchromatin is dispersed and not readily

euchromatin stainable. Corresponds to regions of
osmium-tetroxide-fixed tissues active transcription.
interphase nucleus

http://medcell.med.yale.edu/histology/cell_lab/euchromatin_and_heterochromatin.php
 Heterochromatin and euchromatin
heterochromatin euchromatin

open, decondensed, fewer nucleosomes

condensed chromatin, rich in nucleosomes
 expressed chromatin (gene-rich regions)
Constitutive heterochromatin  in variable regions of the genome
in the same regions of the genome in all cells
(higly repetitive DNA sequences) - telomere

Facultative heterochromatin - interspersed

transposable elements
in variable regions of the genome, DNA repeats
contains genes that are differentially expressed
through development / cellular differentiation - centromere
and are otherwise silenced - pericentromere

transcriptionnally silent regions

(heterochromatinization)

chromosome
MNase digestion analysis of eu- and heterochromatin

euchromatin heterochromatin
context context
MNase

 more ordered nucleosome array in heterochromatin,

indicating that spacing of the nucleosomes in
heterochromatin is more regular

Elgin (2013) Cold Spring Harb Perspect Biol, 5:a017780

Heterochromatin and euchromatin are enriched and depleted
of certain histone modifications
Maintenance of repressive chromatin modifications through DNA
replication and their transmission through cell division

The maintenance of repressive histone post-translational modifications (PTMs) through DNA

replication by reader–writer coupling.
During replication, H3–H4 tetramers from pre-existing parental ‘old’ nucleosomes are randomly
recycled to either of the two newly synthesized DNA molecules. Consequently, the number of H3
histones bearing a PTM (e.g., H3K9me), on the two new DNA molecules will be reduced by half
compared with the parental DNA. Reader–writer coupling should enable propagation of the PTM from
old nucleosomes that retained the PTM to newly assembled nucleosomes, thereby replenishing PTM
levels and reinstating the full chromatin domain on both sister chromatids, ultimately allowing its
transmission to progeny cells.
NATURE REVIEWS | MOLECULAR CELL BIOLOGY: doi:10.1038/nrm.2017.119
 Constitutive heterochromatin

The DNA underlying constitutive heterochromatin is enriched in repetitive DNA

Repetitive sequences consist primarily of satellite DNA (simple, short tandem

repeats), transposons, and ribosomal DNA (rDNA).

Centromeres : tandem repeats of 177-bp a-satellite

Pericentromeres: different satellite subfamilies (i.e., HSATII, HSATIII, …)
Telomeres: TTAGGG repeats
Nucleoli: rDNA repeats (300-400x)
Transposons, endogenous retroviral elements etc

Annu. Rev. Cell Dev. Biol. 2018. 34:8.1–8.24

Constitutive heterochromatin

The chromatin at centromeres is composed of a-satellite DNA repeats

n
a-satellite monomer (171 bp)

Higher-order repeat (HOR) (1-3 kbp)

Human centromeres are characterized by the presence

of head-to-tail tandem arrays of a ∼171 bp AT-rich α-
satellite DNA

These tandem units are further organized into multimeric higher

order repeat (HOR) arrays that are repeated multiple times to
form a core centromeric region up to 5 Mb in size
Non-coding RNAs and the targeting of heterochromatin to nucleation sites

Heterochromatin regions are transcribed into non-coding RNAs

and these RNAs play a role in the establishement of heterochromatin itself

One function for pericentric satellite non-coding

RNAs is to organize an RNA-nucleosome scaffold as
the underlying structure of heterochromatin

H3K9me3 modifications and noncoding RNA

transcribed from pericentric satellite repeats work
together to promote the association of human
SUV39H1 with heterochromatin.

eLife 2017;6:e29503 doi: 10.7554/eLife.29503

Heterochromatin protein 1 a (HP1a), H3K9 methylation and heterochromatin

(191 aa)
 HP1 forms a symmetric dimer and bridges two H3K9me3 nucleosomes

H3K9me3
CD

me3H3K9
CD

Structure of the H3K9me3-containing

dinucleosome complexed with HP1,
obtained by the cryo-EM technique HP1 proteins associate with H3K9 methyl
marks using their N-terminal chromodomain
and self-associate through their C-terminal
https://doi.org/10.1016/j.molcel.2017.12.011
chromo shadow domain
Heterochromatin: spreading of H3K9 methylation and HP1
SUV39H1 (H3K9 methyl transferase)

Recruitment of H3K9
methyl transferase

The association of HP1 with histone H3K9

methyltransferase SUV39H1, coupled to
sequential cycles of modification/binding,
results in spreading of H3K9 methylation
and HP1 along nucleosomal DNA
Spreading of H3K9 methylation and HP1

HP1 serves as a platform for recruitment of other factors (HDAC, DNMT,

transcriptional silencers etc …) leading to formation of heterochromatic
domains that silence DNA transactions such as transcription

