ISCN

An International System for

Human Cytogenomic Nomenclature (2016)
2016

Editors
>Jean McGowan-Jordan
Annet Simons
Michael Schmid

KARG EK
ISCN;
An International System for
Human Cytogenomic Nomenclature (2016)

Editors
Jean McGowan-Jordan, Ottawa, Ont.
An net Simons, Nijmegen
Michael Schmid, Wurzburg

Recommendations of the International Standing Committee on Human

Cytogenomic Nomenclature Including New Sequence-Based Cytogenomic
Nomenclature developed in collaboration with the Human Genome
Variation Society (HGVS) Sequence Variant Description Working Group

10 figures, 4tables, and foldout, 2016

Basel • Freiburg • Paris • London • New York • Chennai • New Delhi •

Bangkok • Beijing • Shanghai • Tokyo • Kuala Lumpur • Singapore • Sydney
 Reprint of Cytogenetic and Genome Research (ISSN 1424-8581)
Vol. 149, No. 1-2, 2016

Copies of ISCN 2016 can be ordered from the publishers:

S. Karger AG S. Karger Publishers, Inc.
Allschwilerstrasse 10 26 West Avon Road
P.O. Box P.O. Box 529
CH-4009 Basel Unionville, CT 06085
Switzerland USA
Tel. +41 61 306 11 11 Tel. +1 860 675 7834
Fax +41 61 306 12 34 Fax+1 860 675 7302
E-Mail [email protected] Toll free:+1 800 828 5479

Library of Congress Cataloging-in-Publication Data

Names: International Standing Committee on Human Cytogenomic Nomenclature,

author. I McGowan-Jordan, Jean, editor. I Simons, Annet, editor. I Schmid,
M. (Michael), editor.
Title: ISCN : an international system for human cytogenomic nomenclature
(2016) / editors, Jean McGowan-Jordan, Annet Simons, Michael Schmid.
Other titles: International system for human cytogenomic nomenclature (2016)
Description: Basel; New York : Karger, [2016] I “Recommendations of the
International Standing Committee on Human Cytogenomic Nomenclature.” I
Published in Cytogenetic and Genome Research under the title ISCN 2016: An
International System for Human Cytogenomic Nomenclature (2016). I Includes
bibliographical references and index.
Identifiers: LCCN 2016011865 I ISBN 9783318058574 (soft cover : alk. paper)
Subjects: I MESH: Cytogenetics I Genomics I Terminology
Classification: LCC QH431 I NLM QU 15 I DDC 572.8-dc23 LC record available at
http://lccn.loc.gov/2016011865

Disclaimer All rights reserved

The statements, opinions and data contained in this publi­ No part of this publication may be translated into other lan­
cation are solely those of the individual authors and contri­ guages, reproduced, or utilized in any form or by any means,
butors and not of the publisher and the editor(s). The appea­ electronic or mechanical, including photocopying, record­
rance of advertisements in the book is not a warranty, endor­ ing, microcopying, or by any information storage and re­
sement, or approval of the products or services advertised or trieval system, without permission in writing from the publi­
of their effectiveness, quality or safety. The publisher and sher.
the editor(s) disclaim responsibility for any injury to persons
or property resulting from any ideas, methods, instructions © Copyright 2016 by S. Karger AG,
or products referred to in the content or advertisements. P.O. Box, CH-4009 Basel (Switzerland)
Printed in Switzerland on acid-free and non-aging paper
S. Karger (ISO 9706) by Werner Druck & Medien AG, Basel
Medical and Scientific Publishers ISBN 978-3-318-05857-4
Basel • Freiburg • Paris • London • New York • Chennai •
New Delhi • Bangkok • Beijing • Shanghai • Tokyo •
Kuala Lumpur • Singapore • Sydney
 Contents

1 Historical Introduction...................................................................... 1
1.1 1956-1984............................................................................................................... 1
1.2 1985-1995............................................................................................................... 3
1.3 1996-2004............................................................................................................... 4
1.4 2005-2009............................................................................................................... 5
1.5 2010-2013............................................................................................................... 5
1.6 2014-2016............................................................................................................... 6

2 Normal Chromosomes....................................................................... 7
2.1 Introduction............................................................................................................. 7
2.2 Chromosome Number and Morphology................................................................ 7
2.2.1 Non-Banding Techniques....................................................................................... 7
2.2.2 Banding Techniques............................................................................................... 8
2.2.3 X-and Y-Chromatin................................................................................................. 9
2.3 Chromosome Band Nomenclature........................................................................ 9
2.3.1 Identification and Definition of Chromosome Landmarks, Regions, and Bands.. 9
2.3.2 Designation of Regions, Bands, and Sub-Bands................................................... 11
2.4 High-Resolution Banding....................................................................................... 12
2.5 Molecular Basis of Banding..................................................................................... 14

3 Symbolsand Abbreviated Terms..................................................... 34

4 Karyotype Designation...................................................................... 37
4.1 General Principles................................................................................................... 37
4.2 Specification of Breakpoints................................................................................... 40
4.3 Designating Structural Chromosome Aberrations by Breakpoints and
Band Composition.................................................................................................. 40
4.3.1 Short System for Designating Structural Chromosome Aberrations.................... 41
4.3.1.1 Two-Break Rearrangements.................................................................................... 41
4.3.1.2 Three-Break Rearrangements.................................................................................. 41
4.3.1.3 Four-Break and More Complex Rearrangements................................................... 42
4.3.2 Detailed System for Designating StructuralChromosome Aberrations................. 42
4.3.2.1 Additional Symbols.................................................................................................. 43
4.3.2.2 Designating the Band Composition of a Chromosome........................................ 43
4.4 Derivative Chromosomes....................................................................................... 44
4.5 Recombinant Chromosomes.................................................................................. 46

ICARGEK © 2016 S. Karger AG, Basel

E-Mail [email protected]
www.karger.com/cgr
 5 Uncertainty in Chromosome or BandDesignation......................... 47
5.1 Questionable Identification................................................................................... 47
5.2 Uncertain Breakpoint Localization or Chromosome Number............................... 48
5.3 Alternative Interpretation....................................................................................... 48
5.4 Incomplete Karyotype............................................................................................ 48

6 Order of Chromosome Abnormalitiesin the Karyotype................. 50

7 Normal Variable Chromosome Features......................................... 52

7.1 Variation in Heterochromatic Segments, Satellite Stalks, and Satellites.............. 52
7.1.1 Variation in Length.................................................................................................. 52
7.1.2 Variation in Number and Position.......................................................................... 53
7.2 Fragile Sites............................................................................................................. 53

8 Numerical Chromosome Abnormalities.......................................... 54

8.1 General Principles................................................................................................... 54
8.2 Sex Chromosome Abnormalities............................................................................ 55
8.3 Autosomal Abnormalities....................................................................................... 56
8.4 Uniparental Disomy................................................................................................. 57

9 Structural Chromosome Rearrangements...................................... 58

9.1 General Principles................................................................................................... 58
9.2 Specification of Structural Rearrangements......................................................... 59
9.2.1 Additional Material of Unknown Origin................................................................. 59
9.2.2 Deletions.................................................................................................................. 60
9.2.3 Derivative Chromosomes....................................................................................... 60
9.2.4 Dicentric Chromosomes......................................................................................... 65
9.2.5 Duplications............................................................................................................ 67
9.2.6 Fission..................................................................................................................... 67
9.2.7 Fragile Sites............................................................................................................. 67
9.2.8 Homogeneously Staining Regions........................................................................ 68
9.2.9 Insertions................................................................................................................. 68
9.2.10 Inversions................................................................................................................. 69
9.2.11 Isochromosomes.................................................................................................... 70
9.2.12 Marker Chromosomes............................................................................................. 70
9.2.13 Neocentromeres...................................................................................................... 72
9.2.14 Quadruplications.................................................................................................... 72
9.2.15 Ring Chromosomes................................................................................................. 72
9.2.16 Telomeric Associations........................................................................................... 74
9.2.17 Translocations......................................................................................................... 75
9.2.17.1 Reciprocal Translocations....................................................................................... 75
9.2.17.2 Whole-Arm Translocations....................................................................................... 77
9.2.17.3 Robertsonian Translocations.................................................................................. 78
9.2.17.4 Jumping Translocations.......................................................................................... 79
9.2.18 Tricentric Chromosomes........................................................................................ 79
9.2.19 Triplications............................................................................................................. 79
9.3 Multiple Copies of Rearranged Chromosomes....................................................... 79

IV ISCN 2016
 10 Chromosome Breakage..................................................................... 81
10.1 Chromatid Aberrations.......................................................................................... 81
10.1.1 Non-Banded Preparations..................................................................................... 81
10.1.2 Banded Preparations................................................................................................ 82
10.2 Chromosome Aberrations...................................................................................... 82
10.2.1 Non-Banded Preparations..................................................................................... 82
10.2.2 Banded Preparations................................................................................................ 83
10.3 Scoring of Aberrations............................................................................................. 83

11 Neoplasia............................................................................................ 84
11.1 Clones and Clonal Evolution.................................................................................. 84
11.1.1 Definition of a Clone............................................................................................... 84
11.1.2 Clone Size................................................................................................................. 85
11.1.3 Mainline................................................................................................................... 85
11.1.4 Stemline, Sideline and Clonal Evolution................................................................. 86
11.1.5 Composite Karyotype............................................................................................... 88
11.1.6 Unrelated Clones.................................................................................................... 89
11.2 Modal Number........................................................................................................ 90
11.3 Constitutional Karyotype.......................................................................................... 90

12 Meiotic Chromosomes........................................................................ 92
12.1 Terminology............................................................................................................ 92
12.1.1 Examples of Meiotic Nomenclature......................................................................... 93
12.1.2 Correlation between Meiotic Chromosomes and Mitotic Banding Patterns......... 94

13 In situ Hybridization.......................................................................... 100

13.1 Introduction............................................................................................................. 100
13.2 Prophase/Metaphase in situ Hybridization (ish)..................................................... 101
13.2.1 Use of dim and enh................................................................................................. 105
13.2.2 Subtelomeric Metaphase in situ Hybridization...................................................... 106
13.3 Interphase/Nuclear in situ Hybridization (nuc ish)................................................. 106
13.3.1 Number of Signals................................................................................................... 106
13.3.2 Relative Position of Signals...................................................................................... 109
13.3.2.1 Single Fusion Probes................................................................................................ 111
13.3.2.2 Single Fusion with Extra Signal Probes.................................................................. 111
13.3.2.3 Dual Fusion Probes................................................................................................. 111
13.3.2.4 Break-Apart Probes................................................................................................... 111
13.4 In situ Hybridization on Extended Chromatin/DNA Fibers (fib ish)...................... 112
13.5 Reverse in situ Hybridization (rev ish)..................................................................... 113
13.5.1 Chromosome Analyses Using Probes Derived from Sorted or Microdissected
Chromosomes.......................................................................................................... 113
13.6 Chromosome Comparative Genomic Hybridization (cgh)..................................... 113
13.7 Multi-Color Chromosome Painting........................................................................ 114
13.8 Partial Chromosome Paints..................................................................................... 114

14 Microarrays......................................................................................... 115
14.1 Introduction............................................................................................................. 115
14.2 Examples of Microarray Nomenclature.................................................................. 116
14.2.1 Nomenclature Specific to SNP Arrays..................................................................... 121
14.2.2 Complex Array Results............................................................................................ 122

Contents V
 15 Region-Specific Assays...................................................................... 123
15.1 Introduction............................................................................................................. 123
15.2 Examples of RSA Nomenclature for Copy Number Detection.............................. 123
15.3 Examples of RSA Nomenclature forBalanced Translocations or Fusion Genes... 124

16 Sequence-Based Assays..................................................................... 125

16.1 Introduction............................................................................................................. 125
16.2 General Principles................................................................................................... 125
16.3 Examples of Sequence-BasedNomenclature for Description of Chromosome
Rearrangements...................................................................................................... 127
16.3.1 Deletions.................................................................................................................. 127
16.3.2 Derivative Chromosomes....................................................................................... 127
16.3.3 Duplications............................................................................................................ 128
16.3.4 Insertions................................................................................................................. 128
16.3.5 Inversions................................................................................................................. 128
16.3.6 Ring Chromosomes................................................................................................. 128
16.3.7 Translocations......................................................................................................... 129

17 References.......................................................................................... 130

18 Members of the ISCN Standing Committee and Advisors............. 132

19 Appendix............................................................................................ 134

20 Index................................................................................................... 136

VI ISCN 2016
1 Historical Introduction

1.1 1956-19841

In 1956 Tjio and Levan, in their now classic article, reported that the human chromosome
number was 46 and not 48. This work, which was carried out on cultured human embryonic
cells, was rapidly confirmed by studies of testicular material by Ford and Hamerton (1956).
These two articles stimulated a renewed interest in human cytogenetics, and, by 1959, sev­
eral laboratories were engaged in the study of human chromosomes and a variety of classifi­
cation and nomenclature systems had been proposed. This resulted in confusion in the lit­
erature and a need to establish a common system of nomenclature that would improve com­
munication between workers in the field.
For this reason, a small study group was convened in Denver, Colorado at the suggestion
of Charles E. Ford. Fourteen investigators and three consultants participated, representing
each of the laboratories that had published human karyotypes up to that time. The system
proposed in the report of this meeting, entitled “A Proposed Standard System of Nomencla­
ture of Human Mitotic Chromosomes,” more commonly known as the Denver Conference
(1960), has formed the basis for all subsequent nomenclature reports and has remained virtu­
ally unaltered, despite the rapid developments of the last 25 years. It is fair to say that the
participants at Denver did their job so well that this report has formed the cornerstone of hu­
man cytogenetics since 1960, and the foresight and cooperation shown by these investigators
have prevented much of the nomenclature confusion which has marked other areas of human
genetics.
Three years later, a meeting called by Lionel S. Penrose was held in London (London Con­
ference, 1963) to consider developments since the Denver Conference. The most significant
result of that conference was to give official sanction to the classification of the seven groups
of chromosomes by the letters A to G, as originally proposed by Patau (1960).
The next significant development came in Chicago at the Third International Congress on
Human Genetics in 1966 when 37 investigators, representing the major cytogenetic labora­
tories, met to determine whether it was possible to improve the nomenclature and thus elim­
inate some of the major problems that had resulted from the rapid proliferation of new find­
ings since 1960. The report of this conference (Chicago Conference, 1966) proposed a stan­
dard system of nomenclature for the provision of short-hand descriptions of the human
chromosome complement and its abnormalities, a system that, in its basic form, has stood

1 Adapted from ISCN (1985).

KARGER ©2016S. Karger AG, Basel

1424—8581/16/1492—0001$39.50/0
E-Mail [email protected]
www.karger.com/cgr
the test of time and is now used throughout the world for the description of non-banded chro­
mosomes.
In his introductory address to the Chicago Conference (1966), Lionel Penrose made the
following prophetic statement:
It is easy to be carried away by the detectable peculiarities and to forget that much under­
lying variability is still hidden from view until some new technical device discloses the finer
structure of chromosomes, as in the Drosophila salivary gland cells.
Two years later in 1968, the second major breakthrough occurred when Torbjorn Caspers-
son and his colleagues, working in Sweden, published the first banding pictures of plant chro­
mosomes stained with quinacrine dihydrochloride or quinacrine mustard (Caspersson et al.,
1968). These studies were rapidly expanded to human chromosomes by these workers, who
published the first banded human karyotype in 1970 (for a review of this work, see Caspers­
son et al., 1972). Soon, several other techniques that also produced chromosome bands were
developed. This led to the realization that, as each human chromosome could now be identi­
fied very precisely, the existing system of nomenclature would no longer be adequate.
A group of 50 workers concerned with human cytogenetics met in 1971 on the occasion of
the Fourth International Congress of Human Genetics in Paris to agree upon a uniform sys­
tem of human chromosome identification. Their objective was accomplished and extended
by the appointment of a Standing Committee, chaired by John Hamerton, which met ini­
tially in Edinburgh in January 1972, and then with a number of expert consultants at Lake
Placid in New York in December 1974, and again in Edinburgh in April 1975.
The 1971 meeting in Paris, together with the 1972 Edinburgh meeting of the Standing
Committee, resulted in the report of the Paris Conference (1971), a highly significant docu­
ment in the annals of human cytogenetics. This document proposed the basic system for des­
ignating not only individual chromosomes but also chromosome regions and bands, and it
provided a way in which structural rearrangements and variants could be described in terms
of their band composition.
By 1974 it had become clear that the number of workers in the field was now too great to al­
low the holding of such conferences as the Chicago and Paris ones, where the majority of labo­
ratories involved could be represented. The Standing Committee therefore proposed holding
smaller, nonrepresentative conferences, each on a number of fairly specific topics and that would
utilize expert consultants for each topic. The first meeting of this type was held in 1974 in Lake
Placid and the second in 1975 in Edinburgh, at which a number of specific topics - including
heteromorphic chromosomes of the Hominoidea, and chromosome registers - were discussed.
These discussions were reported in the 1975 supplement to the Paris Conference report (Paris
Conference, 1971, Supplement, 1975).
A further change came about in 1976 at the Fifth International Congress of Human Genet­
ics in Mexico City, when a meeting of all interested human cytogeneticists was held to elect
an International Standing Committee on Human Cytogenetic Nomenclature. These elections
provided a truly international and geographic representation for the Standing Committee and
provided a mandate to the committee to continue its work in proposing ways in which human
chromosome nomenclature might be improved. Jan Lindsten was appointed the chairman of
this committee.
The committee met in Stockholm in 1977 and, following past practice, invited a number
of expert consultants to meet with it. It was decided at this meeting to cease labeling reports
geographically and to unify the various conference reports reviewed above into a document
entitled “An International System for Human Cytogenetic Nomenclature (1978),” to be ab­
breviated ISCN (1978). ISCN (1978) included all major decisions of the Denver, London,
Chicago, and Paris Conferences, without any major changes but edited for consistency and
accuracy. It thus provided in one document a complete system of human cytogenetic nomen­

2 Cytogenet Genome Res 2016;149:1-140 ISCN 2016

DOI: 10.1159/000445813
 clature that has stood the test of time and has proved to be of value not only to those entering
the field for the first time but also to experienced cytogeneticists.
The next major area to be considered by the Standing Committee was the nomenclature
of chromosomes stained to show “high resolution banding.” In 1977 a working party was es­
tablished under the chairmanship of Bernard Dutrillaux to consider this matter.
It had been recognised for some time that prophase and prometaphase chromosomes reveal
a much larger number of bands than can be seen even in the best banded metaphase chromo­
some preparations. Techniques were devised to partially synchronise peripheral blood cul­
tures so as to yield sufficient cells in the early phase of mitosis for detailed study. These all
essentially use some method of blocking cells in the S-phase, releasing the block and then
timing the subsequent harvest to obtain the maximum number of cells at the appropriate stage
(Dutrillaux, 1975; Yunis, 1976). Several studies showed that techniques of this kind required
a new nomenclature (Francke and Oliver, 1978; Viegas-Pequignot and Dutrillaux, 1978; Yu­
nis et al., 1978).
The working group met on several occasions. There was a remarkable degree of agreement
on the number of bands, the width of the bands and their relative positions. There was, how­
ever, considerable difficulty in reaching a consensus on the origin of certain bands and on the
stage of their appearance relative to other bands. A broad measure of agreement was, how­
ever, reached at a meeting in Paris in May 1980 and this was published as “An International
System for Human Cytogenetic Nomenclature - High Resolution Banding (1981)” or ISCN
(1981).
A new Standing Committee was elected at a specially convened meeting of cytogeneticists
held during the Sixth International Congress of Human Genetics in Jerusalem in 1981. David
Harnden was appointed chairman of the new committee.
A revision of the International System for Human Cytogenetic Nomenclature was prepared
in 1984, to be published as ISCN (1985), partly because a reprint was in any case necessary
and partly because, once again, it was felt to be important to try to keep all statements on no­
menclature together in a single volume. The opportunity was taken to correct errors and make
a small number of amendments but no attempt was made to make a major revision.
The widely accepted international nomenclature for human chromosomes has proved to
be an important element in improving and maintaining international collaboration. The de­
velopment of this system has been made possible by the collaboration of many people. I would
like to thank not only members of the Standing Committee but others who have acted as con­
sultants or who have contributed ideas or materials to these publications. In particular I would
like to express the gratitude of the international cytogenetic community to the March of
Dimes Birth Defects Foundation for its consistent and substantial financial support over the
past 19 years. Without its help none of these developments would have been possible.
David Harnden
October 1984

1.2 1985-1995

A new Standing Committee was elected at a meeting of cytogeneticists attending the Seventh
Congress of Human Genetics held in Berlin in 1986 and Uta Francke was appointed as chair­
man. The Committee was aware of a considerable increase in the amount and variety of data
on chromosome aberrations associated with neoplasia, and considered that a terminology was
necessary for those acquired chromosome aberrations that were not adequately described by
the nomenclature for constitutional aberrations as published in ISCN (1985). A subcommit­
tee under the chairmanship of Felix Mitelman was established and charged with the task of

Historical Introduction Cytogenet Genome Res 2016;149:1-140 3

DOI: 10.1159/000445813
 producing a nomenclature for cancer cytogenetics. The report of this subcommittee was ad­
opted by the ISCN Standing Committee and published as “ISCN (1991): Guidelines for Can­
cer Cytogenetics”. These guidelines superseded previous ISCN recommendations on cancer
cytogenetics and have since come into general use.
A new Standing Committee was elected at the Eighth International Congress of Human
Genetics held in Washington, DC, in 1991 and Felix Mitelman was appointed chairman. The
new committee considered that it would be timely to review and update the ISCN (1985) no­
menclature in the light of developments in the field, including advances in the use of in situ
hybridization techniques, and to incorporate all revisions and the guidelines for cancer cyto­
genetics into a single document to be published as ISCN (1995). Cytogeneticists were asked,
through notices published in relevant journals, to forward to the Committee their comments
on any defects in the ISCN 1978-1991 publications, as well as any suggestions for alterations
and improvements.
The Standing Committee and consultants met in Memphis on October 9-13, 1994, at the
kind invitation of Professor Avirachan Tharapel. The Committee considered all the recom­
mendations that had been submitted to it and updated, modified, and amalgamated the 1985
and 1991 documents into a single text with the intention of this being published in 1995.
H.J. Evans
P.A. Jacobs
October 1994

