Step1:
Research the method used by forensic scientists to accomplish this task and identify the steps involved
as well as a description of each step. Answer in paragraph form. Use at least two sources of information
and cite them properly.
Amplification of DNA
The amplification of DNA is accomplished by using the Polymerase Chain Reaction method (PCR). This
method involves three steps in the whole process. The first step is the Denaturation of DNA, similar to
the DNA replication process that occurs in our body, separating the double helix structure of DNA into
two single chains by breaking the hydrogen bonds. The mixture of the DNA template is heated up to
around 96C to breaking the Hydrogen bonds, separating the complementary DNA templates. The second
step in the process is called Annealing; the DNA mixture is cooled down to around 55C to 65C, so two
primers (synthesized short stretches of DNA), one for each DNA strand, can bind to the complementary
DNA templates to prepare for DNA synthesis. DNA polymerase can only bind nucleotides to a growing
chain, not a new one, so primers are very important. The last step is called Extension; the mixture of the
DNA is heated up again to 72C, and a polymerase enzyme, called Taq polymerase, is used to assist the
free DNA nucleotides (nitrogenous bases) in binding to the DNA primers to produce a DNA double helix
sequences as the region of DNA on the primers also gets copied. This process produces two sequences
of DNA double helix, each containing an original strand and a synthesized strand (semiconservative). The
process is repeated to produce a few to billions of copies around 30 times, and they are eventually
compared with the DNA of the suspects.
References
1. Garibyan, Lilit, and Nidhi Avashia. “Polymerase chain reaction.” The Journal of investigative
dermatology vol. 133,3 (2013): 1-4. doi:10.1038/jid.2013.1
2. Muhlrad, Paul J., and Matilde Parente. "Polymerase Chain Reaction." Genetics, 2nd ed., vol. 3,
Gale, 2018, pp. 237-242. Gale In Context:
Science, link.gale.com/apps/doc/CX2491300205/SCIC?u=bcdc&sid=bookmark-
SCIC&xid=b1e4e3f1. Accessed 13 Nov. 2022.
3. Pokapū, Akoranga Pūtaiao. “What Is PCR?” Science Learning Hub, 26 June 2017,
https://www.sciencelearn.org.nz/resources/2347-what-is-pcr
4. "Polymerase Chain Reaction (PCR)." World of Forensic Science, edited by Sara Constantakis,
2nd ed., vol. 2, Gale, 2016, pp. 543-545. Gale In Context:
Science, link.gale.com/apps/doc/CX3630600416/SCIC?u=bcdc&sid=bookmark-
SCIC&xid=0ff6e55e. Accessed 13 Nov. 2022.
Step 2:
After performing the method described in Step 1 above, you end up with the resulting DNA sequence
from the crime scene. Translate the DNA into mRNA:
DNA
TACGATGAAGGCAATCAAGGGTTCTCCTGTCAAAGTACATTATAGGCAGACTTAGCGGTTG GAATGAAAATC
mRNA:
AUGCUACUUCCGUUAGUUCCCAAGAGGACAGUUUCAUGUAAUAUCCGUCUGAAUCGCCAAC
CUUACUUUUAG
Step 3:
Amino Acid. Characteristics. Amino Acid. Characteristics
1.Metheonine 14.Asparagine
2. Leucine => Female 15.Isoleucine =>Curly hair
3. Leucine 16.Arginine
4.Proline 17.Leucine
5.Leucine =>Blue eyes 18.Asparagine =>Small straight nose
6.Valine 19.Arginine
7.Proline 20.Glutamine
8.Lysine 21.Proline
9.Arginine 22.Tyrosine =>Big ears
10.Threonine 23. Phenylalanine
11.Valine =>Black hair 24. Stop
12.serine
13.cysteine