> how HP1 domains cluster together to form

nuclear foci and how silencing is achieved
are not fully understood. HP1a

HDAC
Ac DNA methylation
Me Me
Me
Facultative heterochromatin: the concept of heterochromatinization

Constitutive heterochromatin is found at and around centromeres and telomeres,

and other regions with underlying repetitive DNA

Facultative heterochromatin can be formed by heterochromatinization

of euchromatin, resulting in stable silencing of euchromatic genes

Heterochromatinization > heterochromatin-mediated gene silencing

regulatory mechanisms governing the activity of certain genes in euchromatin

can involve specific components associated with heterochromatin

Example: Repression of the cyclin E gene by retinoblastoma (Rb)

Facultative heterochromatin: Repression of cyclin E gene
by the transcriptional repressor retinoblastoma (Rb)

Rb
E2F
cyclin E

E2F binding elements

transcription factor E2F as a critical determinant of the G1/S-phase transition

during the cell cycle in mammalian cells, serving to activate the transcription
of a group of genes that encode proteins necessary for DNA replication.

E2F activity is directly regulated by the action of retinoblastoma protein (RB)

 Facultative heterochromatin: Repression of cyclin E gene
by the transcriptional repressor retinoblastoma (Rb)

 Rb recruits HDACs, SUV39H1 (H3K9 methyl transferase) and HP1

proteins to the promoter of cyclin E gene

 This « heterochromatinization » is a transient structure that is lost when

the cyclin E gene is activated as cell progress from G1 to S phase

Components of heterochromatin are utilized in a euchromatic

environment to regulate gene activity
Zhang et al (2000) Exit from G1 and S Phase of the Cell Cycle Is Regulated by Repressor Complexes Containing HDAC-Rb-hSWI/SNF
and Rb-hSWI/SNF. Cell 101, 79-89

Nielsen et al (2001) Rb targets histone H3 methylation and HP1 to promoters. Nature 412,561-565

Zhang Y , Reinberg D Genes Dev. 2001;15:2343-2360

 Distribution of histone modifications on active and silenced genes

Inactive genes :
H3K9me2/3

Actively transcribed genes :

H3K4me3 (promoter)

H3K36me3 (gene body)

(nucleosome-depleted region)
ChIP-seq analyses
Trends in Biochemical SciencesVol.35 No.11
 The RNA Polymerase II transcription cycle

Formation of the pre-initiation complex (PIC), which

includes Pol II and general transcription factors localized
to core promoter elements around the transcription start
site (TSS). On repressed genes, nucleosomes need to be
moved or evicted before PIC formation.

Initiation occurs when Pol II begins incorporating

nucleotides into the mRNA chain. Pol II is phosphorylated
near the TSS at serine 5 on its C-terminal domain (CTD).

However, Pol II often pauses and needs to undergo

pause release for full promoter clearance. Pause release
is accompanied by phosphorylation mediated by positive
transcription elongation factor b (P-TEFb) targeting the
Pol II CTD on serine 2.

This release allows transcription elongation, in which Pol

II proceeds through the gene body and generates the full-
length mRNA transcript with the help of elongation
factors.

The final stage of transcription is termination, in which the

mRNA is cleaved and polyadenylated (not shown), and
Pol II is released from the DNA template.

Trends in Biochemical Sciences, December 2017, Vol. 42, No. 12

 Histone modifications associated with active transcription

(nucleosome-depleted regions)

gene promoter gene body

Mark Function Mechanisms

H3K4me3 stimulates transcription, Recruitment of TFIID (TBP/TAF)
allows promoter recognition/PIC
H3K9ac mediates Pol II pause release, Recruitement of SEC
allows elongation by phosphorylated-Pol II (super elongation complex)
H3K79me2/3 stimulates elongation Unknown mechanisms
deposited in a co-transcriptional manner
H3K36me3 stimulates elongation Different recruitment mechanisms
deposited in a co-transcriptional manner Interplay with DNA methylation
prevents transcription arising from unwanted places
H3K9me2 transcription termination Recruitment of HP1g

Trends in Biochemical Sciences, December 2017, Vol. 42, No. 12

Histone modifications in the transcriptional dynamics of embryonic stem cells

Stem cells:

- ability to differentiate in any mature cell type

(pluripotency)

- divide to produce more stem cells

Active Motif’s Stem Cell Epigenetics Guide

Histone modifications in the transcriptional dynamics of embryonic stem cells

Polycomb and trithorax group proteins: antagonizing activities

The Polycomb and Trithorax groups of proteins, respectively, regulate lineage choices during
development and differentiation and work to maintain repressed, poised or active transcription states of
developmentally important genes through many rounds of cell division.

deposits active marks deposit repressive marks

removes repressive marks remove active marks

Konuma et al (2010) Develop. Growth Differ. , 52, 505–516

 Histone modifications in the transcriptional dynamics of embryonic stem cells

Polycomb and trithorax group proteins: «bivalent genes»

In both embryonic and adult stem cells, a large number of PcG-bound regions are decorated by both the
H3K27me3 repressive mark (PRC2) and the H3K4me3 activation mark (MLL2). Those modifications
contribute to set the promoter of genes implicated in cell-fate determination and development into a poised
bivalent state.