1.3 1996-2004

The Ninth International Congress of Human Genetics was held in Rio de Janeiro in 1996. A
new Standing Committee was elected at the satellite meeting of the cytogeneticists. Patricia A.
Jacobs was appointed as the chairperson of the Committee. In light of the extensive revision of
ISCN (1995), the new Committee elected not to implement additional changes during its term.
The Tenth International Congress of Human Genetics was held in Vienna. The congrega­
tion of cytogeneticists present at the satellite meeting elected a new committee and Niels
Tommerup was appointed as chairman. The extensive use of ISCN (1995) by the scientific
community identified several areas that needed clarifications, deletions and additions. There­
fore, the Committee decided to review and update the ISCN (1995). The seven members of
the Committee and nine external consultants met in Vancouver, BC, December 8-10, 2004
at the invitation of Niels Tommerup and Lisa G. Shaffer. The primary changes included re­
placing G- and R-banded karyotypes (Figs. 2 and 3) with new ones reflecting higher band­
level resolutions, the addition of a new idiogram at the 300-band level, and introduction of a
new 700-band level idiogram that reflected the actual size and position of bands. The in situ
hybridization nomenclature was modernized, simplified, and expanded. New examples re­
flecting unique situations were added, and a basic nomenclature for recording array compar­
ative genomic hybridization results was introduced.
The Committee adopted changes to its membership structure for the future. The number
of members was expanded to eleven from the current seven to reflect better representation of
the geographic distribution of cytogeneticists. The voting constituency and guidelines for the
election of members and chairpersons was redefined. Lisa Shaffer was appointed as chairman
of the newly elected Committee. Finally, the Committee recommended that ISCN (2005) be
published in 2005.
D.H. Ledbetter
A.T. Tharapel
December 2004

4 Cytogenet Genome Res 2016;149:1-140 ISCN 2016

DOI: 10.1159/000445813
1.4 2005-2009

Early in 2006, Lisa Shaffer and Niels Tommerup organized the election for the next Standing
Committee. Ballots were distributed and collected worldwide, and at the Eleventh Interna­
tional Congress of Human Genetics, held in Brisbane, Australia, in 2006, the results of the
election were announced, resulting in a Committee of eleven elected members. The newly
elected Committee received feedback on ISCN (2005) and decided to hold a meeting in 2008
to discuss potential changes and additions to a new edition of ISCN. At the invitation of Lisa
Shaffer, Chair, the Committee and two external consultants met in Vancouver, BC, October
8-10, 2008. The primary change in cancer was the accommodation for either idem or sl/sdl
in the nomenclature to describe clonal evolution. The in situ hybridization nomenclature was
further clarified and additional examples provided. The basic microarray nomenclature was
revised and expanded to accommodate all platform types, with more examples provided. Fi­
nally, a nomenclature for MLPA was introduced. The Committee recommended that ISCN
(2009) be published in 2009.
Lisa G. Shaffer
Marilyn L. Slovak
Lynda J. Campbell
December 2008

1.5 2010-2013

In the fall of 2011, Lisa Shaffer organized the election for the next Standing Committee. The
Committee was reduced to eight members including three from the Americas, three from Eu­
rope, one from Asia and one from Africa/Australia/New Zealand/Oceania. Ballots were dis­
tributed and collected worldwide, and the results of the election were announced. The newly
elected Committee received feedback on ISCN (2009) and decided to hold a meeting in the
spring of 2012 to discuss potential changes and additions to a new edition of ISCN. At the
invitation of Lisa Shaffer, Chair, the Committee and two external consultants met in Seattle,
Washington, April 10-11, 2012. During the meeting, Jean McGowan-Jordan was elected as
the new Chair of the ISCN Committee. The Committee spent substantial time discussing that
the primary purpose of the ISCN is to foster communication among cytogeneticists using a
standard nomenclature that can be used to describe any genomic rearrangement identified
either by standard karyotyping or molecular methodologies. The primary changes to the new
edition of ISCN include additional illustrative examples of uses of nomenclature, inclusion
of some definitions including chromothripsis and duplication, and the use of the genome build
when describing microarray results. In ISCN (2009) MLPA nomenclature was introduced.
The Committee considered adding nomenclature for other targeted quantitative assays such
as QF-PCR, real-time-PCR and bead-based multiplex techniques, but decided to delete sec­
tion 14.4 on MLPA and rather introduce a new chapter 15 for nomenclature that can be used
for any Region-Specific Assay (RSA). Finally, the Committee decided to delete any symbols
that are not used in the nomenclature. With these changes, the Committee recommended that
ISCN (2013) be published.
Lisa G. Shaffer
Jean McGowan-Jordan
May 2012

Historical Introduction Cytogenet Genome Res 2016;149:1-140 5

DOI: 10.1159/000445813
1.6 2014-2016

In the spring of 2014, Jean McGowan-Jordan, as Chair, contacted the members of the Stand­
ing Committee regarding the accumulating need to describe chromosomal abnormalities
identified by sequence-based technologies. The relatively brief period since the publication
of ISCN 2013 and the willingness of Committee members to maintain their commitment
facilitated a meeting of the Committee in San Diego, Calif., October 22-23, 2014, which
included two invited advisors. Prior to the meeting, input on required changes and correc­
tions to ISCN 2013 was sought from the Cytogenetics community. Various approaches to
describing chromosome abnormalities characterized by DNA sequencing were considered
and discussed during a special joint session with the members of the Human Genome Vari­
ation Society (HGVS) Sequence Variant Description Working Group. Due to the long-stand­
ing use of HGVS terms and rules for description of sequence-based changes, it was decided
that the HGVS and ISCN would collaborate on the development of a new nomenclature
which would work for both the Molecular Genetics and Cytogenetics communities. It was
agreed that this new scheme would form a new chapter of ISCN 2016. The Committee agreed
upon required corrections and changes and the addition of new examples, particularly for
microarray and region-specific assays, including the requirement to incorporate the genome
build in the HGVS-standard format whenever nucleotide numbers are specified. Changes in
the main text compared to the previous edition would be marked in the margin for the con­
venience of the reader. The decision to modify the name of the Standing Committee and
nomenclature scheme to reflect changes in technology under its purview, by incorporating
the term “Cytogenomic” (as replacement for Cytogenetic), was also made. The Committee
then recommended the publication of ISCN 2016, An International System for Human Cy­
togenomic Nomenclature (2016).
Jean McGowan-Jordan
Annet Simons
December 2015

6 Cytogenet Genome Res 2016;149:1-140 ISCN 2016

DOI: 10.1159/000445813
2 Normal Chromosomes

2.1 Introduction

Human chromosome nomenclature is based on the results of several international conferences

(Denver 1960, London 1963, Chicago 1966, Paris 1971, Paris 1975, Stockholm 1977, Paris
1980, Memphis 1994, Vancouver 2004, Vancouver 2008, Seattle 2012, San Diego 2014). The
present report, which summarizes the current nomenclature, incorporates and supersedes all
previous ISCN recommendations. The ISCN Standing Committee recommends that this no­
menclature system be used also in other species.

2.2 Chromosome Number and Morphology

2.2.1 Non-Banding Techniques

In the construction of the karyogram1 the autosomes are numbered from 1 to 22 in order of
decreasing length (one exception is that chromosome 21 is shorter than chromosome 22). The
sex chromosomes are referred to as X and Y.
When the chromosomes are stained by methods that do not produce bands, they can be ar­
ranged into seven readily distinguishable groups (A-G) based on descending order of size and
the position of the centromere.
The group letter designations placed before the chromosome numbers are those agreed
upon at the London Conference (1963). Not all chromosomes in the D and G groups show
satellites on their short arms in a single cell. The number and size of these structures are vari­
able.
The following parameters were used to describe non-banded chromosomes: (1) the length
of each chromosome, expressed as a percentage of the total length of a normal haploid set, i.e.,
the sum of the lengths of the 22 autosomes and of the X chromosome; (2) the arm ratio of the
chromosomes, expressed as the length of the longer arm relative to the shorter one; and (3)
the centromeric index, expressed as the ratio of the length of the shorter arm to the whole
length of the chromosome. The latter two indices are, of course, related algebraically.

1 The terms karyogram, karyotype, and idiogram have often been used indiscriminately. The term karyogram should be
applied to a systematized array of the chromosomes prepared either by drawing, digitized imaging, or by photography, with
the extension in meaning that the chromosomes of a single cell can typify the chromosomes of an individual or even a spe­
cies. The term karyotype should be used to describe the normal or abnormal, constitutional or acquired, chromosomal
complement of an individual, tissue or cell line. We recommend that the term idiogram be reserved for the diagrammatic
representation of a karyotype.

Normal Chromosomes Cytogenet Genome Res 2016;149:1-140 7

DOI: 10.1159/000445813
 Group A (1-3) Large metacentric chromosomes readily distinguished from each other
by size and centromere position.
Group B (4-5) Large submetacentric chromosomes.
Group C (6-12, X) Medium-sized metacentric or submetacentric chromosomes. The X
chromosome resembles the longer chromosomes in this group.
Group D (13-15) Medium-sized acrocentric chromosomes with satellites.
Group E (16-18) Relatively short metacentric or submetacentric chromosomes.
Group F (19-20) Short metacentric chromosomes.
Group G (21-22, Y) Short acrocentric chromosomes with satellites. The Y chromosome bears
no satellites.

2.2.2 Banding Techniques

Numerous technical procedures have been reported that produce banding patterns on meta­
phase chromosomes.
A band is defined as the part of a chromosome that is clearly distinguishable from its ad­
jacent segments by appearing darker or lighter with one or more banding techniques. Bands
that stain darkly with one method may stain lightly with other methods. The chromosomes
are visualized as consisting of a continuous series of light and dark bands, so that, by defini­
tion, there are no “interbands”.
The methods first published for demonstrating bands along the chromosomes were those
that used quinacrine mustard or quinacrine dihydrochloride to produce a fluorescent band­
ing pattern. These methods are named Q-staining methods and the resulting bands Q-bands
(Fig. 1). The numbers assigned to each chromosome were based on the Q-banding pattern as
given by Caspersson et al. (1972). Techniques that demonstrate an almost identical pattern
of dark and light bands along the chromosomes usually use the Giemsa dye mixture as the
staining agent. These techniques are generally termed G-staining methods and the resulting
bands G-bands (Fig. 2). Some banding techniques give patterns that are opposite in staining
intensity to those obtained by the G-staining methods, viz, the reverse staining methods, and
the resulting bands are called R-bands (Fig. 3).
The banding techniques fall into two principle groups: (1) those resulting in bands distrib­
uted along the length of the whole chromosome, such as G-, Q-, and R-bands, including tech­
niques that demonstrate patterns of DNA replication, and (2) those that stain specific chro­
mosome structures and hence give rise to a restricted number of bands (Table 1). These in­
clude methods that reveal constitutive heterochromatin (C-bands) (Fig. 4), telomeric bands
(T-bands), and nucleolus organizing regions (NORs). For the code to describe banding tech­
niques, see Table 2.
The patterns obtained with the various C-banding methods do not permit identification
of every chromosome in the somatic cell complement but, as demonstrated in Table 1, can
be used to identify specific chromosomes. The C-bands on chromosomes 1, 9, 16, and Y are
all morphologically variable. The short-arm regions of the acrocentric chromosomes also dem­
onstrate variations in size and staining intensity of the Q-, G-, R-, C-, T-, and NOR-bands.
These variations are heritable features of the particular chromosome.

8 Cytogenet Genome Res 2016;149:1-140 ISCN 2016

DOI: 10.1159/000445813
 Fig. 1. Q-banded human karyogram. (Courtesy of Dr. E. Magenis.)

2.2.3 X- and Y-Chromatin

Inactive X chromosomes, as well as the heterochromatic segment on the long arm of the Y
chromosome, appear as distinctive structures in interphase nuclei, for which the terms X-
chromatin (Barr body, sex chromatin, X-body) and Y-chromatin (Y-body), respectively,
should be used.

2.3 Chromosome Band Nomenclature

2.3.1 Identification and Definition of Chromosome Landmarks, Regions, and Bands

Each chromosome in the human somatic cell complement is considered to consist of a conti­
nuous series of bands, with no unbanded areas. As defined earlier, a band is a part of a chro­
mosome clearly distinguishable from adjacent parts by virtue of its lighter or darker staining

Normal Chromosomes Cytogenet Genome Res 2016;149:1-140 9

DOI: 10.1159/000445813
Fig. 2. G-banded human karyogram. (Courtesy of N.L. Chia.)

intensity. The bands are allocated to various regions along the chromosome arms, and the
regions are delimited by specific landmarks. These are defined as consistent and distinct mor­
phologic features important in identifying chromosomes. Landmarks include the ends of the
chromosome arms, the centromere, and certain bands. The bands and the regions are numbe­
red from the centromere outward. A region is defined as an area of a chromosome lying bet­
ween two adjacent landmarks.
The original banding pattern was described in the Paris Conference (1971) report and was
based on the patterns observed in different cells stained with either the Q-, G-, or R-banding
technique (Appendix, Chapter 19). The banding patterns obtained with these staining meth­
ods agreed sufficiently to allow the construction of a single diagram representative of all three
techniques. The bands were designated on the basis of their midpoints and not by their mar­
gins. Intensity was taken into consideration in determining which bands should serve as land­
marks on each chromosome in order to divide the chromosome into natural, easily recogniz­
able morphologic regions. A list of bands serving as landmarks that were used in constructing
this diagram is provided in Table 3.

10 Cytogenet Genome Res 2016;149:1-140 ISCN 2016

DOI: 10.1159/000445813
 Fig. 3. R-banded human karyogram. (Courtesy of Dr. M. Prieur.)

2.3.2 Designation of Regions, Bands, and Sub-Bands

Regions and bands are numbered consecutively from the centromere outward along each
chromosome arm. The symbols p and q are used to designate, respectively, the short and long
arms of each chromosome. The centromere (cen) itself is designated 10; the part facing the
short arm is plO, the part facing the long arm is qlO. These are not shown in the idiograms.
The two regions adjacent to the centromere are labeled as 1 in each arm; the next, more distal
regions as 2, and so on. A band used as a landmark is considered as belonging entirely to the
region distal to the landmark and is accorded the band number of 1 in that region.
In designating a particular band, four items are required: (1) the chromosome number, (2)
the arm symbol, (3) the region number, and (4) the band number within that region. These
items are given in order without spacing or punctuation. For example, lp31 indicates chro­
mosome 1, short arm, region 3, band 1.
Whenever an existing band is subdivided, a decimal point is placed after the original band des­
ignation and is followed by the number assigned to each sub-band. The sub-bands are numbered
sequentially from the centromere outward. For example, if the original band lp31 is subdivided
into three equal or unequal sub-bands, the sub-bands are labeled 1 p31.1, lp31.2, and lp31.3, sub­
band lp31.1 being proximal and lp31.3 distal to the centromere. If a sub-band is subdivided, ad-

Normal Chromosomes Cytogenet Genome Res 2016;149:1-140 11

DOI: 10.1159/000445813
 Table 1. Examples of heteromorphisms with various stainsa.

Technique Chromosome
1 2 3 4 5 6 7 8 9
z->< h 10
ql2 inv(pll.2ql3) inv(pl 1.2ql2)
inv(pl3q21) pll.l ql2 inv(pl 1.2q21.2)
Cc qh inv(pl2ql3)
Gil qh cen qh
RorT p36.3 qii.i pii.i
qh
q37 pl6 P15.3 qll.l
p22 q24.3 q34 q26
NOR q35
Qd cen cen

DA-DAPIe qh
-------------------------------------------------------------------------------- -- qh

Technique Chromosome
11 12 13 14 15
18 19 20 21 22 X Y
Gb P P P qll.2
inv(pl 1.2ql2.1) P P inv(pll.2ql 1.2)
Cc P P P qh pH
Gil P P P ql2
P P Pll.l qll.l p
R or T P15 pl3 P12 P12 pl2 P ql2
P13.3 q25 P13.3 ql3 P12
ql3 q34 q32 pl2
q24 ql3.1 q22 qll.2
NOR P12 pl2 pl2 ql3
P12 P12
Qd pl 1.2 pll.2 pll.2 pll.2 pll.2
pl3 P13 P13 pl3 P13
cen
DA-DAPIe pll.2 qh ql2

a cen = Centromere, h = heterochromatin, inv = inversion, p = short arm, q = long arm.

b Only the most commonly seen heteromorphisms are listed.
c All centromeres show constitutive heterochromatin variation.
d Only the brilliant and intensity-variable Q-bands are listed.
e DA-DAPI = Distamycin A and 4',6-diamidino-2-phenylindole.

ditional digits, but no further punctuation, are used; e.g., sub-band lp31.1 might be further sub­
divided into lp31.11, lp31.12, etc. Although in principle a band can be subdivided into any num­
ber of new bands at any one stage, a band is usually subdivided into three sub-bands.

2.4 High-Resolution Banding

The nomenclature for high-resolution preparations of prophase and prometaphase chromo­

somes set forth by ISCN (1981) is an extension of the nomenclature for the banding patterns
for metaphase chromosomes established at the Paris Conference (1971) and in ISCN (1978).
The original system was specifically devised to allow for expansion as more chromosome
bands were recognized.
High-resolution banding techniques can be applied to chromosomes in different stages of
the cell cycle, e.g., prophase, prometaphase, or interphase (by methods that induce premature
chromosome condensation). Furthermore, the number of discernible bands depends not only
on the state of condensation but also on the banding technique used. The level of resolution
is determined by the number of bands seen in a haploid set (22 autosomes + X and Y). The

12 Cytogenet Genome Res 2016;149:1-140 ISCN 2016

DOI: 10.1159/000445813
Fig. 4. C-banded human karyogram. The chromosomes were not preidentified with other banding techniques.
(Courtesy of Dr. N. Mandahl.)

standard idiograms shown in Fig. 5 provide schematic representations of chromosomes cor­

responding to approximately 300, 400, 550, 700 and 850 bands. Although larger numbers of
bands can be visualized, 550- to 850-band idiograms are sufficient for practical purposes. The
400- and 550-band idiograms are taken from ISCN (1985), and the 850-band idiogram was
introduced in ISCN (1981) (Francke, 1994). The original nomenclature was based on patterns
rather than on measurements. Also, variation in intensity of staining, which is dependent on
the staining technique, was not reflected in the ISCN (1981) idiograms. At higher resolution,
however, an idiogram depicting only patterns of black and white bands becomes difficult to
use. Therefore, the ISCN (1981) 850-band idiogram has been replaced by previously pub­
lished idiograms that are based on measurements of trypsin-Giemsa bands on prometaphase
chromosomes and include five different shades of staining intensities to facilitate orientation
among the large number of bands (Francke, 1981, 1994).
The ISCN (2005) added the 300- and 700-band idiograms as additional references. The
idiograms, which show a G-band pattern, are provided to represent the position of bands in
G-, Q- and R-stained preparations. Although the appearance of bands visualized by G-stain-
ing may differ from that revealed by R-staining (Fig. 6), the sequence of the bands is the same.
Two kinds of variable regions are indicated by different cross-hatching patterns, one in­
volving the pericentromeric heterochromatin regions on all chromosomes and the other in­
volving the variable regions Iq 12, 3ql 1.2, 9ql2, 16q 11.2, 19p 12, 19ql2, Yql2, and the short
arms of all acrocentric chromosomes. The representations of these variable regions are not

Normal Chromosomes Cytogenet Genome Res 2016;149:1-140 13

DOI: 10.1159/000445813
 Table 2. Examples of the code used to describe banding techniques. In this one-, two-, or three-letter code, the
first letter denotes the type of banding, the second letter the general technique, and the third letter the stain.

Q Q-bands
QF Q-bands by fluorescence
QFQ Q-bands by fluorescence using quinacrine
QFH Q-bands by fluorescence using Hoechst 33258
G G-bands
GT G-bands by trypsin
GTG G-bands by trypsin using Giemsa
GTL G-bands by trypsin using Leishman
GTW G-bands by trypsin using Wright
GAG G-bands by acetic saline using Giemsa
C C-bands
CB C-bands by barium hydroxide
CBG C-bands by barium hydroxide using Giemsa
R R-bands
RF R-bands by fluorescence
RFA R-bands by fluorescence using acridine orange
RH R-bands by heating
RHG R-bands by heating using Giemsa
RB R-bands by BrdU
RBG R-bands by BrdU using Giemsa
RBA R-bands by BrdU using acridine orange
DA-DAPI DAPI-bands by Distamycin A and 4',6-diamidino-2-phenylindole

based on measurements. Banded structures can be seen within the variable regions, in par­
ticular in lql2, 9ql2 and Yql2, but since they are variable they have not been detailed in the
idiograms. Normal chromosome variants are discussed in more detail in Chapter 7.
The lowest band number of 10 is assigned to the centromere (not shown on idiograms).
The adjacent heterochromatic regions carry band designations of 11,11.1 or 11.11 depending
on the level of resolution.
One problem in assigning numbers to euchromatic sub-bands is that in G-banded prepara­
tions new G-bands appear to arise by subdivision of darkly stained G-bands on less extended
chromosomes, while in R-staining preparations the dark R-bands appear to split. These in­
terpretations of band to sub-band relationships would lead to different number assignments.
Therefore, in assigning sub-band numbers, arbitrary decisions were made for the purposes of
nomenclature only that should not be interpreted as statements about chromosome physiol­
ogy. Examples of G- and R-banded chromosomes at successive stages of resolution are shown
in Fig. 6a and b. In addition, G- and R-banded metaphase chromosomes at approximately
the 550-band level and their diagrammatic representation (modified from ISCN 1985) are
illustrated in a detachable foldout on the inside of the backcover.

2.5 Molecular Basis of Banding

Chromosome bands reflect the functional organization of the genome that regulates DNA
replication, repair, transcription, and genetic recombination. The bands are large structures,
each approximately 5 to 10 megabases of DNA that may include hundreds of genes. The mo­
lecular basis of banding methods is known to involve nucleotide base composition, associated
proteins, and genome functional organization. In general, Giemsa-positive bands (G-dark

14 Cytogenet Genome Res 2016;149:1-140 ISCN 2016

DOI: 10.1159/000445813
Table 3. Bands serving as landmarks that divide the chromosomes into cytologically defined regions. The omis­
sion of an entire chromosome or chromosome arm indicates that either both arms or the arm in question consists
of only one region, delimited by the centromere and the end of the chromosome arm.

