Cracking the DNA Code
You have been given a DNA sequence for a make believe person. Your job is to read their DNA and
figure out what characteristics your person will have using the process of transcription and translation.
1. You have been assigned a genetic code. Notice that only one half of the DNA molecule has been
given to you.
2. Use the message from the ORIGINAL strand of DNA to transcribe the message into mRNA on your
answer sheet. (Make the matches. Remember the difference in bases between DNA and RNA!)
Ex: AGGTCCTACTGGGGTACTGGGTAC…
UCCAGGAUGACCCCAUGACCCAUG…
3. Divide your mRNA code into codons. Ex: UCC AGG AUG ACC CCA UGA CCC AUG or
UCC|AGG|AUG|ACC|CCA|UGA|CCC|AUG
4. Use the mRNA codon chart from the HUB to find out which amino acid each mRNA codon
describes. Remember, you only need them for the start of genes (AUG). Once you find an AUG, write
down which amino acid the mRNA codon describes and do the same until you reach a stop codon.
You do not need to find amino acids unless they are part of a gene. Put an X for those codons that you
don’t need. Ex: UCC|AGG|AUG|ACC|CCA|UGA|CCC|AUG…
X | X | Met| Thr| Pro | Stop | X |Met…
Note: It is possible to have something like Met-Gly-Met without starting a whole new gene. The gene
only ends when there is a stop codon. Then you keep looking at the code to find the next AUG to start
the next gene.
5. Match your amino acid sequences to the list of traits. All traits in this exercise are 3 amino acids
long. (Remember, in nature traits may be the result of several thousand amino acids). When you
find a trait in your amino acid sequence, fill in the description below. Your person should have
a total of 7 traits.
6. You will now illustrate your person. All traits should be noticeable. You will also write a 5 sentence
description of your individual’s personality.
7. Answer the questions on the following page.
Continued on next page
Questions
8. Describe 2 ways DNA and RNA are similar. Describe 2 ways DNA and RNA are different. (4) Dna
and rna are similar in ways that they both have a sugar and they both have 4 nitrogenous bases.
they are different because dna is double stranded while rna is only single stranded. They are
also different because dna’s nitrogenous bases are ATGC and rna is AUGC
9. If there are 24 codons in a sequence, how many individual nitrogenous bases would make up this
sequence? (1) 24 codons implies that there at 8 bases as each base takes 3 codons.
10. Normally, the codon on mRNA has to match up with bases on the tRNA. What is the name for the
group of three bases found on the end of tRNA? (1) Anticodon
11. Fill in the following chart. (8)
Transcription Translation
Location
Nucleus ribosomes
Template DNA mRNA
Product Protein
mRNA
Nucleic Acids involved DNA mRNA,tRNA,rRNA
12. Explain why people look different even though there are only 20 amino acids. (2)Millions of
different proteins can be made from different combinations of the 20 amino acids. This means
that there are millions (or even more) possible ways that people can look
13. In your opinion, where would an error be the most damaging, during transcription or translation, and
why? (2)
I think the most damaging error in transcription would be an error in the brain because it
would affect how you function throughout your whole life.
What to turn in where
In Canvas
This sheet with the answers to the questions
The 5 sentence description of your person’s personality
To Ms. Watson
Your code transcribed and translated in the fashion described above
Your illustration
Rubric (Total 60 points possible)
10 points-mRNA matches
5 points-dividing mRNA into codons
10 points-correctly identifying amino acids
7 points-traits correctly identified and written
18 points-questions (point values for each are next to the question)
5 points- illustration showing traits
5 points- description of your person