Such ‘‘bivalent promoters’’ are transcribed at very low levels and can be either activated or
repressed, depending on developmental signals. How the correct balance between PcG and MLL2
occupancy is regulated at bivalent regions is still unclear.

Development 140, 2525-2534 (2013) doi:10.1242/dev.091553

 The structure of chromatin and its regulation

-Concepts
- histone modifications
- Eu- vs Heterochromatin

- DNA methylation
- non-coding RNAs
- chromatin remodeling factors
readers

epigenetic writers/erasers – DNA methylation – epigenetic readers

Reviews:

Atwood et al (2002) CMLS Cell. Mol. Life Sci. 59, 241-257

Szyf (2009) Annu. Rev. Pharmacol. Toxicol. 49, 243–63
Cedar and Bergman (2009) Nature Reviews Genetics 10, 295-304
https://www.epigentek.com/catalog/dna-methylation-c-75_21.html
Chromatin structure: epigenetic marks

5’-CpG-3’
NH2
3’-GpC-5’
C CH3
DNA
N C
methylation
C C
O N
methyl-cytosine

DNA

nucleosome

chromosome
Cytosine DNA methylation, CpG dinucleotides and CpG islands

SAM-CH3: S’-adenosylmethionine

5’-CpG-3’
Sequence context: CpG dinucleotides
3’-GpC-5’

methylation of DNA occurs at the 5’ position of cytosine; about 4% of all

cytosines are methylated, but all are found in the context of CpG dinucleotides
Cytosine DNA methylation, CpG dinucleotides and CpG islands

> methylcytosine distribution is not random throughout the genome

• 80% of CpG dinucleotides are methylated: gene bodies

• some regions (1-2% of the genome) are refractory to methylation: CpG islands

CpG islands are regions with higher proportions of CpG sequences than the genome average

> CpG islands colocalize with the promoter region of active genes (promoter-TSS-exon 1)

• about 60% of all promoters colocalize with CpG islands

TSS

promoter CpG island gene body

Prediction of CpG islands
 Obs/exp CpG ratio

G+C frequency

GTGACTGGAGGAGGGGAACAGACTCAGAGGCTGGCCCTAGGTAGGAGGGGCAAGGGAGCG
ATCCGAGCCCCGTCCCCGCCCCTCGCATGCGCCTCTTTTTAAAAAAGCGCGGGCGTGCCT
TGCGCAGGCGCAATGCTGGGGCGAGGGTTAGCCGCGCAGGTGCGGTGAAGGGAGGATGGC
GGAGTTGGTACCTTTTGCGGTTCCCATCGAGAGTGACAAAACCTTGCTAGTGTGGGAGCT
GAGCTCCGGACCCACGGCCGAGGCTTTGCATGTGAGCCGGGGCCAGGATGGAGGGAGGGA
 DNA methyltransferases

NH2 NH2
HCH3 C CH3
C
N C DNMT N C sequence context
C C C C
O N SAM-CH3 SAM O N 5’-CpG-3’
CpG dinucleotides
cytosine 5’-methyl-cytosine 3’-GpC-5’

> De novo methylation:

De novo establishment of methylation pattern during development

3 enzymes : DNMT3a, DNMT3b and DNMT3c

> Maintenance DNA methylation:

Maintenance of established methylation patterns during replication

1 enzyme: DNMT1

DNA methylation patterns are transmitted with high fidelity

during DNA replication
Hemi-methylated DNA
Removal of methylcytosine
> DNA demethylation by oxidation & repair
TET family of Fe(II)- and aKG-dependent dioxygenases

hydroxymethyl-, formyl- and carboxylcytosine TET enzymes, TDG and the dynamics of DNA demethylation
Nature (2013) 502, 472–479: doi:10.1038/nature12750
 Promoter CpG island and gene body DNA methylation

gene bodies represent the most

frequent targets of DNA methylation

Intragenic methylation levels correlate with

transcriptional strength, indicating a link with
DNA methylation of promoters exerts a transcription elongation
repressive effect on transcription
initiation intragenic methylation restricts transcription
initiation to canonical TSSs, in concert with
DOI10.15252/embj.20179681
H3K36me3
https://doi.org/10.3892/or.2013.2913
Gene body DNA methylation collaborates with H3K36me3 to prevent
aberrant transcription

DOI 10.15252/embj.201796812
 DNA methylation patterns are tissue-specific and established during differentiation

https://doi.org/10.3892/or.2013.2913

M M M
M MM M

Many CGI promoters are protected from DNA methylation by transcription factor binding,
nucleosome exclusion and H3K4 methyltransferases (SETD1A, MLL)