Chromosome Number Landmarks3

of
Number Arm regions

1 P 3 Proximal band of medium intensity (21), median band of medium intensity (31)
q 4 Proximal negative band (21) distal to variable region, median intense band
(31), distal band of medium intensity (41)
2 p 2 Median negative band (21)
q 3 Proximal negative band (21), distal negative band (31)
3 p 2 Median negative band (21)
q 2 Median negative band (21)
4 q 3 Proximal negative band (21), distal negative band (31)
5 q 3 Median band of medium intensity (21), distal negative band (31)
6 p 2 Median negative band (21)
q 2 Median negative band (21)
7 p 2 Distal band of medium intensity (21)
q 3 Proximal band of medium intensity (21), median band of medium intensity (31)
8 p 2 Median negative band (21)
q 2 Median band of medium intensity (21)
9 p 2 Median intense band (21)
q 3 Median band of medium intensity (21), distal band of medium intensity (31)
10 q 2 Proximal intense band (21)
11 q 2 Median negative band (21)
12 q 2 Median band of medium intensity (21)
13 q 3 Median intense band (21), distal intense band (31)
14 q 3 Proximal intense band (21), distal band of medium intensity (31)
15 q 2 Median intense band (21)
16 q 2 Median band of medium intensity (21)
17 q 2 Proximal negative band (21)
18 q 2 Median negative band (21)
21 q 2 Median intense band (21)
X p 2 Proximal band of medium intensity (21)
q 2 Proximal band of medium intensity (21)

a The numbers in parentheses are the region and band numbers as shown in Fig. 5.

bands, R-light bands) are AT-rich, late replicating, and gene poor; whereas, Giemsa-negative
bands (G-light bands, R-dark bands) are CG-rich, early replicating, and relatively gene rich.
Centromeric DNA and pericentromeric heterochromatin, composed of ot-repetitive DNA
and various families of repetitive satellite DNA, are easily detected by C-banding. The telo­
mere is composed of 5 to 20 kb of tandem hexanucleotide minisatellite repeat units, TTAGGG,
and stains darkly by T-banding. The 18S and 28S ribosomal RNA genes are clustered togeth­
er in large arrays containing about 40 copies of each gene. These are located on the acrocen­
tric short arms, at the nucleolar organizer regions or NORs, and are detected by silver staining.

Normal Chromosomes Cytogenet Genome Res 2016;149:1-140 15

DOI: 10.1159/000445813
Fig. 5. Idiograms of G-banding patterns for normal human chromosomes at five different levels of resolu­
tion. From the left, chromosomes in each group represent a haploid karyotype of approximately 300-, 400-, 550-,
700-, and 850-band levels. The location and width of bands are not based on any measurements. The dark G-
bands correspond to bright Q-bands, with the exception of the variable regions. The numbering of R-banded
chromosomes is exactly the same, with a reversal of light and dark bands. While the band numbers are exactly
the same, the relative widths of euchromatic bands are based on measurements and the staining intensities reflect

16 Cytogenet Genome Res 2016;149:1-140 ISCN 2016

DOI: 10.1159/000445813
GTG bands (Francke, 1981, 1994). The idiograms of the Y chromosome are according to observations of Mage-
nis and Barton (1987). While the number of bands on the euchromatic portion of the long arm has been expand­
ed, the designations for light versus dark bands have been maintained. The 400-, 550-, and 850-band idiograms
correspond to the ISCN (1995) nomenclature. The 300- and 700-band idiograms, new to ISCN (2005), were pro­
vided by N.L. Chia.

Normal Chromosomes Cytogenet Genome Res 2016;149:1-140 17

DOI: 10.1159/000445813
 3

Fig. 5 continued (see legend on pp 16-17)

18 Cytogenet Genome Res 2016;149:1-140 ISCN 2016

DOI: 10.1159/000445813
Normal Chromosomes Cytogenet Genome Res 2016;149:1-140 19
DOI: 10.1159/000445813
Fig. 5 continued (see legend on pp 16-17)

20 Cytogenet Genome Res 2016;149:1-140 ISCN 2016

DOI: 10.1159/000445813
p

Normal Chromosomes Cytogenet Genome Res 2016;149:1-140 21

DOI: 10.1159/000445813
22 Cytogenet Genome Res 2016;149:1-140 ISCN 2016
DOI: 10.1159/000445813
Fig. 5 continued (see legend on pp 16-17)

Normal Chromosomes Cytogenet Genome Res 2016;149:1-140 23

DOI: 10.1159/000445813
24 Cytogenet Genome Res 2016;149:1-140 ISCN 2016
DOI: 10.1159/000445813
 14

Fig. 5 continued (see legend on pp 16-17)

Normal Chromosomes Cytogenet Genome Res 2016;149:1-140 25

DOI: 10.1159/000445813
26 Cytogenet Genome Res 2016;149:1-140 ISCN 2016
DOI: 10.1159/000445813
 13.3

13.2
13.13
13.12
13.11

13.31
13.32
13.33

13.41
13.42
13.43

13.2
13.31
13.32 1ZZZ
13.33

Fig. 5 continued (see legend on pp 16-17)

Normal Chromosomes Cytogenet Genome Res 2016;149:1-140 27

DOI: 10.1159/000445813
 22

Fig. 5 continued (see legend on pp 16-17)

28 Cytogenet Genome Res 2016;149:1-140 ISCN 2016

DOI: 10.1159/000445813
Normal Chromosomes Cytogenet Genome Res 2016;149:1-140 29
DOI: 10.1159/000445813
Fig. 6. (a) G-banded chromosomes arranged in increasing order of resolution from approximately the 500- to the
900-band levels. (Courtesy of Dr. E. Magenis.)

30 Cytogenet Genome Res 2016;149:1-140 ISCN 2016

DOI: 10.1159/000445813
Normal Chromosomes Cytogenet Genome Res 2016;149:1-140 31
DOI: 10.1159/000445813
 Fig. 6. (b) R-banded chromosomes arranged in increasing order of resolution from approximately the 400- to
the 850-band levels. (Courtesy of Dr. E. Magenis.)

32 Cytogenet Genome Res 2016;149:1-140 ISCN 2016

DOI: 10.1159/000445813
Normal Chromosomes Cytogenet Genome Res 2016;149:1-140 33
DOI: 10.1159/000445813
3 Symbols and Abbreviated Terms

All symbols and abbreviated terms used in the description of chromosomes and chromosome
abnormalities are listed below. Section references are given within parentheses for terms that
are defined in greater detail in the text. When more than one symbol or abbreviation is used
together, a space is placed between the two (e.g. psu die). When the symbol or abbrevia­
tion precedes the total number of chromosomes and no parenthesis is present, a space is
placed between the symbol or abbreviation and the number of chromosomes (e.g. mos
47,XXX[25]/46,XX[5]). There is no space when a symbol or abbreviation immediately precedes
or follows a parenthesis.

Al First meiotic anaphase (12.1)

All Second meiotic anaphase (12.1)
ace Acentric fragment (9.2.12, 10.2.1)
add Additional material of unknown origin (9.2.1, 16.2)
amp Denotes an amplified signal (13.3.2)
approximate sign (~) Denotes intervals and boundaries of a chromosome segment or number of chromosomes,
fragments, or markers (5.2); denotes a range of number of copies of a chromosomal re­
gion when the exact number cannot be determined (14.2)
arr Microarray (14.2)
arrow (-► or ->) From - to, in detailed system (4.3.2.1)
b Break (10.1.1, 10.2.1)
brackets, angle (< >) Surround the ploidy level (8.1)
brackets, square ([ ]) Surround number of cells or genome build (4.1, 11.1.2, 14)
c Constitutional anomaly (4.1, 8.3, 11.3)
cen Centromere (2.3.2, 4.3.2.1, 16.2)
cgh Comparative genomic hybridization (13.6)
chi Chimera (4.1)
chr Chromosome (10.2)
cht Chromatid (10.1)
colon, single (:) Break, in detailed system (4.3.2.1)
colon, double (::) Break and reunion, in detailed system (4.3.2.1, 16.2)
comma (,) Separates chromosome numbers, sex chromosomes, and chromosome abnormalities
(4.1, 14.2); separates locus designations (13.2, 13.3.1)
con Connected signals (13.3.2)
cp Composite karyotype (11.1.5)
cth Chromothripsis (14.2.2)
curly braces ({)) Indicate differences in the altered segment compared to the reference sequence in dupli­
cations, inversions, conversions, insertions, etc. (16.2)
ex Complex rearrangements (10.1.1, 14.2.2)
decimal point (.) Denotes sub-bands (2.3.2)
del Deletion (9.2.2, 16.3.1)
der Derivative chromosome (4.4, 9.2.3, 9.2.17.2, 9.2.17.3, 16.3.2)
dia Diakinesis (12.1)
die Dicentric (9.2.4)
dim Diminished (13.2.1, 13.5)

34 Cytogenet Genome Res 2016;149:1-140 ISCN 2016

DOI: 10.1159/000445813
dip Diplotene (12.1)
dis Distal (12.1)
dit Dictyotene (12.1)
dmin Double minute (9.2.12, 10.2.1)
dn Designates a chromosome abnormality that has not been inherited (de novo) (4.1)
dup Duplication (9.2.5, 16.3.3)
e Exchange (10.1.1, 10.2.1)
end Endoreduplication (4.1)
enh Enhanced (13.2.1, 13.5)
equal sign (=) Number of chiasmata (12.1)
fem Female (12.1)
fib Extended chromatin/DNA fiber (13.4)
fis Fission, at the centromere (9.2.6)
fra Fragile site (7.2, 9.2.7)
g Gap (10.1.1, 10.2.1)
GRCh Genome Reference Consortium human; human genome build or assembly (4.3,14,15,16)
h Heterochromatin, constitutive (7.1.1)
hmz Homozygous, homozygosity; used when one or two copies of a genome are detected, but
previous, known heterozygosity has been reduced to homozygosity through a variety of
mechanisms, e.g. loss of heterozygosity (LOH) (14.2.1)
hsr Homogeneously staining region (9.2.8)
htz Heterozygous, heterozygosity (14.2.1)
i Isochromosome (9.2.11)
idem Denotes the stemline karyotype in a subclone (11.1.4)
ider Isoderivative chromosome (9.2.3)
idic Isodicentric chromosome (9.2.4, 9.2.11) v
inc Incomplete karyotype (5.4)
inh Inherited (4.1)
ins Insertion (9.2.9, 16.3.4)
inv Inversion (9.2.10, 16.2, 16.3.5)
ish In situ hybridization; when used without a prefix applies to metaphase or prometaphase
chromosomes of dividing cells (13.2)
lep Leptotene (12.1)
MI First meiotic metaphase (12.1)
Mil Second meiotic metaphase (12.1)
mal Male (12.1)
mar Marker chromosome (9.2.12)
mat Maternal origin (4.1)
med Medial (12.1)
min Minute acentric fragment (10.2.1)
minus sign (-) Loss (4.1, 8.1); decrease in length (7.1.1); locus absent from a specific chromosome (13.2)
mos Mosaic (4.1)
multiplication sign (x) Multiple copies of rearranged chromosomes (9.3); designates aberrant polyploidy clones
in neoplasias (11.1.4); with number to indicate number of signals seen (13.2, 13.3.1);
multiple copies of a chromosome or chromosomal region (14.2)
neg No presence of the rearrangement for which testing was conducted (15.3)
neo Neocentromere (9.2.13)
nuc Nuclear or interphase (13.3)
oom Oogonial metaphase (12.1)
or Alternative interpretation (5.3)
P Short arm of chromosome (2.3.2)
PI First meiotic prophase (12.1)
pac Pachytene (12.1)
parentheses () Surround structurally altered chromosomes and breakpoints (4.1); surround chromo­
some numbers, X, and Y in normal and abnormal results; surround coordinates (or
nucleotide positions) in abnormal result (14.2)
pat Paternal origin (4.1)
pcc Premature chromosome condensation (10.2.1)
ped Premature centromere division (10.2.1)
pep Partial chromosome paint (13.8)
period (.) Separates various techniques (13.2, 14.2, 16.2, 16.3)
Ph Philadelphia chromosome (9.2.3)

Symbols and Abbreviated Terms Cytogenet Genome Res 2016;149:1-140 35

DOI: 10.1159/000445813
plus sign, single (+) Additional normal or abnormal chromosomes (4.1, 8.1); increase in length (7.1.1);
locus present on a specific chromosome (13.2)
plus sign, double (++) Two hybridization signals or hybridization regions on a specific chromosome (13.2)
pos Detection of a rearrangement for which testing was conducted (15.3)
prx Proximal (12.1)
ps Satellited short arm of chromosome (7.1.1, 7.1.2)
psu Pseudo- (9.2.4)
pter Terminal end of the short arm
pvz Pulverization (10.2.1)
q Long arm of chromosome (2.3.2)
qdp Quadruplication (9.2.14)
qr Quadriradial (10.1.1)
qs Satellited long arm of chromosome (7.1.1, 7.1.2)
qter Terminal end of the long arm
question mark (?) Questionable identification of a chromosome or chromosome structure (5.1)
r Ring chromosome (9.2.15, 16.3.6)
rec Recombinant chromosome (4.5, 9.2.3)
rev Reverse, including comparative genomic (13.5)
rob Robertsonian translocation (9.2.17.3)
Roman numerals I-IV Indicate univalent, bivalent, trivalent, and quadrivalent structures (12.1)
rsa Region-specific assay (15)
s Satellite (7.1.1, 7.1.2)
see Sister chromatid exchange (10.1.1)
sdl Sideline (11.1.4)
semicolon (;) Separates altered chromosomes and breakpoints in structural rearrangements involving
more than one chromosome (4.1, 4.3.1, 12.1); separates probes on different derivative
chromosomes (13.2)
sep Separated signals (13.3.2)
seq Sequencing (16.2, 16.3)
si Stemline (11.1.4)
slant line, single (/) Separates clones (4.1, 11.1.1, 11.1.6, 11.3), or contiguous probes (13.2, 13.3)
slant line, double (//) Separates chimeric clones (4.1, 13.3.1)
spm Spermatogonial metaphase (12.1)
stk Satellite stalk (7.1.1, 7.1.2)
subtel Subtelomeric region (13.2.2)
t Translocation (9.2.17, 16.3.7)
tas Telomeric association (9.2.16)
ter Terminal (end of chromosome) or telomere (4.3.2.1)
tr Triradial (10.1.1)
trc Tricentric chromosome (9.2.18)
trp Triplication (9.2.19)
underlining (single) Used to distinguish homologous chromosomes (4.1, 9.2.3, 9.2.17.1)
underscore (_) Used to indicate range of nucleotide positions (14.1, 15.1, 16.2)
upd Uniparental disomy (8.4, 14.2.1)
var Variant or variable region (2.4, 7.1)
wcp Whole chromosome paint (13.2)
xma Chiasma(ta) (12.1)
zyg Zygotene (12.1)

36 Cytogenet Genome Res 2016;149:1-140 ISCN 2016

DOI: 10.1159/000445813
4 Karyotype Designation

4.1 General Principles

In the description of a karyotype the first item to be recorded is the total number of chromosomes,
including the sex chromosomes, followed by a comma (,). The sex chromosome constitution is
given next. The autosomes are specified only when an abnormality is present. Thus, the normal
human karyotype is designated as follows:

46,XX Normal female

46,XY Normal male

In the description of chromosome abnormalities, sex chromosome aberrations are presented first,
followed by abnormalities of the autosomes listed in numerical order irrespective of aberration
type. Each abnormality is separated by a comma. Details regarding the order of chromosome
abnormalities are presented in Chapter 6.
Letter designations are used to specify rearranged (i.e., structurally altered) chromosomes.
All symbols and abbreviations used to designate chromosome abnormalities are listed in
Chapter 3. In single chromosome rearrangements, the chromosome involved in the change is
specified within parentheses ( ) immediately following the symbol identifying the type of re­
arrangement, e.g., inv(2), del(4), r(18). If two or more chromosomes have been altered, a semi­
colon (;) is used to separate their designations. If one of the rearranged chromosomes is a sex
chromosome, then it is listed first; otherwise, the chromosome having the lowest number is
always specified first, e.g., t(X;3) or t(2;5). An exception to this rule involves certain three-
break rearrangements in which part of one chromosome is inserted at a point of breakage in
another chromosome. In this event, the receptor chromosome is specified first, regardless of
whether it is a sex chromosome or an autosome with a number higher or lower than that of
the donor chromosome, e.g., ins(5;2). For details, see Section 9.2.9.
For balanced translocations involving three separate chromosomes, with one breakpoint
in each chromosome, the rule is still followed that the sex chromosome or autosome with the
lowest number is specified first. The chromosome listed next is the one that receives a segment
from the first chromosome, and the chromosome specified last is the one that donates a seg­
ment to the first listed chromosome. The same rule is followed in four-break and more com­
plex balanced translocations (see also Section 9.2.17.1). In order to distinguish homologous
chromosomes, one of the numerals may be underlined (single underlining). The derivative
chromosomes produced by reciprocal translocations should be described using the conven­
tions outlined in Section 9.2.3.

Karyotype Designation Cytogenet Genome Res 2016;149:1-140 37

DOI: 10.1159/000445813
 A plus (+) or minus (-) sign is placed before a chromosome or an abnormality designation
to indicate additional or missing, normal or abnormal chromosomes, e.g., +21, -7, +der(2);
for details, see Section 8.1. The + or - sign placed after a chromosome arm symbol (p or q)
may be used in text to indicate an increase or decrease in the length of a chromosome arm
(e.g., 4p+, 5q-) but should not be used in the description of karyotypes. See also Sections 9.2.1
and 9.2.2. Variations in length of heterochromatic segments, satellites, and satellite stalks are
distinguished from increases or decreases in arm length as a result of other structural altera­
tions by placing a plus or minus sign after the appropriate symbol for these normal variable
chromosome features (see Section 7.1). The use of + and - signs in the description of results
obtained by in situ hybridization is described in Chapter 13.
When normal chromosomes are replaced by structurally altered chromosomes, the normal
ones should not be recorded as missing (see Section 9.1). In the description of karyotypes
containing dicentric chromosomes or derivative chromosomes resulting from whole-arm
translocations, the abnormal chromosomes by convention replace both normal chromosomes
involved in the formation of the dicentric chromosome or derivative chromosome. Thus, in
these situations the two missing chromosomes are not specified (see Sections 9.2.4 and
9.2.17.2).
The multiplication sign (x) can be used to describe multiple copies of a rearranged chromo­
some but should not be used to denote multiple copies of normal chromosomes (see Section
9.3).
Uncertainty in chromosome or band designation may be indicated by a question mark (?)
or an approximate sign (~). The term or is used to indicate alternative interpretations of an
aberration. For details, see Chapter 5.
The karyotype designations of different clones are separated by a slant line (/). Square
brackets [ ], placed after the karyotype description, are used to designate the absolute number
of cells in each clone (see Section 11.1.2). In order to distinguish between a mosaic (cell lines
originating from the same zygote) and a chimera (cell lines originating from different zygotes)
in constitutional cases, the symbol mos or chi, respectively, preceding the karyotype designa­
tions, may be used; for example, mos 45,X/46,XX and chi 46,XX/46,XY. In most instances
the triplets will be needed only for the initial description in any report; subsequently, the
simple karyotype designation may be used. A space should follow mos or chi. All abbrevia­
tions that precede a number will have a space that follows. A normal diploid clone, when
present, is always listed last, e.g., mos 47,XY,+21/46,XY; mos 47,XXY/46,XY. If
there are several abnormal clones, they are presented according to their size; the largest first,
then the second largest, and so on, e.g., mos 45,X[15]/47,XXX[10]/46,XX[23]. Likewise, the
largest clone in chimeras is presented first, e.g., chi 46,XX[25]/46,XY[10]. When equivalent
numbers of cells are found in two cell lines, one of which has a numerical abnormality and
the other of which has a structural abnormality, the numerical is listed first, e.g.,
45, X[25]/46,X,i(X)(qlO)[25]. When both clones have numerical abnormalities they are listed
according to the altered autosome number, e.g., 47,XX,+8[25]/47,XX,+21[25]; a clone with a
sex chromosome abnormality always comes first, e.g., 47,XXX[25]/47,XX,+21[25]. For order
of clone presentation in neoplasia, see Sections 11.1.4 and 11.1.6.
In chimerism secondary to bone marrow transplant, the recipient cell clones are listed first,
followed by the donor cell line(s). The recipient and donor cell line(s) are separated by a dou­
ble slant line (//) as shown in the following examples.

46, XY[3]//46,XX[17]
Three cells from the male recipient were identified along with 17 cells from the female donor.

38 Cytogenet Genome Res 2016;149:1-140 ISCN 2016

DOI: 10.1159/000445813
Fig. 7. Metaphase chromosomes in a cell which has undergone endoreduplication. (Courtesy of Dr. N. Mandahl.)

46,XY,t(9;22)(q34;q 11.2)[4]//46,XX[ 16]

Four recipient cells showing a 9;22 translocation were identified along with 16 donor cells.

//46,XX[20]
All 20 cells were identified as derived from the female donor.

46,XY[20]//
All 20 cells were identified as derived from the male recipient.

A haploid or polyploid karyotype will be evident from the chromosome number and from the
further designations, e.g., 69,XXY. All chromosome changes should be expressed in relation
to the appropriate ploidy level (see Sections 8.1 and 9.1), e.g., 70,XXY,+21.
Endoreduplication is the replication of the chromosomes without chromatid separation or
cytokinesis (Fig. 7). An endoreduplicated metaphase cell is indicated by the abbreviation end
preceding the karyotype designation, e.g., end 46,XX.
When it is known that a particular chromosome involved in an aberration has been inher­
ited, the term inh may be used, e.g., 46,XX,t(5;6)(q34;q23)inh. When it is known that the
aberration is inherited from the mother or the father, the most complete information is evi­
dent by the use of the abbreviation mat or pat, respectively, immediately following the desig­
nation of the abnormality, e.g., 46,XX,t(5;6)(q34;q23)mat,inv(14)(ql2q31)pat. If it is known
that the parents’ chromosomes are normal with respect to the abnormality, the abnormality

Karyotype Designation Cytogenet Genome Res 2016;149:1-140 39

DOI: 10.1159/000445813
 may be designated de novo (dn), e.g., 46,XY,t(5;6)(q34;q23)mat,inv(14)(ql2q31)dn. When
dn follows another abbreviation, a space is inserted, e.g., 47,XY,+mar dn[14]/46,XY[16].
The same rules for designating chromosome aberrations are followed in the description of
constitutional and acquired chromosome aberrations. Terms and recommendations related
to abnormalities seen in neoplasia are described in Chapter 11. When an acquired chromo­
some abnormality is found in an individual with a constitutional chromosome anomaly, the
latter is indicated by the letter c immediately after the constitutional abnormality designation
(see Sections 8.3 and 11.3).
In the interest of clarity, complex rearrangements necessitating lengthy descriptions should
be written out in full the first time they are used in a report. An abbreviated version may be
used subsequently, provided it is clearly defined immediately after the complete notation.
Nomenclature guidelines for meiotic chromosomes are presented in Chapter 12.