Some repressed promoters acquire DNA methylation during development

« Different CG sites are methylated in different tissues, creating a pattern of methylation that is gene
and tissue-specific, helping create a layer of information that confers upon a genome its specific cell-type identity »
Szyf (2009) Annual Rev. Pharmacology and Toxicology
DNA methylation of tumor suppressor genes in cancer

CpG island hypermethylation

Inactivation of tumor suppressor genes global loss of gene body
DNA methylation

https://doi.org/10.3892/or.2013.2913
CpG DNA methylation and cancer

PBMC: peripheral blood mononuclear cell

E-cadherin expression is silenced by 5’CpG island methylation

in acute lymphocytic leukemia
Corn et al (2000) Clinical Cancer Research
E2
DNA methylation and transcriptional repression: mechanisms

M M M
M MM M

recruitment of methylcytosine
direct inhibition of binding proteins (MBPs)
transcription factor binding that promote transcriptional
repression

CpG promoter methylation

(AP-2, ATF/CREB, c-Myc) CpG promoter methylation
MBP binding
(MeCP2)

after Attwood et al (2002) CMLS Cell. Mol.Life Scie. 59, 241-257

DNA methylation and transcriptional repression: mechanisms

methylated DNA is bound by methylcytosine-binding proteins (MBPs)

NH2 MeDNA binding

proteins
C CH3
N C
C C
O N
methyl-cytosine

3 families of MBPs (MBD, Zn fingers, SRA)

MBPs interact with HDAC, DNMT, HMT, HP1,

histone modifications and co-repressor complexes

Bogdanovic (2009) Chromosoma. 118. 549-565

 The structure of chromatin and its regulation

-Concepts
-DNA/histone/nucleosome
- histone modifications
- Eu- and heterochromatin
- DNA methylation

- non-coding RNAs
- chromatin remodeling factors

Reviews:

Grewal & Jia (2007) Nature Rev. Genet. 8, 35–46

Djupedal & Ekwall (2009) Cell Research, 19, 282-295
Eymery et al. (2009) Int. J. Dev. Biol., 53, 259-268
Feuerhahn et al. (2010) FEBS Letter, 584, 3812-3818
Bonasio et al (2010) Science, 330, 612-616
Gibb et al. (2011) Molecular Cancer, 10, 38
Augui et al.(2011) Nature Reviews Genetics, 12, 429-442
Verdel et al (2009) Int. J. Dev. Biol., 53, 245-257
Esteller (2011) Nature Reviews Genetics 12, 861-874
Chromatin structure: epigenetic marks

5’-CpG-3’
NH2
3’-GpC-5’
C CH3
DNA
N C
methylation
C C
O N
methyl-cytosine

DNA

dsRNA ssRNA
RNA
RNA-mediated
E regulation
small RNAs

Ac
nucleosome Ac Me Me
P Me Ac Me
AcMeMe
Ac Ac Me PMe
P H4 H3 S K K S KK K R

H2B H2A histone

Ac
Ub Ub Ac modifications

chromosome
histone
variants
 Human non-coding RNAs

Gibb et al. (2011) Molecular Cancer 10, 38

Schonrock et al (2012) Circulation Research, 111, 1349
Non-coding repetitive RNAs in the assembly and maintenance
of heterochromatin and other DNA transactions

(hetero)chromatin regions transcription processing

(peri)centromeres mechanisms mechanisms

other satellite DNAs

telomeres non-coding RNAs serve as
DNA repeats transcripts scaffold for the recruitment of silencing
intergenic regions (rDNA) non-coding RNA machinery & histone modification complexes
XIC (X-inactivation Center)
ICR (imprinting control region) other functions in DNA transactions
size, nature, abundance
etc …. (DNA repair, …..)

growth conditions
cell cycle
stress
environmental factors
differentiation
RNA-dependent heterochromatin formation

Heterochromatin Is transcribed

Given that much of the (peri)centromere and telomere is largely devoid of protein-coding
genes, the region was historically assumed to be transcriptionally silenced.

Within the last decade, emerging evidence has shown that centromeres are not only
transcribed, but that this transcription plays fundamental roles in the function and
maintenance of heterochromatin stability

RNAi-mediated epigenetic memory and its interplay with

histone modifications.
RNAi-based maintenance of pericentric heterochromatin in
Schizosaccharomyces pombe. Bidirectional transcription of
the pericentromeric repeats during S phase generates
transcripts that pair to form double-stranded RNAs. These
are acted on by Dicer to create short interfering RNAs that in
turn recruit the RNA-induced transcriptional silencing (RITS)
complex comprising Argonaute 2 (Ago2), Tas3 and Chp1.
This complex recruits the histone methyltransferase Clr4 to
create the H3K9me2 histone mark to reinitiate the
formation of pericentromeric heterochromatin.