4.2 Specification of Breakpoints

The location of any given breakpoint is specified by the band in which that break has occurred.
Since it is not possible at present to define band interfaces accurately, a break suspected to be at
an interface between two bands is assigned arbitrarily to the higher of the two band numbers, i.e.,
the number of the band more distal to the centromere.
A given break may sometimes appear to be located in either of two consecutive bands. A
similar situation may occur when breaks at or near an interface between two bands are studied
with two or more techniques. In this event, the break can be specified by both band numbers
separated by the term or, e.g., Iq23 or q24, indicating a break in either band lq23 or band lq24
(see also Section 5.3). If a break can be localized to a region but not to a particular band, only
the region number may be specified, e.g., Ipl. Uncertainty about breakpoint localization may
also be indicated by a question mark, e.g., Ipl? (see Section 5.1). If the breakpoint can be as­
signed only to two adjacent regions, both suspected regions should be indicated, e.g., Iq2 or q3.
For the use of the approximate sign to express uncertainty, see Section 5.2. Breakpoints within
the same rearrangement or karyotype string can be at different levels of resolution reflecting the
precision of the karyogram.
When an extra copy of a rearranged chromosome is present, the breakpoints do not need
to be repeated; the breakpoints are specified only at the first time they appear in the karyo­
type:
48,XX,+1 ,+der( 1 )t( 1; 16)(p 13;q 13), t( 1; 16)

4.3 Designating Structural Chromosome Aberrations by Breakpoints and

Band Composition

Two systems for designating structural abnormalities exist. One is a short system in which the
nature of the rearrangement and the breakpoint(s) are identified by the bands or regions in which
the breaks occur. Because of the conventions built into this system, the band composition of the
abnormal chromosomes can readily be inferred from the information provided in the symbolic
description. For very complex abnormalities, especially in tumor cells, the short system may be
inadequate or ambiguous, but it will always provide information on all bands involved in the
generation of an abnormal chromosome. The other is a detailed system which, besides identifying
the type of rearrangement, defines each abnormal chromosome in terms of its band composition.
The notation used to identify the rearrangement and the method of specifying the breakpoints
are common to both systems (see Sections 4.3.1 and 4.3.2).

40 Cytogenet Genome Res 2016;149:1-140 ISCN 2016

DOI: 10.1159/000445813
 The genome build or assembly must be specified when designating an aberration by nucle­
otide position defined by microarray, region-specific assay or sequencing (see Sections 14.1,
15.1 and 16.2).

4.3.1 Short System for Designating Structural Chromosome Aberrations

In this system, structurally altered chromosomes are defined only by their breakpoints. The
breakpoints are specified within parentheses immediately following the designation of the
type of rearrangement and the chromosome(s) involved. The breakpoints are identified by
band designations and are listed in the same order as the chromosomes involved. No semi­
colon is used between breakpoints in single chromosome rearrangements.

4.3.1.1 Two-Break Rearrangements

When both arms of a single chromosome are involved in a two-break rearrangement, the break­
point in the short arm is always specified before the breakpoint in the long arm.
46,XX,inv(2)(p21q31)

When two breaks occur within the same arm, the breakpoint more proximal to the centromere
is specified first.
46,XX,inv(2)(pl3p23)
46,XX,inv(2)(qll.2q32)

When two chromosomes are involved, the chromosome having the lowest number is always
listed first; however, if one of the rearranged chromosomes is a sex chromosome this is listed
first.

46,XY,t(12;16)(qI3;pl 1.1)
46,X,t(X;I8)(pl I.l;ql 1.1)

4.3.1.2 Three-Break Rearrangements

An exception to the rule that sex chromosomes and autosomes with the lowest number are
specified first involves three-break rearrangements in which part of one chromosome is in­
serted into another chromosome. In that event, the donor chromosome is listed last, even if
it is a sex chromosome or an autosome with a lower number than that of the receptor chro­
mosome.

46,X,ins(5;X)(pl4;q21q25)
46,XY,ins(5;2)(pl4;q22q32)

When an insertion within a single chromosome occurs, the breakpoint at which the chromo­
some segment is inserted is always specified first. The remaining breakpoints are specified in
the same way as in a two-break rearrangement, i.e., the more proximal breakpoint of the in­
serted segment is specified first and the more distal one last if the insertion is direct and vice
versa if it is inverted.

Karyotype Designation Cytogenet Genome Res 2016;149:1-140 41

DOI: 10.1159/000445813
 46,XX,ins(2)(ql3pl3p23)
Direct insertion of the short-arm segment between bands 2pl3 and 2p23 into the long arm at band 2ql3.

46,XX,ins(2)(ql3p23pl3)
Inverted insertion of the short-arm segment between bands 2pl3 and 2p23 into the long arm at band 2ql3.
Because the insertion is inverted, band 2p23 is now proximal and band 2pl3 distal to the centromere.

For translocations involving three chromosomes, with one breakpoint in each, the rule is still
followed that the sex chromosome or autosome with the lowest number is given first. The
chromosome listed next is the one that receives a segment from the first chromosome, and
the chromosome specified last is the one that donates a segment to the first chromosome li­
sted.

46,XX,t(9;22;17)(q34;qll.2;q22)
The segment of chromosome 9 distal to 9q34 has been translocated onto chromosome 22 at band 22ql 1.2,
the segment of chromosome 22 distal to 22ql 1.2 has been translocated onto chromosome 17 at 17q22, and
the segment of chromosome 17 distal to 17q22 has been translocated onto chromosome 9 at 9q34.

46,Y,t(X;I5;18)(pl l.l;pl l.l;ql 1.1)

The segment of the X chromosome distal to Xpll.l has been translocated onto chromosome 15 at band
15pl 1.1, the segment of chromosome 15 distal to 15pl 1.1 has been translocated onto chromosome 18 at
18q 11.1, and the segment of chromosome 18 distal to 18q 11.1 has been translocated to Xp 11.1.

4.3.1.3 Four-Break and More Complex Rearrangements

Whenever applicable, the guidelines for three-break rearrangements should be used.

46,XX,t(3;9;22;21)(pl3;q34;qll.2;q21)
The segment of chromosome 3 distal to 3pl3 has been translocated onto chromosome 9 at 9q34, the segment
of chromosome 9 distal to 9q34 has been translocated onto chromosome 22 at 22ql 1.2, the segment of chro­
mosome 22 distal to 22ql 1.2 has been translocated onto chromosome 21 at 21 q21, and the segment of chro­
mosome 21 distal to 21q21 has been translocated onto chromosome 3 at 3pl3.

46,XY,t(5;6)(ql3q23;ql5q23)
Reciprocal translocation of two interstitial segments. The segments between bands 5ql3 and 5q23 of chro­
mosome 5 and between 6ql5 and 6q23 of chromosome 6 have been exchanged.

Unbalanced rearrangements will lead to at least one derivative chromosome and in these situa­
tions the use of the symbol der to describe the derivative chromosome(s) is recommended (see
Section 9.2.3). It will usually not be possible to adequately describe all complex rearrangements
with the short system. The detailed system can always be used to describe any abnormality, ho­
wever complex. Still, it may be necessary to illustrate the rearrangement and/or describe it in
words to ensure complete clarity.

4.3.2 Detailed System for Designating Structural Chromosome Aberrations

Structurally altered chromosomes are defined by their band composition. The conventions
used in the short system are retained in the detailed system, except that an abbreviated de­
scription of the band composition of the rearranged chromosome(s) is specified within the
last parentheses, instead of only the breakpoints. It is acceptable to combine the short system
(4.3.1) and the detailed system for designating complex karyotypes, especially to describe ac­
quired chromosomal abnormalities.

42 Cytogenet Genome Res 2016;149:1-140 ISCN 2016

DOI: 10.1159/000445813
 Fig. 8. Pachytene diagram of a t(2;5)(q21;q31) reciprocal translocation heterozygote used to specify the disjunc-
tional possibilities and derivative chromosome combinations given in Table 4. Letters A, B, C, and D designate
chromosome ends (telomeres). For the sake of simplicity only those two of the four chromatids that are involved
in crossing-over (see Table 4) are indicated. Crosses mark the positions of crossing-over.

4.3.2.1 Additional Symbols

A single colon (:) is used to indicate a chromosome break and a double colon (::)
to indicate break and reunion. In order to avoid an unwieldy description, an arrow (-► or ->),
meaning from - to. is employed. The end of a chromosome arm may be designated either by
its band designation or by the symbol ter (terminal), preceded by the arm designation, i.e.,
pter indicates the end of the short arm and qter the end of the long arm. When it is necessary
to indicate the centromere, the abbreviation cen should be used.

4.3.2.2 Designating the Band Composition of a Chromosome

The description starts at the end of the short arm and proceeds to the end of the long arm,
with the bands being identified in the order in which they occur in the rearranged chromo­
some. If the rearrangement is confined to a single chromosome, the chromosome number is
not repeated in the band description. If more than one chromosome is involved, however, the
bands and chromatid ends are identified with the appropriate chromosome numbers. The
aberrations should be listed according to the breakpoints of the derivative chromosome from
pter to qter and should not be separated by a comma.
If, owing to a rearrangement, no short-arm segment is present at the end of either arm, the
description of the structurally rearranged chromosome starts at the end of the long-arm seg­
ment with the lowest chromosome number. However, if a portion of the proximal short arm

Karyotype Designation Cytogenet Genome Res 2016;149:1-140 43

DOI: 10.1159/000445813
 Table 4. Possible unbalanced gametes derived from segregation of a balanced reciprocal translocation of mater-
nal origin. The pachytene configuration is given in Fig. 8.

Segregation Schematic Chromosomal Karyotype of potential female zygotes

pattern segregants complement of
gametes

Adjacent-1 AB CB 2, der(5) 46,XX,der(5)t(2;5)(q21 ;q31 )mat

AD CD der(2), 5 46,XX,der(2)t(2;5)(q21 ;q31 )mat
Adjacent-2a AB AD 2, der(2) 46,XX,+der(2)t(2;5)(q21 ;q31 )mat,-5
CD CB 5, der(5) 46,XX,-2,+der(5)t(2;5)(q21 ;q31 )mat
AB AB 2,2 46,XX,+2,-5
AD AD der(2), der(2) 46,XX,der(2)t(2;5)(q21 ;q31 )mat,+der(2)t(2;5),-5
CB CB der(5), der(5) 46,XX,-2,der(5)t(2;5)(q21;q31)mat,+der(5)t(2;5)
CD CD 5, 5 46,XX,-2,+5
3:lb AB CD CB 2, 5, der(5) 47,XX,+der(5)t(2;5)(q21 ;q31 )mat
AD der(2) 45,XX,der(2)t(2;5)(q21 ;q 31 )mat,-5
AD CD CB der(2), 5, der(5) 47,XX,t(2;5)(q21 ;q31 )mat,+5
AB 2 45,XX,-5
AB AD CD 2, der(2), 5 47,XX,+der(2)t(2;5)(q21 ;q31 )mat
CB der(5) 45,XX,-2,der(5)t(2;5)(q21 ;q31 )mat
AB AD CB 2, der(2), der(5) 47,XX,+2,t(2;5)(q21 ;q 31 )mat
CD 5 45,XX,-2

a Adjacent-2 disjunction minimally results in the first two unbalanced gametic types shown (AB AD, CD CB).
Crossing-over in the interstitial segments between centromeres and points of exchange is necessary for the
origin of the remaining four types.
b A further eight segregants can occur if there is crossing-over in the interstitial segments, making a total of 12
types of gametes with three chromosomes derived from the translocation quadrivalent.

is present, the description begins with the material on the end of that chromosome arm even
if the recipient segment is from a long arm or from a chromosome with a higher or lower
chromosome number. For use of the detailed system, see examples in Section 9.2.3.

4.4 Derivative Chromosomes

A derivative chromosome is a structurally rearranged chromosome generated by (1) more than

one rearrangement within a single chromosome, e.g., an inversion and a deletion of the same
chromosome, or deletions in both arms of a single chromosome, or (2) rearrangements invol­
ving two or more chromosomes, e.g., the unbalanced product(s) of a translocation. An abnor­
mal chromosome in which no part can be identified is referred to as a marker chromosome
(see Section 9.2.12).
Derivative chromosomes are designated der. The term always refers to the chromosome(s)
that has an intact centromere or neocentromere (Section 9.2.13). The derivative chromosome
is specified in parentheses, followed by all aberrations involved in the generation of the de­
rivative chromosome. The aberrations should be listed according to the breakpoints of the
derivative chromosome from pter to qter and should not be separated by a comma. For ex­
ample, der(l)t(l;3)(p32;q21)t(l;l I)(q25;ql3) specifies a derivative chromosome 1 generated
by two translocations, one involving the short arm with a breakpoint in lp32 and the other
involving the long arm with a breakpoint in lq25.

44 Cytogenet Genome Res 2016;149:1-140 ISCN 2016

DOI: 10.1159/000445813
 p22 p16 q24 p22

-------- rec(2)d u p(2q) i nv(2)(p21 q31)

q24 q32

Fig. 9. Diagram of an inv(2)(p21q31)mat pericentric inversion heterozygote. Bands delimiting the breakpoints
(arrows on original) are shown as black boxes on the short arm and as hatched boxes on the long arm. In the
pachytene diagram, the cross indicates crossing-over within the inversion loop. For the sake of simplicity only
those two of the four chromatids that are involved in crossing-over and give rise to the recombinant chromosomes
are indicated.

Various derivative chromosomes and their designations are presented in Section 9.2.3. As
an illustration of the way derivative chromosomes can be written, a balanced reciprocal trans­
location between chromosomes 2 and 5, 46,XX,t(2;5)(q21;q31), has been assumed and is
represented by the pachytene diagram in Fig. 8. The derivative chromosomes from such a
translocation would be designated der(2) and der(5). Table 4 gives the possible unbalanced
gametes resulting from adjacent-1 and adjacent-2 disjunctions and also from four of the 12
possible 3:1 disjunctions, together with the recommended designations of the karyotypes re­
sulting from syngamy between each unbalanced gametic type and a normal gamete. The full

Karyotype Designation Cytogenet Genome Res 2016;149:1-140 45

DOI: 10.1159/000445813
 karyotype designation needs be written only once in any given publication and then can be
abbreviated. A suggested abbreviation for the first designated karyotype in Table 4, for ex­
ample, would be 46,XX,der(5)mat.

4.5 Recombinant Chromosomes

A recombinant chromosome is a structurally rearranged chromosome with a new segmental

composition resulting from meiotic crossing-over between a displaced segment and its nor­
mally located counterpart in certain types of structural heterozygotes.
Whereas derivative chromosomes are products of the original rearrangement and segregate
at meiosis without further change, recombinant chromosomes arise de novo during gameto­
genesis in appropriate structural heterozygotes as predictable consequences of crossing-over
in a displaced segment.
Recombinant chromosomes are designated by the symbol rec. The recombinant chromo­
some is specified in parentheses immediately following the symbol. The chromosome desig­
nation used is that which indicates the origin of the centromere of the particular recombinant
chromosome.
Recombinant chromosomes are most likely to originate from crossing-over in inversion or
insertion heterozygotes. To exemplify the method of designating these chromosomes, a mater­
nal pericentric inversion of chromosome 2, 46,XX,inv(2) (p21q31), is shown diagrammatically
in Fig. 9. In this case, crossing-over results in a duplication (dup) of 2p in one recombinant
chromosome and of 2q in the other. The respective karyotype could be recorded as 46,XX,rec(2)
dup(2p)inv(2)(p21q31)mat and 46,XX,rec(2)dup(2q)inv(2)(p21q31)mat, specifying, in the
first example, a duplication from 2pter to 2p21 and a deletion from 2q31 to 2qter and, in the
second example, a duplication from 2q31 to 2qter and a deletion from 2pter to 2p21. Note
that, in analogy with the nomenclature for derivative chromosomes, the aberrations following
the designation rec are not separated by a comma. The symbol rec should only be used when
a parental inversion or insertion has been identified. If this is not known, an apparent recom­
binant chromosome should be written as a derivative. For example, 46,XX,rec(2)dup(2p)
inv(2)(p2 lq3 l)mat designates a recombinant from a known maternal inversion. 46,XX,der(2)
(pter->q31::p21->pter) designates a derivative chromosome with duplication of pter->p21
and deletion of q31 ->qter. The net imbalance is the same in the two examples, with the first
derived from a known inversion carrier.

46 Cytogenet Genome Res 2016;149:1-140 ISCN 2016

DOI: 10.1159/000445813
5 Uncertainty in Chromosome or Band
Designation

5.1 Questionable Identification

A question mark (?) indicates questionable identification of a chromosome or chromosome

structure. It is placed either before the uncertain item, or it may replace a chromosome, region,
or band designation (see also examples in Section 9.2.3).

45, XX,-?21
A missing chromosome, probably No. 21.

47,XX,+?8
An additional chromosome, probably No. 8.

46, XX,del(l)(q2?)
The break in the long arm of chromosome 1 is in region lq2, but it has not been possible to determine the
band within that region.

46,XY,del(l)(q2?3)
The break in the long arm of chromosome 1 is in region lq2, probably in band lq23, but this is uncertain.

46,XX,del(l)(q?2)
The break is in the long arm of chromosome 1, probably in region lq2.

46,XY,del(l)(q?23)
It is uncertain whether the break in the long arm of chromosome 1 is in region lq2. If so, the break is in band
lq23.

46,XX,del(l)(q?)
The break is in the long arm of chromosome 1, but neither the region nor the band can be identified. This
aberration is often described as lq-, a notation that may be useful in text but should not be used in karyotype
nomenclature.

46,XY,?del(l)(q23)
A possible deletion in chromosome 1, band lq23, but all items, including the deletion, are uncertain.

46 ,XX,der( 1 )?t( 1; 3)(p22;q 13)

The der(l) has probably resulted from a t(l;3). If so, the breaks are in bands lp22 and 3ql3.

Uncertainty in Chromosome or Cytogenet Genome Res 2016;149:1-140 47

Band Designation DOI: 10.1159/000445813
5.2 Uncertain Breakpoint Localization or Chromosome Number

An approximate sign (~) is used to denote intervals and to express uncertainty about break­
point localizations in that it indicates the boundaries of a chromosome segment in which the
breaks may have occurred.

46,XX,del(l)(q21~24)
A terminal deletion of the long arm of chromosome 1 with a breakpoint within the segment Iq21-q24, i.e.,
the breakpoint may be in band lq21, lq22, lq23 or lq24.

46,XY,dup(l)(q22-24q44)
A duplication in the long arm of chromosome 1; the proximal breakpoint is in band lq22, lq23 or lq24.

46,XX,t(3; 12)(q27—29;q 13—15)

Both breakpoints in this translocation are uncertain; in chromosome 3 the breakpoint may be in bands 3q27,
3q28 or 3q29 and in chromosome 12 in bands 12ql3, 12ql4 or 12ql5.

43-47,XX,...
The chromosome number is within the interval 43-47.

5.3 Alternative Interpretation

The symbol or is used to indicate alternative interpretations of an aberration. Note that there
should be a space before and after the symbol.

46,XX,add(19)(pl3 or ql3)
Additional material of unknown origin attached to either 19p 13 or 19ql 3 (see Section 9.2.1).

46,XY,del(8)(q21.1) or i(8)(p 10)

A deletion of the long arm of a chromosome 8 with a breakpoint in 8q21.1 or an isochromosome for the short
arm of chromosome 8.

46,XX,t( 12; 14)(q 15;q24) or t( 12; 14)(q 13;q22)

The two alternative interpretations of the t( 12; 14) give rise to identical-looking derivative chromosomes. This
is in principle a different situation than t(12;14)(ql3~15;q22~24), which means that the breakpoint locali­
zations in the t(12; 14) are less certain and a variety of combinations are possible.

46,XY,der(l)t(l;10)(q44;q22) or dup(l)(q32q44)
A rearranged chromosome 1 that may have originated either from a translocation to 1 q44 of the distal seg­
ment of the long arm of chromosome 10 with a breakpoint in 10q22, or from a duplication of the segment
from lq32 to lq44.

5.4 Incomplete Karyotype

The symbol inc denotes that the karyotype presented is incomplete, usually because of poor
chromosome quality. The karyotype is thus likely to contain unidentified structural or nume­
rical changes in addition to the abnormalities listed. The symbol inc is placed at the end of
the nomenclature string, after the description of identifiable abnormalities.

46,XX,del(l)(q21),inc[4]
It has only been possible to identify a clonally occurring deletion of the long arm of chromosome 1, but anal­
ysis is incomplete. Without the symbol inc, the del(l)(q21) would be the sole anomaly present in this tumor.

48 Cytogenet Genome Res 2016;149:1-140 ISCN 2016

DOI: 10.1159/000445813
53—57,XY,+ l,+3,+6,t(9;22)(q34;ql 1.2),+21,+3mar,inc[cpl0]
This abnormal karyotype has, in addition to the abnormalities presented that include three marker chromo­
somes, other changes that could not be identified, cp indicates a composite karyotype from 10 cells (see Sec­
tion 11.1.5).

Every attempt should be made to present karyotypes in which each abnormality has been
identified. The use of inc should be restricted to exceptional situations.

Uncertainty in Chromosome or Cytogenet Genome Res 2016;149:1-140 49

Band Designation DOI: 10.1159/000445813
Order of Chromosome Abnormalities in the
Karyotype

Sex chromosome aberrations are specified first (X chromosome abnormalities are presented
before those involving Y), followed by abnormalities of the autosomes listed in numerical or­
der irrespective of aberration type. For each chromosome, numerical abnormalities are listed
before structural changes. Multiple structural changes of homologous chromosomes are pre­
sented in alphabetical order according to the abbreviated term of the abnormality. For order
of clone presentation, see Sections 4.1, 11.1.4 and 11.1.6.
50,X,+X,-Y,+10,+ 14,+ 17,+21[5]/46,XY[15]
The numerical abnormality of the X is listed before that of the Y.

47,
X,t(X; 13)(q27;q 12),inv( 10)(p 13q22),+21
The sex chromosome abnormality is presented first, followed by the autosomal abnormalities in chromosome
number order, irrespective of whether the aberrations are numerical or structural.

47, Y,t(X; 13)(q27;q 12),inv( 10)(p 13q22),+21

The same karyotype as in the previous example in a male.

46,t(X; 18)(p 11.1 ;q 11,2),t(Y; 1 )(q 11.2;p 13)

The abnormality involving the X chromosome is listed before that of the Y chromosome.

48, X,t(Y;12)(ql 1.2;pl2),del(6)(ql l),+8,t(9;22)(q34;ql 1.2),+ 17,-21,+22

The translocation involving the Y chromosome is presented first, followed by all autosomal abnormalities in
strict chromosome number order.

49, X,inv(X)(p21q26),+3,inv(3)(q21q26.2),+7,+ 10,-20,del(20)(ql 1.2),+21

The inversion of the X chromosome is listed first. The extra chromosome 3 is presented before the inversion
of chromosome 3 and the monosomy 20 before the deletion of chromosome 20. Note that the karyotype can
also be written as:
49,X,inv(X)(p21q26),+inv(3)(q21q26.2),+7,+ 10,-20,del(20)(qll.2),+21
and is preferred as it gives the shortest karyotype string.

50, XX,+l,+del(l)(pl3),+dup(l)(q21q32),+inv(l)(p31q41),+8,r(10)(pl2q25),-21
There are four abnormalities involving different copies of chromosome 1. The numerical change is presented first,
followed by the structural aberrations listed in alphabetical order: del, dup, inv.

46,XX,der(8)ins(8;?)(p23;?)del(8)(q22)
There are two abnormalities involving one chromosome 8. The chromosome 8 is described as a derivative
with the structural aberrations listed from the distal p arm to the distal q arm, rather than in alphabetical or­
der, because the insertion and deletion are present on the same derivative chromosome.

50 Cytogenet Genome Res 2016;149:1-140 ISCN 2016

DOI: 10.1159/000445813
Unidentified ring chromosomes (r), marker chromosomes (mar), and double minute chromo­
somes (dmin) are listed last, in that order.
52,XX,.. .,+r,+mar,12~20dmin

Derivative chromosomes whose centromere is unknown (see Section 9.2.3) should be

placed after all identified abnormalities but before unidentified ring chromosomes, marker
chromosomes, and double minute chromosomes.
52,XX,... ,+der(?)t(?;6)(?;q 16),+r,+mar,5 ~9dmin

Order of Chromosome Cytogenet Genome Res 2016;149:1-140 51

Abnormalities in the Karyotype DOI: 10.1159/000445813
 Normal Variable Chromosome Features

7.1 Variation in Heterochromatic Segments, Satellite Stalks, and Satellites

Variation refers to the differences in size or staining of chromosomal segments in the popu­
lation (see Wyandt and Tonk, 2008).

7.1.1 Variation in Length

Variation in length of heterochromatic segments (h), stalks (stk) or satellites (s) should be di­
stinguished from increases or decreases in arm length as a result of other structural alterations
by placing a plus (+) or minus (-) sign after the symbols h, stk or s following the appropriate
chromosome and arm designation.

16qh+ Increase in length of the heterochromatin on the long arm of chro­

mosome 16.
Yqh- Decrease in length of the heterochromatin on the long arm of the Y
chromosome.
21ps+ Increase in length of the satellite on the short arm of chromosome
21.
22pstk+ Increase in length of the stalk on the short arm of chromosome 22.
13cenh+pat Increase in length of the centromeric heterochromatin of the chro­
mosome 13 inherited from the father.
1 qh-, 13cenh+,22ps+ Decrease in length of the heterochromatin on the long arm of chro­
mosome 1, increase in length of the centromeric heterochromatin on
chromosome 13, and large satellites on chromosome 22.
15cenh+mat, 15ps+pat Increase in length of the centromeric heterochromatin on the chromo­
some 15 inherited from the mother and large satellites on the chromo­
some 15 inherited from the father.
14cenh+pstk+ps+ Increase in length of the centromeric heterochromatin, the stalk, and
the size of satellites on the same chromosome 14.

52 Cytogenet Genome Res 2016;149:1-140 ISCN 2016

DOI: 10.1159/000445813
7.1.2 Variation in Number and Position

The same nomenclature symbols as described above are used to describe variation in position
of heterochromatic segments, satellite stalks, and satellites.

22pvar Variable presentation of the short arm of chromosome 22.

17ps Satellites on the short arm of chromosome 17.
Yqs Satellites on the long arm of the Y chromosome.
9phqh Heterochromatin in both the short and the long arms of chromosome 9.
9ph Heterochromatin only in the short arm of chromosome 9.
Iq41h Heterochromatic segment in chromosome 1 at band lq41.

Duplicated chromosome structures are indicated by repeating the appropriate designation:

21pss Double satellites on the short arm of chromosome 21.

14pstkstk Double stalks on the short arm of chromosome 14.

In contrast, the common population inversion variants (see Table 1) are specified by their
euchromatic breakpoints.

inv(9)(pl2ql3) Pericentric inversion on chromosome 9.

inv(2)(pl 1.2ql3) Pericentric inversion on chromosome 2.

7.2 Fragile Sites

Fragile sites (fra) associated with a specific disease or phenotype are referred to in Section
9.2.7.
Fragile sites associated with specific chromosome bands can occur as normal variants with
no phenotypic consequences. These fragile sites are inherited in a co-dominant Mendelian
fashion and may result in chromosome abnormalities such as deletions, multiradial figures,
and acentric fragments. While there may be several different types of fragile sites inducible
by culturing cells in media containing different components, all these will be covered by a
single nomenclature.

fra(10)(q25.2) A fragile site on chromosome 10 in 10q25.2.

fra( 10)(q22.1 ),fra( 10)(q2 5.2) Two fragile sites on the same chromosome 10.
fra( 10)(q22.1 ),fra( 10)(q2 5.2) Two fragile sites on different homologous chromosomes.
fra(10)(q25.2),fra(16)(q22.1) Two fragile sites on different chromosomes.

Normal Variable Chromosome Cytogenet Genome Res 2016;149:1-140 53

Features DOI: 10.1159/000445813
8 Numerical Chromosome Abnormalities

8.1 General Principles

A plus (+) or minus (-) sign is placed before a chromosome to indicate gain or loss of that par­
ticular chromosome. The only exception to this rule is the convention to designate constitu­
tional numerical sex chromosome abnormalities by listing all sex chromosomes after the chro­
mosome number, see examples below.
All numerical changes are expressed in relation to the appropriate ploidy level (see Section
11.2), i.e., in near-haploid cells (chromosome numbers up to 34) in relation to 23, in near­
diploid cells (chromosome numbers 35-57) in relation to 46, in near-triploid cells (chromo­
some numbers 58-80) in relation to 69, in near-tetraploid cells (chromosome numbers 81-
103) in relation to 92, and so on.

26,X,+4,+6,+21
A near-haploid karyotype with two copies of chromosomes 4, 6, and 21, and a single copy of all other chro­
mosomes.

71,XXX,+8,+ 10
A near-triploid karyotype with four copies of chromosomes 8 and 10, and three copies of all other chromo­
somes.

89,XXYY,-l,-3,-5,+8,-21
A near-tetraploid karyotype with three copies of chromosomes 1, 3, 5, and 21, five copies of chromosome 8,
and four copies of all other autosomes.

mos 47,XY,+21[12]/46,XY[18]
A mosaic karyotype showing two cell lines, one cell line, represented by 12 cells, with trisomy 21 and one nor­
mal male cell line, represented by 18 cells. The normal diploid karyotype is written last.

The investigator should select as the reference for the description of the karyotype what is
convenient and at the same time biologically meaningful. In such instances, the ploidy level
(n, 2n, 3n, etc.) should be given in angle brackets < > after the chromosome number.

76~102<4n>,XXXX,...
The chromosome numbers vary between hypertriploidy and hypertetraploidy. The symbol <4n> indicates that
all abnormalities are expressed in relation to the tetrapioid level.

58<2n>,XY,+X,+4,+6,+8,+ 10,+ ll,+14,+ 14,+ 17,+ 18,+21,+21[10]

Near-triploid clone described in relation to the diploid chromosome number with gain of chromosomes listed.

54 Cytogenet Genome Res 2016;149:1-140 ISCN 2016

DOI: 10.1159/000445813
Sex Chromosome Abnormalities

Constitutional sex chromosome abnormalities are described as follows:

45,X
A karyotype with one X chromosome (Turner syndrome).

47,XXY
A karyotype with two X chromosomes and one Y chromosome (Klinefelter syndrome).

47,XXX
A karyotype with three X chromosomes.

47, XYY
A karyotype with one X chromosome and two Y chromosomes.

48, XXXY
A karyotype with three X chromosomes and one Y chromosome.

mos 47,XXY[10]/46,XY[20]
A mosaic karyotype with one cell line showing two X chromosomes and one Y, found in 10 cells, and a second
cell line with a normal diploid male pattern of one X chromosome and one Y chromosome, found in 20 cells.

mos 45,X[25]/47,XXX[12]/46,XX[13]
A mosaic karyotype with two abnormal cell lines, one with monosomy X, found in 25 cells, and one with tri­
somy X, found in 12 cells. A normal female karyotype was found in 13 cells.

mos 47,XXX[25]/45,X[12]/46,XX[13]
A mosaic karyotype with two abnormal cell lines, one with trisomy X found in 25 cells, and one with mono­
somy X found in 12 cells. A normal female karyotype was found in 13 cells.

The constitutional sex chromosome complement is given without the use of plus or minus
signs.

Acquired sex chromosome abnormalities are expressed with plus and minus signs as follows:

47, XX,+X
A tumor karyotype in a female with an additional X chromosome.

45,
X,-X
A tumor karyotype in a female with loss of one X chromosome.

45,X,-Y
A tumor karyotype in a male with loss of the Y chromosome.

45,Y,-X
A tumor karyotype in a male with loss of the X chromosome.

48, XY,+X,+Y
A tumor karyotype in a male with one additional X and one additional Y chromosome.

Numerical Chromosome Cytogenet Genome Res 2016;149:1-140 55

Abnormalities DOI: 10.1159/000445813
 Acquired chromosome abnormalities in individuals with a constitutional sex chromosome
anomaly can be distinguished with the use of the letter c after the constitutional abnormality
designation, as illustrated in more detail in Section 11.3.

48,XXYc,+X
Tumor cells with an acquired additional X chromosome in a patient with Klinefelter syndrome.

Xc,+X
46,
Tumor cells with an acquired additional X chromosome in a patient with Turner syndrome.

46,
XXYc,-X
Tumor cells with an acquired loss of one X chromosome in a patient with Klinefelter syndrome.

44, Xc,-X
Tumor cells with an acquired loss of the X chromosome in a patient with Turner syndrome.

46, Xc,+21
Tumor cells with an acquired extra chromosome 21 in a patient with Turner syndrome.

47, XXX?c
Tumor cells with an uncertain karyotype with an extra X chromosome. The question mark indicates that it
is unclear if the extra X is constitutional or acquired.

48, XXY,+mar c
For constitutional markers, there is a space between mar and c.

8.3 Autosomal Abnormalities

Constitutional and acquired gains or losses of chromosomes are indicated with plus or minus
signs.

47, XX,+21
A karyotype with trisomy 21.

48, XX,+ 13,+21

A karyotype with trisomy 13 and trisomy 21.

45, XX,-22
A karyotype with monosomy 22.

46, XX,+8,-21
A karyotype with trisomy 8 and monosomy 21.

Acquired autosomal abnormalities in individuals with a constitutional anomaly are, as exem­

plified above for sex chromosome abnormalities, distinguished by the letter c (see Section
11.3) after the constitutional abnormality designation.

48,
XY,+21c,+21
An acquired extra chromosome 21 in a patient with Down syndrome.

46,
XY,+21c,-21
Acquired loss of one chromosome 21 in a patient with Down syndrome.

56 Cytogenet Genome Res 2016;149:1-140 ISCN 2016

DOI: 10.1159/000445813
8.4 Uniparental Disomy

Uniparental disomy, abbreviated upd, a condition in which both homologous chromosomes

are derived from one parent, may in certain circumstances be identified cytogenetically. See
Chapter 14 for a UPD example detected by microarray analysis.

46,XY,upd(15)mat
Male karyotype showing uniparental disomy for a maternally derived chromosome 15.

mos 47,XX,+21 [23]/46,XX,upd(21 )pat[7]

A mosaic female karyotype consisting of one cell line with uniparental disomy for a paternally derived chro­
mosome 21, identified in 7 cells, and the other with trisomy 21, identified in 23 cells. Note that the trisomic
cell line is listed first since it is larger (see Section 4.1).

XY,upd
45, der(13;13)(ql0;ql0)pat
A male karyotype with a single chromosome 13 that is a Robertsonian translocation inherited from the father.
Because the father has the same karyotype, this has been interpreted to be uniparental disomy.

Numerical Chromosome Cytogenet Genome Res 2016;149:1-140 57

Abnormalities DOI: 10.1159/000445813
9 Structural Chromosome Rearrangements

9.1 General Principles

Structural aberrations, whether constitutional or acquired, should be expressed in relation to

the appropriate ploidy level (see Section 11.2), i.e., in near-haploid cells in relation to one
chromosome of each type, in near-diploid cells in relation to two chromosomes of each type,
in near-triploid cells in relation to three chromosomes of each type, in near-tetraploid cells in
relation to four chromosomes of each type, and so on.

69,XXX,del(7)(pl 1.2)
Two normal chromosomes 7 and one with a deletion of the short arm.

69, XXY,del(7)(q22),inv(7)(p 13q22),t(7; 14)(p 15 ;q 11.1)

No normal chromosome 7: one has a long arm deletion, one has an inversion, and one is involved in a bal­
anced translocation with chromosome 14.

70, XXX,+del(7)(pl 1.2)

Three normal chromosomes 7 and an additional, structurally abnormal chromosome 7 with a deletion of the
short arm.

92,XXYY,del(7)(p 11. 2), t(7; 14)(p 15 ;q 11.1)

Two normal and two abnormal chromosomes 7: one has a deletion of the short arm, and one is involved in a
balanced translocation with chromosome 14.

92,XXYY,del(7)(p 11.2),del(7)(q22),del(7)(q34)
One normal chromosome 7 and three with different deletions.

When normal chromosomes are replaced by structurally altered chromosomes, the normal
ones should not be recorded as missing.

XX,inv(3)(q21q26.2)
46,
An inversion of one chromosome 3. There is no need to indicate that one chromosome 3 is missing, i.e., the
karyotype should not be written 46,XX,-3,+inv(3).

XX,dic(13;15)(q22;q24)
45,
It is apparent from the symbol die (see Section 9.2.4) and from the specification of the chromosomes involved
that the dicentric chromosome replaces two normal chromosomes. Thus, there is no need to indicate the miss­
ing normal chromosomes.

58 Cytogenet Genome Res 2016;149:1-140 ISCN 2016

DOI: 10.1159/000445813
 Y,t(X;8)(p22.3;q24.1)
46,
Male karyotype showing a balanced translocation between the X chromosome and chromosome 8. Note that
the normal sex chromosome, in this case a Y, is shown first.

46,XY,der( 1 )t( 1; 3)(p22;q 13.1)

The der(l) replaces a normal chromosome 1 and there is no need to indicate the missing normal chromosome.
The description implies that the karyotype contains one normal chromosome 1 and two normal chromosomes
3.

46,XX,der( 1 )ins( 1 ;?)(p22;?)

Material of unknown origin has been inserted at band p22 in one chromosome 1. The homologous chromo­
some 1 is normal.

45, XY-10,der( 10)t( 10; 17)(q22;p 12)

The der(10) replaces a normal chromosome 10; the homologous chromosome 10 is lost. In this situation the
missing chromosome 10 must be indicated.

9.2 Specification of Structural Rearrangements

Examples of structural rearrangements, whether constitutional or acquired, are presented be­

low. Each abnormality is described first with the short system and, when appropriate, also
with the detailed system.

9.2.1 Additional Material of Unknown Origin

The symbol add (Latin, additid) should be used to indicate additional material of unknown
origin attached to a chromosome region or band. Such abnormalities have often been de­
scribed using the symbols t and ?, e.g., t( 1 ;?)(p36;?), but it is only rarely known that the rear­
ranged chromosome has actually resulted from a translocation. The symbol add does not im­
ply any particular mechanism and is therefore recommended.
Additional material attached to a terminal band will always lead to an increase in length
of a chromosome arm. Unknown material that replaces a chromosome segment may, depend­
ing on the size of the extra material, result in either increase or decrease in the length of the
chromosome arm. Designations such as “lp+” or “Ip-” may be used in text to describe such
abnormal chromosomes, but should not be used in the karyotype.

46, XX,add(19)(pl3.3)
46,XX,add(19)(?::pl3.3->qter)
Additional material attached to band 19p 13.3, but neither the origin of the extra segment nor the type of re­
arrangement is known.

46,XY,add(12)(ql3)
46,XY,add(12)(pter^ql3::?)
Additional material of unknown origin replaces the segment 12ql3qter.

When additional material of unknown origin is attached to both arms of a chromosome and/
or replaces more than one segment in a chromosome, the symbol der (see Section 9.2.3) should
be used.

46,XX,der(5)add(5)(pl5.3)add(5)(q23)
46,XX,der(5)(?::pl5.3->q23::?)
Additional material of unknown origin is attached at band 5p 15.3 in the short arm and additional material
replaces the segment 5q23qter in the long arm.

Structural Chromosome Cytogenet Genome Res 2016;149:1-140 59

Rearrangements DOI: 10.1159/000445813
 Unknown material inserted in a chromosome arm should be described by the use of the sym­
bols ins and ?.

46,XX,der(5)ins(5;?)(ql3;?)
46,XX,der(5)ins(5;?)(pter-»ql3::?::ql3->qter)
Material of unknown origin has been inserted into the long arm of chromosome 5 at band 5ql3. Use of the
symbol add in this situation, i.e., add(5)(ql3), would have denoted that unknown material had replaced the
segment 5ql3qter.

9.2.2 Deletions

The symbol del is used to denote both terminal and interstitial deletions. A deletion is a loss
of a chromosome segment. No arrows are used in the short system to indicate the extent of
the deleted segment. This is apparent from the description of the breakpoints. Note that des­
ignations such as “5q-” or “del(5q)”, which may be useful abbreviations in text, should not
be used in karyotypes.

46,XX,del(5)(ql3)
46,XX,del(5)(pter~*ql3:)
Terminal deletion with a break (:) in band 5ql3. The remaining chromosome consists of the entire short arm
of chromosome 5 and the part of the long arm lying between the centromere and band 5ql3.

46,XX,del(5)(ql3q33)
46 ,XX,del(5)(pter -»q 13: :q3 3 -► qter)
Interstitial deletion with breakage and reunion (::) of bands 5ql3 and 5q33. The segment lying between these
bands has been deleted.

46,XX,del(5)(ql3ql3)
4 6 ,XX, del( 5 )(pter -> q 13:: q 13 -► qter)
Interstitial deletion of a small segment within band 5q 13, i.e., both breakpoints are in band 5ql3.

46,XY,del(5)(q?)
Deletion of the long arm of chromosome 5, but it is unclear whether it is a terminal or an interstitial deletion,
and also the breakpoints are unknown.

46,Y,del(X)(p21p21)
Interstitial deletion of a small segment within band Xp21.

Multiple deletions of the same chromosome should be expressed using the symbol der (see
Section 9.2.3).

9.2.3 Derivative Chromosomes

A derivative chromosome (der) is a structurally rearranged chromosome generated either by a

rearrangement involving two or more chromosomes or by multiple aberrations within a single
chromosome. The term always refers to the chromosome that has an intact centromere.
A recombinant chromosome (rec) is a structurally rearranged chromosome with a new seg­
mental composition resulting from meiotic crossing-over; consequently, this term should not
be used in the description of acquired chromosome abnormalities. If parental karyotypes are
unknown or a parental inversion has not been identified, the abnormal chromosome should
be designated as a der, not a rec.

60 Cytogenet Genome Res 2016;149:1-140 ISCN 2016

DOI: 10.1159/000445813
46,XX,der(6)(pter-»q25.2::p22.2^pter)

When parental karyotypes are known and a parental inversion or an intra- or interchromo-
somal insertion is identified, rec should be used.

46,XX,rec(6)dup(6p)inv(6)(p22.2q25.2)mat
46,XX,rec(6)(pter -+ q2 5.2: :p22.2 pter)mat
Recombinant chromosome 6 containing a duplication of segment 6p22.2 to 6pter and a deletion of 6q25.2 to
6qter due to a meiotic crossing-over in the mother. The mother is carrier of an inversion of the segment 6p22.2
to 6q25.2.

46,XX,rec(21)del(21)ins(21)(pl3q22.2q22.3)pat
Recombinant chromosome 21 containing a deletion of segment 21q22.2q22.3 due to a meiotic crossing-over
in the father. The father is carrier of an intrachromosomal insertion of the bands 21q22.2 to 21q22.3 into pl 3.

46,XY,rec( 1 )dup(5q)ins( 1 ;5)(q32;q 11.2q22)inh,rec(5)del( 1 q)ins( 1 ;5)inh

Recombinant chromosomes 1 and 5 resulting in a duplication of segment 5q22 to 5qter and deletion of the
segment from lq32 to Iqter due to a meiotic crossing-over in a parent who carries an interchromosomal in­
sertion of the segment from 5ql 1.2 to 5q22 into band lq32.

A derivative chromosome generated by more than one rearrangement within a chromosome is

specified in parentheses, followed by the type of abnormality. The detailed system is helpful
in these cases.