https://doi.org/10.1016/j.tig.2011.11.005
Dosage compensation by X-chromosome inactivation in mammals : Xist RNA

In mammals, females have two copies of a large, gene-rich chromosome,

the X chromosome, whereas males have one X and a small, gene-poor Y.
The imbalance in expression of several hundred genes is lethal if not
dealt with by dosage compensation.
 Dosage compensation by X-chromosome inactivation in mammals : Xist RNA

Augui et al.(2011) Nature Reviews Genetics, 12, 429-442

RNA FISH in mouse embryonic stem cells. In undifferentiated cells, the
two X chromosomes are active, as shown here by biallelic expression of
the X-linked gene (AtrX). In these cells, Xist is expressed at a low level
and is hardly detectable. During differentiation, one of the two Xist
alleles is upregulated. Xist RNA coats the X chromosome from which it
is produced and triggers X-inactivation, which leads to the monoallelic
expression of X-linked genes such as AtrX in differentiated cells.

Histone variant macroH2A is incorporated on inactive X

X-chromosome inactivation (XCI) proceeds in a stepwise series of

chromatin modifications.
Wutz (2011) Nature Reviews Genetics, 12, 542-553

Campos & Reibnerg (2009) Ann.Rev. Genet.,43, 559-599

 The structure of chromatin and its regulation

-Concepts
-DNA/histone/nucleosome / Eu- and heterochromatin
- histone modifications
- DNA methylation
- non-coding RNAs

- chromatin remodeling factors

- DNA and RNA epigenetics

Reviews:

Clapier & Cairns (2009) Annu. Rev. Biochem. 78,273–304

Tang et al. (2011) Prog Biophys Mol Biol. 102, 122–128
Saganuma & Workman (2011) Annu. Rev. Biochem. 80, 473–99
ATP-dependent chromatin remodeling complexes

- specialized protein machinery able to restructure the nucleosome to make its DNA accessible during
transcription, replication and DNA repair
- ATP-dependent chromatin remodeling complexes recognize histone marks and work in concert with
histone-modifying enzymes

The different outcomes of chromatin remodeling

Tang et al. (2011) Prog Biophys Mol Biol. 102, 122–128, Clapier & Cairns (2009) Annu. Rev. Biochem. 78,273–304
ATP-dependent chromatin remodeling complexes

Four families: SWI/SNF family, the ISWI family, the NuRD family and the INO80 family

replacement of an octamer via ATP-dependent repositioning of nucleosomal DNA to enable

chromatin-remodeling enzymes the binding of a regulatory factor
Summary: epigenetic mechanisms that regulate chromatin structure

Hahn et al. (2010) J Appl Physiol 109, 232–242.

The structure of chromatin and its regulation

- Concepts
- DNA/histone/nucleosome /Eu- and heterochromatin
- DNA methylation
- histone modifications
- non-coding RNAs
- chromatin remodeling factors
- DNA and RNA epigenetics

Methods for epigenetics studies

- antibodies and their applications

- DNA methylation analysis

Functional consequences of chromatin regulation – importance of epigenetic mechanisms

- DNA repair/maintenance of chromatin structure/genetic stability

- cancer and epigenetics
- epigenetic drugs
 RNA epigenetics: Reversible m6A RNA methylation modulates

gene expression regulation

N6-methyladenosine (m6A) :

most prevalent internal modification in mRNAs and ncRNAs (lncRNAs)

>80% of all RNA base methylation
context consensus: A/G-A/G-m6A-C-U/A/C (RRACH)
m6A amounts to 0.1-0.4% of adenine in RNA
 Reversible m6A RNA methylation mediates
gene expression regulation

m6A is distributed in > 7000 mRNAs and >300 lncRNAs

For References Frye et al (2016) Nature Reviews Genetics 17, 365–372
Epigenetic readers of the m6A-RNA mark and mediated functions

RNA processing/splicing

translation

mRNA degradation
Epigenetic readers of the m6A-RNA mark and mediated functions

Jiang, X., et al. The role of m6A modification in the biological functions and diseases. Sig
Transduct Target Ther 6, 74 (2021). https://doi.org/10.1038/s41392-020-00450-x
The structure of chromatin and its regulation

- Concepts
- DNA/histone/nucleosome /Eu- and heterochromatin
- DNA methylation
- histone modifications
- non-coding RNAs
- chromatin remodeling factors

Methods for epigenetics studies

- antibodies and their applications

- DNA methylation analysis

Functional consequences of chromatin regulation – importance of epigenetic mechanisms

- DNA repair/maintenance of chromatin structure/genetic stability

- cancer and epigenetics
- epigenetic drugs
Tools and techniques for the study of epigenetics

Antibodies and their applications

Immunofluorescence (IF)

Immunoprecipitation (IP)

Chromatin immunoprecipitation (ChIP)

DNA methylation analysis

Immunofluorescence study using the anti-H3K9me3 antibody

H3K9Me3 DAPI

A B

NIH3T3 cells (mouse fibroblasts) were formaldehyde fixed, permeabilized with Triton® X-100
and blocked with PBS containing 2.5% BSA. (A) Cells were labeled with the anti-H3K9me3
antibody, followed by FITC-labeled goat anti-rabbit secondary antibody. (B) Nuclei were
stained using the DNA-specific stain DAPI.