46,XY,der(9)del(9)(pl2)del(9)(q31)
46,XY,der(9)(:pl2->q31:)
A derivative chromosome 9 resulting from terminal deletions in both the short and long arms with breakpoints
in bands 9pl2 and 9q31.

46,XY,der(9)inv(9)(pl3p23)del(9)(q22q33)
46,XY,der(9)(pter^p23::pl3^p23::pl3^q22::q33^qter)
A derivative chromosome 9 resulting from an inversion in the short arm with breakpoints in 9pl3 and 9p23,
and an interstitial deletion of the long arm with breakpoints in 9q22 and 9q33.

46,XX,der(7)add(7)(p22)add(7)(q22)
46,XX,der(7)(?::p22^q22::?)
A derivative chromosome 7 with additional material of unknown origin attached at band 7p22. Similarly,
additional material of unknown origin is attached to 7q22, replacing the segment 7q22qter.

46,XX,der(5)add(5)(p 15.1 )del(5)(q 13)

46,XX,der(5)(?::pl5.1->ql3:)
A derivative chromosome 5 with additional material of unknown origin attached at 5pl 5.1 and a terminal
deletion of the long arm distal to band 5ql3.

A derivative chromosome resulting from one rearrangement involving two or more chromosomes
is specified in parentheses, followed by the type of abnormality.

46,Y,der(X)t(X;8)(p22.3;q24.1)
A male showing a derivative X chromosome derived from a translocation between Xp22.3 and 8q24.1.

46 ,XX,der( 1 )t( 1; 3)(p22;q 13.1)

46 ,XX,der( 1 )(3qter -> 3 q 13.1:: 1 p22 -► 1 qter)
The derivative chromosome 1 has resulted from a translocation of the chromosome 3 segment distal to 3ql 3.1
to the short arm of chromosome 1 at band lp22. The der(l) replaces a normal chromosome 1 and there is no

Structural Chromosome Cytogenet Genome Res 2016;149:1-140 61

Rearrangements DOI: 10.1159/000445813
 need to indicate the missing chromosome (see Section 9.1). There are two normal chromosomes 3. The karyo­
type is unbalanced with loss of the segment lp22pter and gain of 3q 13.1 qter.

45, XY,der(l)t(l;3)(p22;ql3.1),-3
The derivative chromosome 1 (same as above) replaces a normal chromosome 1, but there is only one normal
chromosome 3. One can presume that it is the der(3) resulting from the t( 1; 3) that has been lost, but the karyo­
type cannot make explicit such assumptions.

The term Philadelphia chromosome is for historical reasons retained to describe the deriva­
tive chromosome 22 generated by the translocation t(9;22)(q34;ql 1.2). The abbreviation Ph
(formerly Ph1) may be used in text, but not in the description of the karyotype, where der(22)
t(9;22)(q34;ql 1.2) is recommended. Similarly, the derivative chromosome 9 resulting from
the t(9;22) is designated der(9)t(9;22)(q34;ql 1.2).

A derivative chromosome generated by more than one rearrangement involving two or more
chromosomes is specified in parentheses, followed by all aberrations involved in the genera­
tion of the derivative chromosome. The aberrations should be listed according to the break­
points of the derivative chromosome from pter to qter and should not be separated by com­
mas.

46, XX,der( 1 )t( 1; 3)(p32;q21 )t( 1; 11 )(q25 ;q 13)

46,XX,der(l)(3qter->3q21::lp32-> lq25::l Iql3->T Iqter)
A derivative chromosome 1 generated by two translocations, one involving the short arm with a breakpoint
in lp32 and the other involving the long arm with a breakpoint in lq25.

46,XY,der(l)t(l;3)(p32;q21)t(3;7)(q28;ql 1.2)
46,XY,der(l)(7qter-»7qll.2::3q28-»3q21::lp32^1qter)
A derivative chromosome 1 resulting from a translocation of the chromosome 3 segment distal to 3q21 onto
lp32, and a translocation of the segment 7ql 1.2qter to band 3q28 of the chromosome 3 segment attached to
chromosome 1.

46,XY,der( 1 )t( 1; 3)(p32;q21 )dup( 1 )(q2 5q42)

46,XY,der( 1 )(3qter-> 3q21:: 1 p32 -> 1 q42:: 1 q25 -> 1 qter)
A derivative chromosome 1 resulting from a t(l;3) with a breakpoint in lp32 and a duplication of the long
arm segment Iq25q42.

46,XY,der(9)del(9)(p 12)t(9; 13)(q34;q 11)

46,XY,der(9)(:9pl2->9q34::13qll^l3qter)
A derivative chromosome 9 generated by a terminal deletion of the short arm with a breakpoint in 9pl2, and
by a t(9; 13) involving the long arm with a breakpoint in 9q34.

46,XX,der(l)t(l;ll)(p32;ql3)t(l;3)(q25;q21)
46, XX,der(l)(llqter^llql3::lp32^1q25::3q21->3qter)
A derivative chromosome 1 generated by two translocations, one involving a breakpoint in lp32 and 1 Iq 13
and the other involving a breakpoint in lq25 and 3q21. The detailed system describes the derivative 1 from
1 Iqter to 3qter as the aberrations are listed according to the orientation of chromosome 1, from the p arm to
the q arm.

47, XY,+mos der(8)r(l;8;17)(p36.3p35;pl2ql3;q25q25)

XY,+mos
47, der(8)r(l;8;17)(::lp36.3^1p35::8pl2->8ql3::17q25^17q25::)
Mosaic ring chromosome involving three chromosome segments determined to be a derivative 8 because it
retains the 8 centromere. For additional examples of ring chromosomes, see 9.2.15.

62 Cytogenet Genome Res 2016;149:1-140 ISCN 2016

DOI: 10.1159/000445813
46,
XX,der( 1 )del( 1 )(p22p34)ins( 1; 17)(p22;q 11 q2 5)
46,
XX,der(l)(lpter^lp34::17q25^17qll::lp22^1qter)
A derivative chromosome 1 resulting from an interstitial deletion of the short arm with breakpoints in lp22
and lp34, and a replacement of this segment by an insertion of a segment from the long arm of chromosome
17. In such situations, when there are two breakpoints in the recipient chromosome, the proximal one is list­
ed as the point of insertion.

46,XY,der(7)t(2;7)(q21;q22)ins(7;?)(q22;?)
46,XY,der(7)(7pter->7q22::?::2q21 ->2qter)
A derivative chromosome 7 in which material of unknown origin has replaced the segment 7q22qter, and the
segment 2q21qter from the long arm of chromosome 2 is attached to the unknown chromosome material. By
convention, the breakpoint in the derivative chromosome is specified as the point of insertion of the unknown
material.

46,XX,der(8)t(8;17)(p23;q21)inv(8)(p22ql3)t(8;22)(q22;ql2)
46,XX,der(8)(22qter^22ql2::8q22^8ql3::8p22-»8ql3::8p22-»8p23::17q21^17qter)
A derivative chromosome 8 resulting from two translocations, one affecting the short arm, one the long arm,
with breakpoints at 8p23 and 8q22, respectively, and a pericentric inversion with breakpoints at 8p22 and 8q 13.

An isoderivative chromosome, abbreviated ider, designates an isochromosome formation for

one of the arms of a derivative chromosome. The breakpoints are assigned to the centromer­
ic bands p 10 and qlO according to the morphology of the isoderivative chromosome (see Sec­
tion 9.2.11).

46,XX,ider(22)(ql0)t(9;22)(q34;qll.2)
46,XX,ider(22)(9qter^9q34::22qll.2^22ql0::22ql0^22qll.2::9q34^9qter)
An isochromosome for the long arm of a derivative chromosome 22 generated by a t(9;22), i.e., an isochro­
mosome for the long arm of a Ph chromosome.

46,XY,ider(9)(pl0)ins(9;12)(pl3;ql3q22)
46,XY,ider(9)(9pter^9pl3::12q22^12ql3::9pl3^9pl0::9pl0->9pl3::12ql3->
12q22::9p 13 9pter)
An isochromosome for the short arm of a derivative chromosome 9 resulting from an insertion of the segment
12ql3q22 at band 9pl3.

When a derivative chromosome is dicentric and contains one or more additional abnormali­
ties, the two centromere-containing chromosomes are given within parentheses, separated by
a semicolon, followed by the specification of the aberrations.

45,XX,der(5;7)t(5;7)(q22;pl3)t(3;7)(q21;q21)
45,XX,der(5;7)(5pter->5q22::7pl3^7q21::3q21->3qter)
A dicentric derivative chromosome. Breakage and reunion have occurred at band 5q22 in the long arm of
chromosome 5 and at band 7pl3 in the short arm of chromosome 7. In addition, the segment 3q21qter has
been translocated onto the long arm of chromosome 7 at band 7q21.

45,XY,der(5;7)t(3;5)(q21;q22)t(3;7)(q29;pl3)
45,XY,der(5;7)(5pter-»5q22::3q21->3q29::7pl3->7qter)
A dicentric derivative chromosome composed of chromosomes 5 and 7. The same acentric chromosome 3
segment as in the previous example is inserted between the long arm of chromosome 5 and the short arm of
chromosome 7.

45,XY,der(5;7)t(3;5)(q21;q22)t(3;7)(q29;pl3)del(7)(q32)
45,XY,der(5;7)(5pter^5q22::3q21^3q29::7pl3^7q32:)
The same dicentric derivative chromosome as in the previous example but with an additional terminal dele­
tion of the long arm of chromosome 7 at band 7q32.

Structural Chromosome Cytogenet Genome Res 2016;149:1-140 63

Rearrangements DOI: 10.1159/000445813
45,XX,der(8;8)(ql0;ql0)del(8)(q22)t(8;9)(q24.1;ql2)
45, XX,der(8;8)(:8q22->8ql0::8ql0^8q24.1::9ql2-^9qter)
A derivative chromosome composed of the long arms of chromosome 8 with material from chromosome 9
translocated to one arm at band 8q24.1 and a deletion at band 8q22 in the other arm.

When the centromere of the derivative chromosome is not known, but more distal parts of
the chromosome can be recognized, the abnormal chromosome may be designated der(?).

47,XY,+der(?)t(?;9)(?;q22)
47,XY,+der(?)(?->?cen->?::9q22-*9qter)
The distal segment of the long arm of chromosome 9 from band 9q22 has been translocated to a centromere­
containing derivative chromosome of unknown origin.

47,XX,+der(?)t(?;9)(?;p 13)ins(?;7)(?;q 11.2q32)

47,XX,+der(?)(9pter->9pl3::?^cen-^?::7qll.2^7q32::?)
A derivative chromosome of unknown origin onto which is translocated in its short arm the segment of chro­
mosome 9 distal to band 9pl3, and which also contains an insertion in the long arm of the chromosome 7
segment between bands 7ql 1.2 and 7q32.

47,XX,+der(?)t(?;9)(?;pl3)hsr(?)
47,XX,+der(?)(9pter-^9pl3::?-^cen->?::hsr->?)
A derivative chromosome of unknown origin with the same translocation in its short arm as in the previous
example, and a homogeneously staining region in the long arm.

Derivative chromosomes whose centromeres are unknown should be placed after all identi­
fied abnormalities but before unidentified ring chromosomes, marker chromosomes, and
double minute chromosomes (see Chapter 6).

53,XX,...,+der(?)t(?;9)(?;q22),+r,+mar,dmin

There is usually no need to indicate which homologue is involved in a derivative chromosome

because this will be apparent from the karyotype description. If both homologues are involved,
this will result in two derivative homologous chromosomes.

46, XX,der(9)del(9)(pl2)t(9;22)(q34;qll.2),der(9)t(9;12)(pl3;q22)inv(9)(ql3q22)
One der(9) is the result of a deletion of the short arm and a translocation involving the long arm; the other
der(9) is the result of a translocation affecting the short arm and a paracentric inversion in the long arm of
the homologous chromosome 9. There are two normal chromosomes 12, two normal chromosomes 22, but
no normal chromosome 9.

When homologous chromosomes cannot be distinguished within this nomenclature system,

one of the numerals may be underlined (single underlining). There is in particular one situa­
tion where this may be helpful: When the two homologous chromosomes are involved in
identical aberrations resulting in two identical derivative chromosomes.

46,XX,der(l)t(l;3)(p34.3;q21),der(l)t(l;3)(p34.3;q21)
The two homologous chromosomes 1, as identified by C-band polymorphism, are involved in apparently
identical translocations.

46,XX,der(l)t(l;3)(p34.3;q21)[20]/46,XX,der(l)t(l;3)(p34.3;q21)[10]
The two homologous chromosomes 1 are involved in apparently identical translocations in different cells. The
two abnormalities represent two different clones; the homologous chromosomes 1 in each clone are normal.

64 Cytogenet Genome Res 2016;149:1-140 ISCN 2016

DOI: 10.1159/000445813
 46,XX,derQ)t( 1; 1 )(p31 ;q32)
46, XX,der(I)t(l;l)(p31;q32)
The two derivative chromosomes can be distinguished by underlining. In the first example, the derivative
observed is the homologue with a break at q32. In the second example, the derivative is the homologue with
a breakpoint in p31.

Complex rearrangements may give rise to several derivative chromosomes. The breakpoints in
the derivative chromosomes generated by the same rearrangement need not be repeated in the
description of each individual derivative chromosome.

47, XX,t(9;22)(q34;qll.2),+der(22)t(9;22)
Karyotype with t(9;22) and an additional Ph chromosome. The breakpoints in the extra der(22) need not be
repeated.

46,XX,der(l)t(l;3)(p32;q21)inv(l)(p22q2I)t(l;ll)(q25;ql3),der(3)t(l;3),der(ll)t(l;ll)
A balanced complex rearrangement with three derivative chromosomes. The breakpoints of the t( 1; 3) and the
t( 1; 11), which both contribute to the der(l), are not repeated in the description of der(3) and der(l 1).

Complex karyotypes involving rearrangements between two or more derivative chromosomes, or

where derivative chromosomes are involved in new rearrangements, cannot be described by the
short system. The detailed system will be adequate in all such situations. It is acceptable to com­
bine the short system (4.3.1) and the detailed system (4.3.2) for designating complex karyotypes.
Whenever doubts remain, the rearrangement should, to avoid ambiguity, be illustrated and de­
scribed in words.

9.2.4 Dicentric Chromosomes

The symbol die is used to describe dicentric chromosomes. Isodicentric chromosomes are des­
ignated idic. It is apparent from the symbol and from the specification of the chromosome(s)
involved that the dicentric chromosome replaces one or two normal chromosomes. There is
no need to indicate the missing normal chromosome(s) (cf., whole-arm and Robertsonian
translocations, Sections 9.2.17.2 and 9.2.17.3). A dicentric chromosome is counted as one
chromosome. The term der may be used instead of die, but the combination of der die should
never be used.

45,XX,dic(13;13)(ql4;q32)
XX,dic(13;13)(13pter^l3ql4::13q32->13pter)
45,
Breakage and reunion have occurred at bands 13ql4 and 13q32 on the two homologous chromosomes 13
to form a dicentric chromosome. There is no normal chromosome 13. If it can be shown that the dicentric
chromosome has originated through breakage and reunion of sister chromatids, it may be designated, e.g.,
dic(13)(ql4q32).

45,
XX,dic(13;15)(q22;q24)
45, XX,dic(l 3; 15)(13pter-> 13q22:: 15q24-> 15pter)
A dicentric chromosome with breaks and reunion at bands 13q22 and 15q24. The missing chromosomes 13
and 15 are not indicated since they are replaced by the dicentric chromosome. The karyotype contains one
normal chromosome 13, one normal chromosome 15, and the dic(13; 15). The resulting net imbalance of this
abnormality is loss of the segments distal to 13q22 and 15q24.

46, XX,+13,dic( 13; 15)(q22;q24)

A dicentric chromosome with breaks and reunion at bands 13q22 and 15q24 (same as above) has replaced
one chromosome 13 and one chromosome 15. There are, however, two normal chromosomes 13, i.e., an ad­
ditional chromosome 13 in relation to the expected loss due to the dic( 13; 15). Consequently, the gain is indi­
cated as +13. The karyotype contains two normal chromosomes 13, one normal chromosome 15, and the

Structural Chromosome Cytogenet Genome Res 2016;149:1-140 65

Rearrangements DOI: 10.1159/000445813
 dic(l 3; 15). The resulting net imbalance is partial trisomy for the segment 13pterq22 and loss of the segment
15q24qter.

45,XY,dic( 14; 21 )(p 11,2;p 11.2)

45, XY,dic(14;21)(14qter->14pl 1.2::21pl 1.2-^21qter)
A dicentric chromosome with breaks and reunion at bands 14p 11.2 and 2Ip 11.2. The missing chromosomes
14 and 21 are not indicated since they are replaced by the dicentric chromosome. The karyotype contains one
normal chromosome 14, one normal chromosome 21, and the dic(14;21). The resulting net imbalance of this
abnormality is loss of the segments distal to 14pl 1.2 and 21pl 1.2. For description of Robertsonian transloca­
tions, see Section 9.2.17.3.

47,
XY,+dic(17;?)(q22;?)
47,XY,+dic( 17;?)( 17pter 17q22::?)
An additional dicentric chromosome composed of one chromosome 17 with a break at band 17q22 and an
unknown chromosome with an intact centromere.

46, X,idic(Y)(ql2)
4 6 ,X, idic(Y)(pt er q 12:: q 12 -> pt er)
Breakage and reunion have occurred at band Yql2 on sister chromatids to form an isodicentric Y chromo­
some. The resulting net imbalance is loss of the segment Yql2qter and gain of Ypterql2.

46, XX,idic(21)(q22.3)
46 ,XX,idic(21 )(pter -> q22.3:: q22.3 -> pter)
An isodicentric with breakage and reunion at the terminal ends of two chromosomes 21. There are two copies
of the long arm of chromosome 21, joined at q22.3, and one normal chromosome 21, indicated by the 46
count. Even though there are effectively three copies of the chromosome 21 long arm, the normal chromo­
some 21 is not designated with a (+) sign.

47, XX,+idic(13)(q22)
47,XX,+idic(13)(pter->q22::q22-*pter)
An additional isodicentric chromosome 13. There are two chromosomes 13 and the idic(l 3).
Another example is shown in Section 9.2.11.

47,XY,+idic(15)(ql2)
47,XY,+dic(15;15)(ql2;ql2)
4 7 ,X Y,+dic( 15; 15 )(pt er -► q 12:: q 12 -> pt er)
An additional apparent isodicentric chromosome 15. There are two chromosomes 15 and the idic( 15)(ql2).
This rearrangement has historically been referred to as inv dup(15)(ql2). However, because most result from
recombination between homologues, dic(15; 15)(q 12;q 12), (or psu die, see below), would be a more appropri­
ate designation.

Complex dicentric chromosomes must be described as derivative chromosomes, see Section

9.2.3.

A pseudodicentric chromosome is a dicentric structure in which only one centromere is active.

Such chromosomes are abbreviated psu die (similarly, pseudotricentric. psu tre, etc.), and the
segment with the presumptively active centromere, based on the morphology in the majority
of cells, is always written first. If the active centromere cannot be determined, the smallest
chromosome number is written first.

45,XX,psu dic(l5; 13)(ql2;ql2)

45,XX,psu dic( 15; 13)( 15pter->15ql2::13ql2-*l3pter)
A pseudodicentric chromosome has replaced one chromosome 13 and one chromosome 15. The karyotype con­
tains one normal chromosome 13, one normal chromosome 15, and the psu dic(15; 13). The centromere of the
chromosome mentioned first, i.e., chromosome 15, is the active one.

66 Cytogenet Genome Res 2016;149:1-140 ISCN 2016

DOI: 10.1159/000445813
 XX,psu
46, idic(20)(ql 1.2)
XX,psu
46, idic(20)(pter-’-ql 1.2::q 11.2->pter)
A pseudodicentric chromosome has replaced one chromosome 20, resulting in three copies of 20pterql 1.2.
The psu idic(20) has one active centromere.

9.2.5 Duplications

The symbol dup indicates a duplication. Duplications are a gain of a chromosome segment
observed at the original chromosome location. When a gain of a chromosome segment is
found elsewhere in the genome, der or ins should be used depending on the rearrangement.
The orientation of the duplicated segment is indicated by the order of the bands with respect
to the centromere. Note that no arrow is used in the short system to indicate the orientation.

XX,dup(l)(q22q25)
46,
46,XX,dup( 1 )(pter -»q2 5: :q22 ->qter)
Duplication of the segment between bands lq22 and lq25.

46,XY,dup(l)(q25q22)
46,XY,dup(l)(pter->q25::q25-»q22::q25-*qter) or (pter-*q22::q25->q22::q22->qter)
Duplication of the segment between bands lq22 and lq25. Note that only the detailed system will clarify the
location of the duplicated segment.

9.2.6 Fission

The symbol fis is used to denote centric fission.

47,XY,-1O,+fis( 10)(p 10),+fis( 10)(q 10)

47,XY,-10,+fis( 10)(pter~>p 1O:),+fis( 10)(qter ->q 10:)
Break in the centromere resulting in two derivative chromosomes composed of the short and long arms, re­
spectively. The breakpoints (:) are assigned to plO and qlO according to the morphology of the derivative
chromosomes.

9.2.7 Fragile Sites

Fragile sites, abbreviated fra, may occur as normal variants (see Section 7.2) or be associated
with specific diseases and/or phenotypic abnormalities. In both situations the same nomen­
clature is used.

46,X,fra(X)(q27.3)
A fragile site in subband Xq27.3 on one X chromosome in a female.

46, Y,fra(X)(q27.3)
A fragile site in subband Xq27.3 on the X chromosome in a male.

fra(X)(q27.3)
45,
A fragile site in subband Xq27.3 on the X chromosome in a Turner syndrome patient.

47, XY,fra(X)(q27.3)
A fragile site in subband Xq27.3 on one X chromosome in a Klinefelter syndrome patient.

Structural Chromosome Cytogenet Genome Res 2016;149:1-140 67

Rearrangements DOI: 10.1159/000445813
9.2.8 Homogeneously Staining Regions

The symbol hsr is used to describe the presence, but not the size, of a homogeneously stain­
ing region in a chromosome arm, segment, or band.