The dense signals obtained with both probes characterize the distribution pattern of
H3K9me3, which is linked to the transcriptionally inactive, condensed pericentric
heterochromatin.

http://www.invitrogen.com/site/us/en/home/support/Research-Tools/Image-Gallery/Image-Detail.9561.html
Fluorescent protein fusions: imaging living cells
Fluorescent protein fusions: imaging living cells

Real-time recruitment of Nbs1 and Mdc1 to the microlaser-generated sites of DNA damage.
U-2-OS cells expressing Nbs1-2YFP or GFP-Mdc1 were mixed (1:1) and co-cultivated for 24 h. The YFP and
GFP signals were unmixed through the spectral analyser to discriminate the Nbs1- and Mdc1-expressing
cells. The cells were microirradiated with a laser beam along 0.5–1-m-wide tracks spanning the entire
nuclear diameter, and the redistribution of the respective fluorophore-tagged proteins was recorded by a
repeated scanning of the same field at 20 s intervals.

Lukas et al (2004) EMBO J., 23, 2674-2683

Fluorescent recovery after photobleaching (FRAP)

photobleaching recovery

Fig. 1. Fluorescence recovery after photobleaching (FRAP) and molecular

kinetics. (A) An example of FRAP experiment. A cell expressing a transcription
factor tagged with GFP was imaged using a confocal microscope. A small part of nucleus is bleached
(second panel, arrowhead) and the fluorescence in the bleached area recovers during the
observation period (for ∼1 s).
Because the bleaching irreversibly damages the GFP fluorophore, the recovery of fluorescence in
the bleached area depends on new fluorescent molecules diffusing from the unbleached area into
the bleached area.
(B) If all molecules are fixed, the intensity of the bleached area never recovers.
(C) If all molecules are free to diffuse, the fluorescence in the bleached area
quickly recovers almost to the original level; the diffusion rate can be determined
by analyzing the recovery curve.
(D) If both mobile and immobile fractions exist, the fluorescence recovers with diffusion kinetics
Kimura (2005) DNA Repair, 4, 939–950 but reach at a plateau at a level that reflects the size of mobile fractions.
Markedly slow movement of FoxA1 across the nucleus: A FRAP study

Markedly slow movement of FoxA1 across the

nucleus.
(A) Half-area FRAP assay of c-Myc. (Left) Quantification of
the fluorescence recoveries of c-Myc after bleaching
half the nuclear area. Average fluorescence intensities
in the bleached (blue circles) and unbleached (red
circles) region were plotted over time. Values are
averages from at least 10 cells. (Right) Fluorescent
images of c-Myc during the FRAP process.

(B) Half-area FRAP assay of FoxA1, as in A.

(C) The average fluorescence intensities of FoxA1 and c-

Myc in each area were quantified and plotted. (Blue
squares) Area 1; (red) area 2; (yellow) area 3; (green)
total bleached region.

(D) Different movement models for c-Myc and FoxA1.

(Left) c-Myc interaction with chromatin is less stable,
with more repeated association and dissociation
allowing more extensive diffusion in the
nucleoplasm. (Right) The higher chromatin affinity of
FoxA1 keeps it more closely associated with
chromatin, causing slower overall movement.

Sekiya T et al. (2009) Genes Dev. 23, 804-809

HALO tags: a Platform Technology for Protein Analysis

DOI:10.2174/1875397301206010072
HALO tags: a Platform Technology for Protein Analysis
Immunoprecipitation: detection-purification-analysis of a protein of interest

Immunoprecipitation for antigen detection and purification. An antibody (monoclonal or polyclonal) against a specific
target protein forms an immune complex with that target in a sample, such as a cell lysate. The immune complex is then
captured, or precipitated, on a beaded support to which an antibody-binding protein is immobilized (such as Protein A or
G), and any proteins not precipitated on the beads are washed away. Finally, the antigen is eluted from the support and
analyzed by SDS-PAGE, often followed by Western blot detection to verify the identity of the antigen.

http://www.piercenet.com/browse.cfm?fldID=9C471132-0F72-4F39-8DF0-455FB515718F
Co-immunoprecipitation

Co-Immnunoprecipitation (co-IP) is an extension of IP that is based on the potential of IP SDS-PAGE or

reactions to capture and purify the primary target (i.e., the antigen) as well as other functional (activity) assay
macromolecules that are bound to the target by native interactions in the sample solution.
The DNA methyltransferase DNMT3A associates H3 histone
methyltransferase activity
HeLa cell extracts

IP with anti-Dnmt3a
antibodies

immune complexes

in vitro histone methylation

assay
(purified histones, 3H-SAM)

SDS-PAGE analysis of
histones

Endogenous Dnmt3a associates with H3 methyltransferase activity.