46,
XX,hsr(l)(p22)
46,XX,hsr( 1 )(pter->p22: :hsr: :p22 -> qter)
A homogeneously staining region in band lp22.

When a chromosome contains multiple hsr or one hsr and another structural change, it is by
definition a derivative chromosome and should be designated accordingly (see Section 9.2.3).

46,XX,der( 1 )hsr( 1 )(p22)hsr( 1 )(q31)

46,XX,der( 1 )(pter-»p22: :hsr: :p22 —> q 31: :hsr: :q31 -> qter)
Two homogeneously staining regions in chromosome 1: one in band lp22 in the short arm and the other in
band lq31 in the long arm.

46 ,XY,der( 1 )del( 1 )(p21 p3 3)hsr( 1 )(p21)

46 ,XY, der( 1 )(pter -> p 3 3: :hsr: :p21 -> qter)
The segment between bands lp21 and lp33 is replaced by a homogeneously staining region that may be
smaller or larger than the deleted segment. The hsr is by convention assigned to the proximal deletion break­
point band.

When a homogeneously staining region is located at the interface between segments of differ­
ent chromosomes involved in a rearrangement, the hsr is assigned to the breakpoints in both
chromosomes according to the standard nomenclature for structural chromosome aberra­
tions, i.e., the two chromosomes involved are presented in the first parentheses and the break­
points in the second.

46,XX,der( 1 )ins( 1; 7)(q21 ;p 11.2p21 )hsr( 1; 7)(q21 ;p 11.2)

46,XX,der(l)(lpter^lq21::hsr::7pll.2->7p21::lq21^1qter)
Insertion of the segment 7pl 1.2p21 into the long arm of chromosome 1 with breakage and reunion at band
lq21. The derivative chromosome also contains an hsr at the interface between the recipient and donor chro­
mosomes. The hsr is located proximal to the segment inserted from chromosome 7.

46 ,XX,der( 1 )ins( 1; 7)(q21 ;p 11.2p21 )hsr( 1; 7)(q21 ;p21)

46,XX,der( 1)(1 pter-> 1 q21 ::7p 11.2 -> 7p21: :hsr:: 1 q21 -> 1 qter)
Insertion of the segment 7pl 1.2p21 into the long arm of chromosome 1 with breakage and reunion at band lq21.
The derivative chromosome also contains an hsr at the interface between the recipient and donor chromosomes.
The hsr is located distal to the segment inserted from chromosome 7.

The distinction between homogeneously staining regions and abnormally banded regions,
another term that has been used to describe regions containing amplified genes, is ambiguous.
So is the distinction between abnormally banded regions and any region of unknown origin
within a derivative or marker chromosome. Therefore, until better defined, no symbol to de­
note abnormally banded regions should be used in karyotype descriptions.

9.2.9 Insertions

The symbol ins is used for insertions. The orientation of the inserted segment is indicated by
the order of the bands of the inserted segment with respect to the centromere. For clarity, the
use of the long form is recommended.

68 Cytogenet Genome Res 2016;149:1-140 ISCN 2016

DOI: 10.1159/000445813
 Insertion within a chromosome

46,XX,ins(2)(p 13q21 q 31)

46,XX,ins(2)(pter-> p 13: :q31 -> q21: :p 13 -> q21: :q31 qter)
The long-arm segment between bands 2q21 and 2q31 has been inserted into the short arm at band 2pl3. The
original orientation of the inserted segment has been maintained in its new position, i.e., band 2q21 remains
more proximal to the centromere than band 2q31.

46,XY,ins(2)(pl3q31q21)
46,XY,ins(2)(pter->pl 3::q21 ->q31 ::p 13->q21 ::q31 ->qter)
The insertion is the same as in the previous example except that the orientation of the bands within the seg­
ment has been reversed with respect to the centromere, i.e., band 2q21 of the inserted segment is now more
distal to the centromere than band 2q31.

Insertion between two chromosomes

46,XX,ins(5;2)(pl4;q22q32)
46,XX,ins(5;2)(5pter-*5pl4::2q32->2q22::5pl4->5qter;2pter^2q22::2q32->2qter)
The long-arm segment between bands 2q22 and 2q32 has been inserted into the short arm of chromosome 5
at band 5pl4. The original orientation of the inserted segment has been maintained in its new position, i.e.,
2q22 remains more proximal to the centromere than 2q32. Note that the recipient chromosome is specified
first.

46,XY,ins(5;2)(pl4;q32q22)
46,XY,ins(5;2)(5pter->5pl4::2q22->2q32::5pl4-»5qter;2pter->2q22::2q32->2qter)
Breakage and reunion have occurred at the same bands as in the previous example except that band 2q22 is
now more distal to the centromere of the recipient chromosome than band 2q32.

46,XX,ins(5;2)(q31 ;p 13p23)
46,XX,ins(5;2)(5pter->5q31::2pl3->2p23::5q31 ->5qter;2pter-»2p23::2pl3->2qter)
An insertion of bands pl 3 to p23 from chromosome 2 into band 5q31.

46,XX,ins(5;2)(q31 ;p23p 13)

46,XX,ins(5;2)(5pter->5q31::2p23->2pl3::5q31->5qter;2pter->2p23::2pl3->2qter)
An insertion of bands pl3 to p23 from chromosome 2 into band 5q31 in a reverse orientation to the above ex­
ample.

46,XY,der(5)ins(5;2)(q3 1 ;p23p 13)mat

A derivative chromosome 5 resulting from malsegregation of a maternal insertion. There is one derivative
chromosome 5 containing the insertion from chromosome 2, one normal chromosome 5, and two normal
chromosomes 2.

46,X,der(X)ins(X;7)(p21 ;q21 q22)

A derivative X chromosome resulting from an insertion of the segment from 7q21 to 7q22 into band Xp21.
There are two normal chromosomes 7.

9.2.10 Inversions

The symbol inv is used. Whether it is a paracentric or pericentric inversion is apparent from
the band designations.

Structural Chromosome Cytogenet Genome Res 2016;149:1-140 69

Rearrangements DOI: 10.1159/000445813
 46,XX,inv(2)(pl3p23)
Paracentric inversion in which breakage and reunion have occurred at bands 2pl3 and 2p23.
The breakpoint more proximal to the centromere is specified first.

46,XX,inv(3)(q21q26.2)
46,XX,inv(3)(pter^q21::q26.2^q21::q26.2^qter)
Paracentric inversion in which breakage and reunion have occurred at bands 3q21 and 3q26.2.

46,XY,inv(3)(pl3q21)
46,XY,inv(3)(pter->pl 3::q21 ->pl 3::q21 -^qter)
Pericentric inversion in which breakage and reunion have occurred at bands 3pl 3 and 3q21. The breakpoint
in the short arm is specified first.

9.2.11 Isochromosomes

The symbol i (not iso) is used for isochromosomes and idic for isodicentric chromosomes. The
breakpoints in isochromosomes are assigned to the centromeric bands plO and qlO according
to the morphology of the isochromosome. See also Section 9.2.4.

46,XX,i(17)(qlO)
46 ,XX,i( 17)(qter-> q 10: :q 10 -> qter)
An isochromosome for the entire long arm of one chromosome 17 and consequently the breakpoint is assigned
to 17q 10. There is one normal chromosome 17. The shorter designation i(17q) may be used in text but not in
the karyotype to describe this isochromosome.

46,X,i(X)(qlO)
46, X,i(X)(qter-> q 10: :q 10 -► qter)
One normal X chromosome and an isochromosome for the long arm of one X chromosome.

47, XY,i(X)(qlO)
A male showing an isochromosome of the long arm of the X chromosome in addition to a normal X and Y.

46,XX,idic(17)(pl 1.2)
46,XX,idic( 17)(qter->p 11.2: :p 11.2 -> qter)
An isodicentric chromosome composed of the long arms of chromosome 17 and the short arm materials be­
tween the centromeres and the breakpoints in 17p 11.2.

46,XX,i(21)(qlO)
An isochromosome of the long arm of chromosome 21 has replaced one chromosome 21. There are two copies
of the long arm of chromosome 21 in the isochromosome and one normal copy of chromosome 21. Even though
there are effectively three copies of the long arm of chromosome 21, the normal chromosome 21 is not desig­
nated with a plus sign (+). Note that an alternative description for this same chromosomal rearrangement based
on G-banding is found in Section 9.2.17.3 and makes the additional copy of chromosome 21 more obvious.

Complex isochromosomes, including isoderivative chromosomes, are described as derivative

chromosomes, see Section 9.2.3.

9.2.12 Marker Chromosomes

A marker chromosome (mar) is a structurally abnormal chromosome that cannot be unambigu­

ously identified or characterized by conventional banding cytogenetics. Numerous terms have
been used in the literature to describe markers, including “supernumerary marker chromosomes

70 Cytogenet Genome Res 2016;149:1-140 ISCN 2016

DOI: 10.1159/000445813
(SMC),” “extra structurally abnormal chromosomes (ESAC),” “supernumerary ring chromo­
somes (SRC),” and “accessory chromosomes (AC)”; see Liehr et al. (2004) for a review of these
abnormalities. Whenever any part of an abnormal chromosome can be recognized, it is a de­
rivative chromosome (der) and can be adequately described by the nomenclature for derivative
chromosomes (see Section 9.2.3). For placement of mar in the karyotype, see Chapter 6. In the
description of a karyotype, the presence of a mar must be preceded by a plus sign (+). No attempt
should be made to describe the morphology or size of markers in karyotypes. Using min mar,
A-size mar, aero mar, etc., is discouraged. If such information is relevant, it should be described
in words in the text.

XX,+mar
47,
One additional marker chromosome.

47, XX,t(12;I6)(ql3;pll.2),+mar
One marker chromosome in addition to t( 12; 16).

48, X,t(X;I8)(pl I.2;ql 1.2),+2mar

Two marker chromosomes in addition to t(X;18).

47—51 ,XY,t( 11 ;22)(q24;q 12),+1 ~ 5mar[cp 10]

In this tumor there are, in addition to a t(l 1;22), five clonally occurring markers, but not all cells contain all
the markers.

When several different markers are clonally present, they may be indicated by an Arabic num­
ber after the symbol mar, e.g., marl, mar2, etc. It must be stressed that this does not mean
derivation of the marker from chromosome 1, chromosome 2, and so on. Multiple copies of
the same marker are indicated by a multiplication sign after the mar designation, e.g., mar 1x2
indicates two markers 1; mar 1x3 indicates three markers 1, and so on.

48, XX,i(17)(ql0),+marl,+mar2[17]/51,XX,i(17)(ql0),+marlx3,+mar2,+mar3[13]
There are two different markers (marl and mar2) in the clone with 48 chromosomes. The clone with 51 chro­
mosomes has three copies of marl, one copy of mar2, and in addition a third marker (mar3).

As soon as any part of an abnormal chromosome can be recognized, even if the origin of the
centromere is unknown, this abnormal chromosome is referred to as a der and not as a mar
(see Section 9.2.3).

XX,+der(?)t(?;
47, 15)(?;q22)
The centromere of this abnormal chromosome is unknown and hence it is designated der(?), but part of the
chromosome is composed of the chromosome 15 segment distal to band 15q22.

Double minutes, abbreviated dmin, represent a special kind of acentric structures that should
be recorded in the karyotype when present in more than one metaphase cell. Note that the
dmin should not be included in the chromosome count, and that the symbol should not be
preceded by a plus sign. It is placed after any centric marker. The number of dmin per cell
should be presented before the symbol either in absolute numbers or as a mean or a range.

49, XX,... ,+3mar, 1 dmin

A tumor with one dmin per cell.

49,XY,... ,+3mar,~ 14dmin

A tumor with approximately 14 dmin per cell.

Structural Chromosome Cytogenet Genome Res 2016;149:1-140 71

Rearrangements DOI: 10.1159/000445813
 49,XX,.. .,+3mar,9~34dmin
A tumor with 9 to 34 dmin per cell.

Acentric fragments (ace) other than dmin, even if present in more than one cell, should not
be presented in the karyotype, but must be recorded in chromosome breakage studies (see
Chapter 10).

9.2.13 Neocentromeres

A neocentromere is a functional centromere that has arisen or been activated within a region
not known to have a centromere. A chromosome with a neocentromere may be described with
the symbol neo or as a derivative chromosome with the assumption that a new centromere
has arisen (or has been activated) within the region(s) from which the chromosome segment
was derived.

XX,+der(3)(qter^q28:)
47,
An additional derivative chromosome containing segments 3q28 through 3qter. Because this segment usu­
ally does not contain a centromere, this example is a chromosome with a neocentromere. In this example, neo
could be used instead of der: 47,XX,+neo(3)(qter->q28:). Also, the location of the neocentromere could be
indicated by the symbol neo: 47,XX,+der(3)(qter->q28->neo->q28:). Note that the short system may not be
adequate to describe this chromosome.

47,XX,der(3)(:pl l->ql l:),+neo(3)(pter->pl I::qll->q26-*neo->q26~>qter)

Chromosome 3 has been replaced by a derivative small chromosome containing the chromosome 3 centro­
mere and by a large chromosome composed of the remaining part of chromosome 3 where a neocentromere
has been activated at 3q26.

Unlike duplications in which the orientation of the duplicated segment is indicated by the
order of the bands with respect to the centromere, a supernumerary marker chromosome con­
taining a neocentromere may require the use of the detailed system depending on the circum­
stance.

47 ,XX,+dup( 10)(qt er q2 5:: q2 5 -► qt er)

47,XX,+dup(10)(qter->q25::q25->q26->neo^q26->qter)
A supernumerary chromosome that is a duplication of the segments between bands 10q25 and lOqter. Because
this segment does not usually contain a centromere, this example is a derivative chromosome with a neocen­
tromere. The location of the neocentromere could be indicated as shown.

9.2.14 Quadruplications

The symbol qdp is used. It is not possible to indicate the orientation(s) of the segment with
the short system.

46,XX,qdp(l)(q23q32)
46,XX,qdp(l)(pter^q32::q23^q32::q23-+q32::q23^qter)
Quadruplication of the segment between bands lq23 and lq32.

9.2.15 Ring Chromosomes

A ring, designated by the symbol r, may be composed of one or several chromosomes.

72 Cytogenet Genome Res 2016;149:1-140

ISCN 2016
DOI: 10.1159/000445813
Ring chromosomes derived from one chromosome

As in other rearrangements affecting a single chromosome, there is no semicolon between the

band designations.

46,
XX,r(7)(p22q36)
46,XX,r(7)(::p22^q36::)
Ring chromosome in which breakage and reunion have occurred at bands 7p22 and 7q36. The segments dis­
tal to these breakpoints have been deleted.

Ring chromosomes derived from more than one chromosome

Ring chromosomes derived from more than one chromosome may contain one or several
centromeres.
Monocentric ring chromosomes are treated as derivative (der) chromosomes (see Section
9.2.3). The chromosome that provides the centromere is listed first. The orientation of the
acentric segment is apparent from the order of the breakpoints.

46,XX,der(l)r(l;3)(p36.1q23;q21q27)
46,XX,der(l)(::lp36.1->lq23::3q21->3q27::)
A ring composed of chromosome 1 with breakpoints in lp36.1 and lq23, and the acentric segment between
bands 3q21 and 3q27 of chromosome 3.

46,XX,der( 1)r(1; 3)(p36.1 q23;q27q21)

46,XX,der(l)(::lp36.1->lq23::3q27^3q21::)
A ring with the same breakpoints as in the previous example, but the orientation of the acentric segment is
reversed.

46,XX,der(l)r(l;?)(p36.1q23;?)
46, XX,der(l)(::lp36.1^1q23::?::)
A ring composed of chromosome 1 with breakpoints in lp36.1 and lq23, and an unknown acentric segment.

If the centromere of the ring chromosome is not known, but segments from other chromo­
somes contained in the ring are recognized, the ring is designated der(?).

47, XX,+der(?)r(?;3;5)(?;q21q26.2;ql3q33)
47,XX,+der(?)(::?->cen->?::3q21->3q26.2::5ql3->5q33::)
In this ring the origin of the centromere is unknown, but the ring contains the acentric segments 3q21 to 3q26.2
and 5ql3 to 5q33.

Dicentric or tricentric ring chromosomes are designated by the symbol r preceded by the trip­
let die or trc.
In dicentric ring chromosomes (die r), the sex chromosomes or the autosome with the low­
est number is specified first.

47,XX,+dic r(l;3)(p36.1q32;p24q26.2)
47,XX,+dic r(l;3)(::lp36.1-+lq32::3p24-»3q26.2::)
A dicentric ring composed of chromosomes 1 and 3 in which lq32 is fused with 3p24 and 3q26.2 is fused
with lp36.1.

Structural Chromosome Cytogenet Genome Res 2016;149:1-140 73

Rearrangements DOI: 10.1159/000445813
 In tricentric ring chromosomes (trc r), the sex chromosomes or the autosome with the lowest
number is specified first. The orientation of the chromosomes will be apparent from the order
of the breakpoints.

47,XX,+trc r(l;3;12)(p36.1q32;q26.3p24;pl2q23)
47,XX,+trc r(l;3;12)(::lp36.1^1q32::3q26.3-*3p24::12pl2-12q23::)
A tricentric ring in which lq32 is fused with 3q26.3, 3p24 with 12p 12, and 12q23 with lp36.1.

When the origin of the ring is known, the description of the ring is placed in the appropriate
chromosome number order.

49, XX,+l,+3,r(7),+8

When the origin of the ring is not known, the presence of the ring, preceded by a plus sign (+),
is indicated at the end of the karyotype, but before any other marker chromosome (see Chap­
ter 6).

50, XX,+l,+3,+8,+r
51, XY,+ l,+3,+8,+r,+mar

Different rings may be indicated by an Arabic number after the symbol r, e.g., rl, r2, etc.,
whereas several copies of unidentified rings are indicated by the appropriate number before
the ring symbol, e.g., 5r.

53,XX,...,+rl,+r2
Two distinctly different clonally occurring rings. Note that the ring designations rl and r2 do not mean deri­
vation from chromosomes 1 and 2. When the origin of a ring is known, the appropriate chromosome is placed
in parentheses, e.g., r( 1), r(2), etc.

53,XY,...,+5r
A total of five rings but it is not known if any of the rings are identical.

9.2.16 Telomeric Associations

The symbol tas is used. In telomeric associations between two chromosomes, the sex chromo­
some or the autosome with the lowest number is specified first. When more than two chro­
mosomes are involved, the ‘end’ chromosome which has the lowest number, or is one of the
sex chromosomes, is specified first, followed by the other chromosomes in the order they are
associated with the chromosome listed first. The terminal bands of the chromosomes involved
in telomeric association(s) are given in the second parentheses; the orientation of the chro­
mosomes will be apparent from the order in which the bands are listed. Chromosomes in­
volved in telomeric associations are counted as separate chromosomes.

46,XX,tas(12;13)(q24.3;q34)
46,XX,tas(12; 13)(12pter^ 12qter-> 13qter-> 13pter)
Association between the telomeric regions of the long arms of chromosomes 12 and 13.

46,Y,tas(X;12;3)(q28;pl3q24.3;q29)
46,Y,tas(X; 12; 3)(Xpter->Xqter-> 12pter-> 12qter-> 3qter-> 3pter)
Association between the telomeric regions of Xq and 12p, and 12q and 3q.

74 Cytogenet Genome Res 2016;149:1-140 ISCN 2016

DOI: 10.1159/000445813
 46,X,tas(l;X;12;7)(p36.3;q28p22.3;pl3q24.3;p22)
46,X,tas(l;X;12;7)(lqter-> lpter-*Xqter-»Xpter-> 12pter~* 12qter~>7pter-*7qter)
Association between the telomeric regions of lp and Xq, Xp and 12p, and 12q and 7p.

9.2.17 Translocations

9.2.17.1 Reciprocal Translocations

In translocations (t) affecting two chromosomes, the sex chromosome or the autosome with
the lowest number is always specified first. The same rule is followed in translocations involv­
ing three chromosomes, but in these rearrangements the chromosome specified next is the
one receiving a segment from the one listed first, and the chromosome specified last is the
one donating a segment to the first chromosome listed. Whenever applicable, the same rules
should be followed in four-break and more complex balanced translocations. In order to dis­
tinguish homologous chromosomes, one of the numerals may be underlined (single underlin-
ing).

Two-break rearrangements

46,XY,t(2;5)(q21;q31)
46,XY,t(2;5)(2pter-+2q21 ::5q31 5 qter; 5 pt er5q31 ::2q21 ^2qter)
Breakage and reunion have occurred at bands 2q21 and 5q31. The segments distal to these bands have been
exchanged.

46,XY,t(2;5)(pl2;q31)
46,XY,t(2;5)(5qter->5q31::2pl2->2qter;5pter->5q31::2pl2->2pter)
Breakage and reunion have occurred at bands 2pl2 and 5q31. The segments distal to these bands have been
exchanged.

46,X,t(X;13)(q27;ql2)
46,X,t(X;13)(Xpter->Xq27::13ql2- >13qter;13pter-)T3ql2::Xq27->Xqter)
Breakage and reunion have occurred at bands Xq27 and 13ql2. The segments distal to these bands have been
exchanged. Since one of the chromosomes involved in the translocation is a sex chromosome, it is designated
first. Note that the correct designation is 46,X,t(X;13) and not 46,XX,t(X;13). Similarly, an identical trans­
location in a male should be designated 46,Y,t(X;13) and not 46,XY,t(X;13).

46,t(X;Y)(q22;qll.2)
46,t(X;Y)(Xpter^Xq22::Yql 1.2-»Yqter;Ypter-Yql 1.2::Xq22-Xqter)
A reciprocal translocation between an X chromosome and a Y chromosome with breakpoints at bands Xq22
and Yqll.2.

46,t(X;18)(pll.2;qll.2),t(Y;l)(qll.2;p31)
46,t(X;18)(18qter-*T8qll.2::Xpll.2->Xqter;18pter-*18qll.2::Xpll.2->Xpter),t(Y;l)
(Ypter->Yql 1.2:: lp31-+lpter;Yqter->Yql 1.2:: lp31-4 qter)
Two reciprocal translocations, each involving one sex chromosome. Breakage and reunion have occurred at
bands Xpl 1.2 and 18q 11.2 as well as at bands Yql 1.2 and lp31. Abnormalities of the X chromosome are
listed before those of the Y chromosome.