HeLa nuclear extracts were immunoprecipitated with either antibodies against Dnmt3a (164a or 164b;
lanes 1 and 3) or their respective preimmune sera (lanes 2 and 4). After washing, the immune
complexes where tested for histone methyltransferase activity using bulk histones as substrate. The
reaction products were then analysed by SDS–PAGE followed by western blotting and autoradiography.
The radiolabelled H3 is indicated by an arrow on the right.
Fuks et al. (2003) NAR, 31, 2305-2312
Chromatin Immunoprecipitation (ChIP): Analysis of protein-DNA
interactions in their chromatin context

Selective immunoprecipitation of a protein of interest from a chromatin preparation,

to determine the DNA sites that this protein occupies

crosslinking

fragmentation

immunopurification

reverse X-link
DNA purification

analysis
Chromatin Immunoprecipitation (ChIP)

SW48 colon cancer cell line

ChIP using antibodies against

H3K9Me, H3K9Ac, H3K4Me

purified DNA examined by PCR using primers

specific for the promoters of P21 or P16

p21 (WAF1) - cyclin-dependent kinase inhibitor 1 : expressed in SW48 cells

P16 (INK4A) - cyclin-dependent kinase inhibitor 2 : silenced in SW48 cells

Kondo Y et al. (2004) PNAS,101,7398-7403

 Combining ChIP with microarray technology or DNA sequencing

“ChIP on chip” “ChIP-seq”

Goal: to identify chromatin factor targets or

chromatin modification sites along the genome :
precise mapping of chromatin factors on specific
chromosomal regions
http://www.currentprotocols.com/protocol/mb2113
 Tools and techniques for the study of epigenetics

Antibodies and their applications

Immunofluorescence (IF)

Immunoprecipitation (IP)

Chromatin immunoprecipitation (ChIP)

DNA methylation analysis

DNA methylation analysis

Restriction enzyme analysis

some enzymes that cleave at sites containing

HpaII HhaI CG do not function if the internal CG is
methylated; they can discriminate between
methylated and unmethylated sequences

MspI
some enzymes function irrespective of
methylation at the internal CG
DNA methylation analysis

Restriction enzyme analysis: resistance to RE as a measure of DNA methylation

Hypomethylation distinguishes genes of some human cancers from their normal counterparts
Feinberg & Vogelstein (1983) Nature, 301, 89-92

cancer normal
tissue HpaII HhaI MspI HpaII HhaI HpaII HhaI

DNA extraction

restriction

gel electrophoresis

transfer on membrane
HGH probe g-globin a-globin
Southern blot with
adenocarcinoma of the colon
32P-labelled gene-
specific probes
“DNA hypomethylation was the initial epigenetic
abnormality recognized in human tumors.” Ehrlich 10.2217/epi.09.33
DNA methylation analysis

Methylated DNA immunoprecipitation (MeDIP)

 very similar to ChIP

 use 5mC-specific antibodies to enrich in methylated DNA regions
 purified DNA is analyzed (e.g, by hybridization to an array (MeDIP-chip)) to identify the enriched regions
DNA methylation analysis

Bisulfite conversion

NH2 NH2
HCH3 C CH3
C
N C N C
C C C C
O N O N
cytosine 5’-methyl-cytosine

Na-bisulfite Na-bisulfite sodium bisulfite treatment converts

cytosine, but NOT methyl-cytosine,
to uracil
O NH2
C HCH3 C CH3
N C N C
C C C C
O N O N
uracil 5’-methyl-cytosine
 DNA methylation analysis

Bisulfite conversion

analysis
 PCR with primers specific for methylated versus unmethylated DNA

 Sequencing (me-C read as C; U read as T)

 Restriction enzyme analysis (novel restriction site created by bisulfite treatment)

http://privatewww.essex.ac.uk/~mastal/illumina_methyl_arrays.html
 DNA methylation analysis

Bisulfite sequencing

http://biochem.jacobs-university.de/BDPC/
E3
The structure of chromatin and its regulation

-Concepts
-DNA/histone/nucleosome / Eu- and heterochromatin
-DNA methylation
-histone modifications
-non-coding RNAs
-chromatin remodeling factors

Methods for epigenetics studies

- antibodies and their applications (ChIPs)

- DNA methylation analysis

Functional consequences of chromatin regulation – importance of epigenetic mechanisms

- DNA repair/maintenance of chromatin structure/genetic stability

- cancer and epigenetics
- epigenetic drugs
 Cancer and epigenetics

interplay between genetic and epigenetic alterations

in malignancies

as well as genetic stability

as well as genetic stability

novel therapeutic strategies

Gonzalo (2010) J. Appl. Physiol., 109, 586-597
Genetic mutations and epigenetic alterations
of tumour suppressor genes

Epigénétiaue et cancer, Kern et al.

Genetic mutations in epigenetic modifiers in cancer

Plass et al (2013) Nature Reviews Genetics, 14, 765.

Methylation and cancer

Many tumors: global hypomethylation

regional hypermethylation

Hypomethylation distinguishes genes of some human cancers from their normal counterparts
Feinberg & Vogelstein (1983) Nature, 301, 89- 91

p16INK4a promoter is hypermethylated at a high frequency in esophageal adenocarcinomas

Wong et al (1977) Cancer research, 57, 2619-2622

CpG island hypermethylation leads to suppression of gene expression

tumour suppressors
genes involved in apoptosis driving force in tumorigenesis
genes involved in DNA repair
CpG Island Methylator Phenotype (CIMP) in Tumors

CpG island methylator phenotype (CIMP): defined sets of hypermethylated genes

in certain tumors (i.e., cancer with a high degree of methylation)
IDH enzymes convert isocitrate into a-ketoglutarate

IDH1/2/3 : isocitrate dehydrogenases

 Gain-of-function mutations in IDH1
lead to the production of 2-HG

mutant IDH1:wtIDH1 heterodimer

 2-HG is an oncometabolite

metabolic changes epigenetic changes

intracellular 2HG: [1-30 mM]

tumorigenesis
 2-HG transforms cells by competitively inhibiting
Fe(II)-, a-KG-dependent dioxygenases

enzymes that enzymes that other hydroxylases

demethylate DNA/RNA demethylate lysine

Epigenetic control of gene expression & DNA repair

Reprogramming of DNA methylation profiles and gene expression patterns
2-HG that accumulates in IDH-mutant inhibits
a subset of methylation mark erasers: the a-
KG-dependent dioxygenases that demethylate
methyl-lysine (KDM) or 5mC in DNA (TET)
Histones and histone chaperone alterations in cancer

Alterations in H3 variants and their

chaperones are common in gliomas,
predominantly in pediatric forms
 Whole-exome sequencing on 48 paediatric GBMs

- 15 samples displayed a heterozygous mutation affecting one of two sites in H3F3A

- K27M, G34R, G34V affecting the N-ter tail of H3.3

KDM4 SETD2
PRC2

K36me2 K36me3
K36me2 K36me3
K27 K27me3

Schwartzentruber et al (2012) nature, 482, 226

Epigenetic drugs in cancer

Epigenetic drugs (HDAC inhibitors and DNA methylation inhibitors)

Synthetic lethality

Epigenetic drugs used in combination therapy

Epigenetic drugs : reversing aberrant gene expression profiles
through inhibition of HDACs and DNMTs

HAT
HDAC

DNMT

histone acetylation

histone deacetylation
Epigenetic drugs in cancer
SYNTHETIC LETHALITY

Synthetic lethality occurs when simultaneous

defects (through gene mutation, RNAi-mediated
depletion or pharmacological inhibition) in two
genes or proteins causes cell death (under
normal conditions, or following exposure to DNA
damage for instance) whereas defect in either
gene or protein alone is not lethal.

mutation
siRNA / shRNA
pharmacological inhibition
SYNTHETIC LETHALITY, DNA REPAIR AND CANCER

AB Ab

aB ab

Cancer cells become «addicted» to gene B for survival

 BRCA2+ RAD52+

BRAC2+ RAD52-

BRCA2- RAD52+

BRAC2- RAD52-

Cells transfected with sh-Rad52 or control shRNA. Cell number measuring started
5 d after transfection and 3 d after selection in hygromycin.
Synthetic lethality and Cancer. Cytotoxicity of PARP inhibitors in tumor cells with
intrinsic HR deficiency (BRCA-deficient tumours)
Synthetic lethality and Cancer. Cytotoxicity of PARP inhibitors in tumor cells
With intrinsic HR deficiency (BRCA-deficient tumours)

Error-free repair
SSB

DSB

Toxic repair

PARP is a DNA repair protein involved

in single-stranded DNA break (SSB) repair
Olaparib approved as a fourth-line
treatment for women with recurrent
ovarian cancer with a confirmed
germline BRCA mutation.
ARID1A (member of the SWI–SNF nucleosome remodeling complex)

Among the most frequently mutated genes in human cancers: in ovarian clear cell carcinomas,
half of the samples carry mutations that lead to the functional loss of ARID1A.

Question: Can ARID1A deficiency render cells vulnerable to the inhibition of a second epigenetic
regulator?

15 commercially available small molecule inhibitors of epigenetic regulators were tested for
their ability to kill ARID1A-deficient cells but not ARID1A wild-type cells.

The compound with the highest selectivity for ARID1A-deficient cells was a highly specific
inhibitor of EZH2 (HMT (H3K27Me3) part of the polycomb repressive complex 2.)
EXTRA SLIDES