Three-break rearrangements

46,XX,t(2;7;5)(p21;q22;q23)
46,XX,t(2;7;5)(5qter->5q23::2p21->2qter;7pter->7q22::2p21->2pter;5pter->
5q23::7q22->7qter)

Structural Chromosome Cytogenet Genome Res 2016;149:1-140 75

Rearrangements DOI: 10.1159/000445813
 The segment on chromosome 2 distal to 2p21 has been translocated onto chromosome 7 at band 7q22, the
segment on chromosome 7 distal to 7q22 has been translocated onto chromosome 5 at 5q23, and the segment
of chromosome 5 distal to 5q23 has been translocated onto chromosome 2 at 2p21.

X,t(X;22;l)(q24;qll.2;p33)
46,
46,X,t(X;22;l)(Xpter->Xq24::lp33-> lpter;22pter->22ql 1.2::Xq24->Xqter;22qter->
22qll.2::lp33-*lqter)
The segment on one X chromosome distal to Xq24 has been translocated onto chromosome 22 at band
22ql 1.2, the segment distal to 22ql 1.2 has been translocated onto chromosome 1 at band lp33, and the seg­
ment distal to lp33 has been translocated onto the X chromosome at band Xq24.

46,XX,t(2;7;7)(q21 ;q22;p 13)

46,XX,t(2;7;7)(2pter->2q21::7pl3->7pter;7pter-*7q22::2q21->2qter;7qter->7q22::7pl3-*
7qter)
The segment on chromosome 2 distal to 2q21 has been translocated onto chromosome 7 at band 7q22, the
segment on chromosome 7 distal to 7q22 has been translocated onto the homologous chromosome 7 at band
7pl3, and the segment distal to 7pl3 on the latter chromosome has been translocated onto chromosome 2 at
2q21. Underlining is used only to emphasize that the chromosomes are homologous. However, this is usually
not necessary since if the same chromosome 7 had been involved, the resulting chromosome 7 would have to
be described as a derivative chromosome.

Four-break and more complex rearrangements

46,XX,t(3;9;22;21)(pl3;q34;ql 1.2;q21)
46,XX,t(3;9;22;21)(21qter-*21q21::3pl3->3qter;9pter->9q34::3pl3->3pter;22pter->
22ql 1.2::9q34->9qter;21pter->21q21::22ql 1.2->22qter)
The segment of chromosome 3 distal to 3pl3 has been translocated onto chromosome 9 at 9q34, the segment
of chromosome 9 distal to 9q34 has been translocated onto chromosome 22 at 22ql 1.2, the segment of chro­
mosome 22 distal to 22ql 1.2 has been translocated onto chromosome 21 at 21 q21, and the segment of chro­
mosome 21 distal to 21q21 has been translocated onto chromosome 3 at 3pl3.

46,XX,t(3;9;9;22)(pl3;q22;q34;ql 1.2)
46,XX,t(3;9;9;22)(22qter->22ql 1.2::3pl3^3qter;9pter^9q22::3pl3^3pter;9pter^
9q34::9q22^9qter;22pter^22ql 1.2::9q34->9qter)
Four-break rearrangement involving the two homologous chromosomes 9. The segment on chromosome 3
distal to 3pl3 has been translocated onto chromosome 9 at band 9q22, the segment on chromosome 9 distal
to 9q22 has been translocated onto the homologous chromosome 9 at 9q34, the segment on the latter chromo­
some 9 distal to 9q34 has been translocated onto chromosome 22 at 22ql 1.2, and the segment on chromosome
22 distal to 22ql 1.2 has been translocated onto chromosome 3 at 3pl3.

46,XY,t(5;6)(ql3q23;ql5q23)
46,XY,t(5;6)(5pter->5ql3::6ql5->6q23::5q23->5qter;6pter->6ql5::5ql3-*5q23::6q23->
6qter)
Four-break rearrangement involving two chromosomes. The segment between bands 5ql3 and 5q23 in chro­
mosome 5 and the segment between bands 6ql5 and 6q23 in chromosome 6 have been exchanged.

46,XX,t(5;14;9)(ql3q23;q24q21;pl2p23)
46,XX,t(5;14;9)(5pter->5ql3::9pl2->9p23::5q23->5qter;14pter->14q21::5ql3^
5q23::14q24-> 14qter;9pter->9p23::14q21-* 14q24::9pl2->9qter)
Reciprocal six-break translocation of three interstitial segments. The segment between bands 5q 13 and 5q23
on chromosome 5 has replaced the segment between bands 14q21 and 14q24 on chromosome 14, the segment
14q21q24 has replaced the segment between bands 9pl2 and 9p23 on chromosome 9, and the segment
9pl2p23 has replaced the segment 5ql3q23. The orientations of the segments in relation to the centromere
are apparent from the order of the bands. The segment 14q21q24 is inverted.

76 Cytogenet Genome Res 2016;149:1-140 ISCN 2016

DOI: 10.1159/000445813
 The derivative chromosomes produced by malsegregation of a reciprocal translocation should
be described using the conventions outlined in Section 9.2.3.

9.2.17.2 Whole-Arm Translocations

Whole-arm translocations are described by assigning the breakpoints to the centromeric

bands plO and qlO according to the morphology of the abnormal chromosomes. In balanced
whole-arm exchanges, the breakpoint in the chromosome which has the lowest number, or is
a sex chromosome, is assigned to plO.

46,XY,t(l;3)(plO;qlO)
46,XY,t(I;3)(Ipter->lpI0::3ql0->3qter;3pter->3pl0::lql0->Iqter)
Reciprocal whole-arm translocation in which the short arm of chromosome 1 has been fused at the centromere
with the long arm of chromosome 3 and the long arm of chromosome 1 has been fused with the short arm of
chromosome 3.

46,XY,t(l;3)(plO;plO)
46,XY,t( 1; 3)( 1 pter-> 1 p 10:: 3p 10 ->■ 3pter; 1 qter -> 1 q 10:: 3q 10 3qter)
Reciprocal whole-arm translocation in which the short arms of chromosomes 1 and 3 and the long arms of
these chromosomes, respectively, have been fused at the centromeres.

In the description of karyotypes containing derivative chromosomes resulting from unbal­

anced whole-arm translocations (see Section 9.2.3), the derivative chromosome (der) replaces
the two normal chromosomes involved in the translocation. The two missing normal chro­
mosomes are not specified. The imbalance(s) can be inferred from the karyotype designation.

45,XX,der(l;3)(pI0;ql0)
45, XX,der(l;3)(lpter->lpI0::3ql0->3qter)
A derivative chromosome consisting of the short arm of chromosome 1 and the long arm of chromosome 3.
The missing chromosomes 1 and 3 are not indicated since they are replaced by the derivative chromosome.
The karyotype contains one normal chromosome 1, one normal chromosome 3, and the der(l;3). The result­
ing net imbalance of this abnormality is monosomy for the long arm of chromosome 1 and monosomy for the
short arm of chromosome 3.

46, XX,+1 ,der( 1; 3)(p 10;q 10)

A derivative chromosome consisting of the short arm of chromosome 1 and the long arm of chromosome 3
(same as above) has replaced one chromosome 1 and one chromosome 3. There are, however, two normal
chromosomes 1, i.e., an additional chromosome 1 in relation to the expected loss due to the der(l;3). Conse­
quently, this gain is indicated as +1. The karyotype contains two normal chromosomes 1, one normal chro­
mosome 3, and the der(l;3). The resulting net imbalance is trisomy for Ip and monosomy for 3p.

46, XX,der( 1; 3)(p 10;q 10),+3

A derivative chromosome consisting of the short arm of chromosome 1 and the long arm of chromosome 3
(same as above) has replaced one chromosome 1 and one chromosome 3. There are, however, two normal
chromosomes 3, i.e., an additional chromosome 3 in relation to the expected loss due to the der(l;3). Conse­
quently, this gain is indicated as +3. The karyotype contains one normal chromosome 1, two normal chromo­
somes 3, and the der(l;3). The resulting net imbalance is monosomy for Iq and trisomy for 3q.

47, XX,+der(l;3)(plO;qlO)
An extra derivative chromosome consisting of the short arm of chromosome 1 and the long arm of chro­
mosome 3 (same as above). There are two normal chromosomes 1, two normal chromosomes 3, and the
der(l;3). The resulting net imbalance is trisomy for Ip and trisomy for 3q.

Structural Chromosome Cytogenet Genome Res 2016;149:1-140 77

Rearrangements DOI: 10.1159/000445813
 44, XY,-l,der(l;3)(plO;qlO)
A derivative chromosome consisting of the short arm of chromosome 1 and the long arm of chromosome 3
(same as above) has replaced one chromosome 1 and one chromosome 3. There is, however, no normal chro­
mosome 1, indicated as -1 in relation to the expected presence of one chromosome 1 due to the der(l;3). The
karyotype contains no chromosome 1, one normal chromosome 3, and the der(l;3). The resulting net imbal­
ance is nullisomy for lq, monosomy for lp, and monosomy for 3p.

9.2.17.3 Robertsonian Translocations

These special types of translocations originate through translocation of the acrocentric chro­
mosomes 13-15 and 21-22. The breakpoints mostly occur in the short arms, resulting in di­
centric chromosomes. Breaks may also occur in one short arm and one long arm of the par­
ticipating chromosomes, resulting in monocentric rearrangements. Usually there is simulta­
neous loss of the remaining short arms. Either rob or der can adequately describe these
whole-arm translocations.

45, XX,der(13;21)(qlO;qlO)
45, XX,rob(13;21)(qlO;qlO)
Breakage and reunion have occurred at band 13ql0 and band 21ql0 in the centromeres of chromosomes 13
and 21. The derivative chromosome has replaced one chromosome 13 and one chromosome 21 and there is
no need to indicate the missing chromosomes. The karyotype contains one normal chromosome 13, one nor­
mal chromosome 21, and the der( 13;21). The resulting net imbalance is loss of the short arms of chromosomes
13 and 21.

46, XX,der(13;21)(qlO;qlO),+21
46,XX,rob(13;21)(qlO;qlO),+21
A derivative chromosome consisting of the long arm of chromosome 13 and the long arm of chromosome 21
(same as above) has replaced one chromosome 13 and one chromosome 21. There are, however, two normal
chromosomes 21, i.e., an additional chromosome 21 in relation to the expected loss due to the der(13;21).
Consequently, this gain is indicated as +21. The karyotype contains one normal chromosome 13, two normal
chromosomes 21, and the der(13;21). The resulting net imbalance is loss of the short arm of chromosome 13
and trisomy for the long arm of chromosome 21.

46,XX,+ 13,der(13;21)(qlO;qlO)
46,XX,+ 13,rob(13;21)(qlO;qlO)
A derivative chromosome consisting of the long arm of chromosome 13 and the long arm of chromosome 21
(same as above) has replaced one chromosome 13 and one chromosome 21. There are, however, two normal
chromosomes 13, i.e., an additional chromosome 13 in relation to the expected loss due to the der(13;21).
Consequently, this gain is indicated as +13. The karyotype contains two normal chromosomes 13, one normal
chromosome 21, and the der(13;21). The resulting net imbalance is loss of the short arm of chromosome 21
and trisomy for the long arm of chromosome 13.

If only a single chromosome is involved in the rearrangement, the extra chromosome is indi­
cated by the 46 count in the presence of a whole-arm rearrangement and the addition of a
normal chromosome.

46,XX,+21 ,der(21 ;21 )(q 10;q 10)

46,XX,+21,rob(21;21)(qlO;qlO)
A derivative chromosome composed of the long arms of chromosome 21. There are two copies of the long
arm of chromosome 21 in the derivative chromosome and one normal chromosome 21, indicated by the 46
count. The normal chromosome 21 is designated with a (+) sign. See also Section 9.2.11 for an alternate de­
scription of this same rearrangement.

The abbreviation rob should not be used in the description of acquired abnormalities.

78 Cytogenet Genome Res 2016;149:1-140 ISCN 2016

DOI: 10.1159/000445813
 If it is proven that the derivative chromosome resulting from a whole-arm translocation is
dicentric, i.e., the breakpoints have been assigned to pl 1.2 or ql 1.2, the abbreviation die
should be used and the dicentric chromosome should be described accordingly (see Section
9.2.4).

9.2.17.4 Jumping Translocations

These can be described by the standard nomenclature for translocations. The clones are pre­
sented in the same order as unrelated clones, i.e., in order of decreasing frequency (see Section
11.1.6).

46,XX,t(4;7)(q35;ql 1.2)[6]/46,XX,t(l;7)(p36.3;ql 1.2)[4]/46,XX,t(7;9)(ql 1.2;p24)[3]

Three clonal translocations involving band 7ql 1.2. The segment 7ql 1.2qter is translocated to bands lp36.3,
4q35, and 9p24.

9.2.18 Tricentric Chromosomes

The symbol tre is used. The ‘end’ chromosome which has the lowest number, or is one of the
sex chromosomes, is specified first. The other chromosomes are listed in the order they are
attached to the chromosome listed first. The orientation of the chromosomes will be apparent
from the order of the breakpoints specified in the second parentheses. A tricentric chromo­
some is counted as one chromosome.

44,XX,trc(4;12;9)(q31.2;q22pl3;q34)
44,XX,trc(4;12;9)(4pter->4q31.2::12q22-> 12pl3::9q34->9pter)
A tricentric chromosome in which band 4q31.2 is fused with 12q22 and 12p 13 is fused with 9q34.

9.2.19 Triplications

The symbol trp is used. It is not possible to indicate the orientation(s) of the segment in the
short system, but this can be done with the detailed system.

46,XX,trp(l)(q21q32)
46,XX,trp(l)(pter->q32::q21->q32::q21->qter)
Triplication of the segment between bands lq21 and lq32, one of several possible orientations of the triplica­
tions of this segment.

46,XX,trp(l)(q32q21)
46,XX,trp( 1 )(pter-> q32: :q32 -► q21: :q21 -» qter)
Triplication of the segment between bands 1 q21 and lq32 in an opposite orientation to the above example.

9.3 Multiple Copies of Rearranged Chromosomes

The multiplication sign (x) can be used to describe two or more copies of a structurally rear­
ranged chromosome. The number of copies (x2, x3, etc.) should be placed after the abnormal­
ity. The multiplication sign should not be used to denote multiple copies of normal chromo­
somes.

Structural Chromosome Cytogenet Genome Res 2016;149:1-140 79

Rearrangements DOI: 10.1159/000445813
46, XX,del(6)(ql3q23)x2
Two deleted chromosomes 6 with breakpoints at bands 6ql3 and 6q23, and no normal chromosome 6. Since
the two abnormal chromosomes replace the two normal chromosomes, there is no need to indicate the miss­
ing normal chromosomes.

XY,+del(6)(ql3q23)x2
48,
Two normal chromosomes 6 plus two additional deleted chromosomes 6 with breakpoints at bands 6ql 3 and
6q23.

47, XX,del(6)(ql3q23)x2,+del(6)(ql3q23)
There are three copies of a deleted chromosome 6 and no normal chromosome 6, i.e., two of the deleted chro­
mosomes replace the two normal chromosomes 6. Note that the supernumerary deleted chromosome 6 has
to be preceded by a plus sign.

48, XX,del(6)(ql3q23)x2,+7,+7
Two deleted chromosomes 6 replace the two normal chromosomes 6; in addition, there are two extra chro­
mosomes 7.

48,XX,t(8; 14)(q24.1 ;q32),+der( 14)t(8; 14)x2

A balanced t(8; 14) plus two additional copies of the derivative chromosome 14.

92, XXXX,t(8; 14)(q24.1 ;q32)x2

A tetrapioid clone with two balanced t(8; 14). The two derivative chromosomes 8 and 14 replace two normal
chromosomes 8 and 14. There are two normal chromosomes 8 and 14.

94,XXYY,t(8; 14)(q24.1 ;q32)x2,+der( 14)t( 8; 14)x2

A hypertetraploid clone with two balanced t(8; 14) plus two additional copies of the derivative chromosome
14. There are two normal chromosomes 8 and 14.

93, XXXX,t(8;14)(q24.1;q32)x2,der(14)t(8;14)x2,+der(14)t(8;14)
A hypertetraploid clone with two balanced t(8; 14) and three extra copies of the derivative chromosome 14,
i.e., there are in total five der(14), four of which replace the normal chromosomes 14; consequently there is
no normal chromosome 14.

94, XXYY,t(8; 14)(q24.1 ;q32)x2,+14,der( 14)t(8; 14)x2,+der( 14)t(8; 14)

A hypertetraploid clone with two balanced t(8; 14), three extra copies of the derivative chromosome 14, and
one normal chromosome 14.

47,XX,+8,i(8)(qlO)x2
47,XX,i(8)(qlO),+i(8)(qlO)
Alternative descriptions of the same chromosome complement with one normal chromosome 8 and two cop­
ies of an isochromosome for the long arm of chromosome 8.

80 Cytogenet Genome Res 2016;149:1-140 ISCN 2016

DOI: 10.1159/000445813
10 Chromosome Breakage

This section provides a nomenclature for the chromatid and chromosome aberrations that
may be observed in, for example, constitutional chromosome breakage syndromes or follow­
ing clastogenic exposure. Since many aberrations of this kind are scored on unbanded mate­
rial, recommendations are given first for non-banded preparations and then for banded prep­
arations.

10.1 Chromatid Aberrations

10.1.1 Non-Banded Preparations

A chromatid (cht) aberration involves only one chromatid in a chromosome at a given locus.
A chromatid gap (chtg) is a non-staining region (achromatic lesion) of a single chromatid
in which there is minimal misalignment of the chromatid.
A chromatid break (chtb) is a discontinuity of a single chromatid in which there is a clear
misalignment of one of the chromatids.
A chromatid exchange (chte) is the result of two or more chromatid lesions and the subse­
quent rearrangement of chromatid material. Exchanges may be between chromatids of differ­
ent chromosomes (interchanges) or between or within chromatids of one chromosome (intra­
changes). In the case of interchanges, it will generally be sufficient to indicate whether the
configuration is triradial (tr) when there are three arms to the pattern, quadriradial (qr) when
there are four, or complex (ex) when there are more than four. The number of centromeres
may be indicated within parentheses (1 cen, 2 cen, etc.). When necessary, exchanges may be
classified in more detail. Asymmetrical exchanges inevitably result in the formation of an
acentric fragment, whereas symmetrical ones do not. In complete exchanges all the broken
ends are rejoined, but not in incomplete ones. In asymmetrical exchanges, the incompleteness
may be proximal when the broken ends nearest the centromere are not rejoined or distal when
the ends farthest from the centromere are not rejoined. Intra-arm events include duplications,
deletions, paracentric inversions, and isochromatid breaks showing sister reunion. It should
be noted that these terms are only descriptive and do not imply knowledge of the origin of the
aberrations.
Sister chromatid exchange, detectable only by special staining methods, results from the
interchange of homologous segments between two chromatids of one chromosome. The sym­
bol see can be used to describe this event.

Chromosome Breakage Cytogenet Genome Res 2016;149:1-140 81

DOI: 10.1159/000445813
10.1.2 Banded Preparations

Some chromatid aberrations can be defined more precisely or can be recognized with cer­
tainty only in banded preparations; e.g., a chromatid deletion (cht del) is the absence of a
banded sequence from only one of the two chromatids of a single chromosome. A chromatid
inversion (cht inv) is the reversal of a banded sequence of only one of the two chromatids of
a single chromosome. Both are subclasses of chromatid exchanges (chte).
Where it is desired to specify the location of a chromatid aberration, the appropriate sym­
bol can be followed by the band designation.

chtg(4)(q25) Chromatid gap in chromosome 4 at band 4q25.

chtb(4)(q25) Chromatid break in chromosome 4 at band 4q25.
chte(4; 10)(q25 ;q22) Chromatid exchange involving chromosomes 4 and 10 at bands 4q25
and 10q22.
cht del(l)(ql2q25) Chromatid deletion in chromosome 1 with loss of the segment between
bands lql2 and lq25.
cht inv(l)(ql2q25) Chromatid inversion in chromosome 1 with reversal of the segment
between bands 1 q 12 and lq25.
sce(4)(q25q33) Sister chromatid exchanges in chromosome 4 at bands 4q25 and 4q33.

10.2 Chromosome Aberrations

10.2.1 Non-Banded Preparations

A chromosome (chr) aberration involves both chromatids of a single chromosome at the same
locus.
A chromosome gap (chrg) is a non-staining region (achromatic lesion) at the same locus in
both chromatids of a single chromosome in which there is minimal misalignment of the chro­
matids. The term chromosome gap is synonymous with isolocus gap and isochromatid gap.
X chromosome break (chrb) is a discontinuity at the same locus in both chromatids of a
single chromosome, giving rise to an acentric fragment and an abnormal monocentric chro­
mosome. This fragment is therefore a particular type of acentric fragment (ace), and chrb
should be used only when the morphology indicates that the fragment is the result of a single
event. The term chromosome break is synonymous with isolocus break and isochromatid
break.
A chromosome exchange (chre) is the result of two or more chromosome lesions and the
subsequent relocation of both chromatids of a single chromosome to a new position on the
same or on another chromosome. It may be symmetrical (e.g., reciprocal translocation) or
asymmetrical (e.g., dicentric formation).
A minute (min) is an acentric fragment smaller than the width of a single chromatid. It may
be single or double. In the special situation when double minutes are present clonally in tumor
cells, the symbol dmin is used; see Section 9.2.12.
Pulverization (pvz) indicates a situation where a cell contains both chromatid and/or chro­
mosome gaps and breaks which are not normally associated with exchanges and are present
in such numbers that they cannot be enumerated. Occasionally, one or more chromosomes
in a cell are pulverized while the remaining chromosomes are of normal morphology; e.g.,
pvz(l) is a pulverized chromosome 1. The term chromothripsis (cth) describes complex pat­
terns of alternating copy number changes (normal, gain or loss) along the length of a chromo­

82 Cytogenet Genome Res 2016;149:1-140 ISCN 2016

DOI: 10.1159/000445813
 some or chromosome segment (Stephens et al., 2011). As these complex rearrangements can­
not be visualized on banded or non-banded chromosomes, this symbol is used after microar­
ray analysis (see Section 14.2.2).
Premature chromosome condensation (pcc) occurs when an interphase nucleus is prema­
turely induced to enter mitosis. A pcc may involve a G1 or a G2 nucleus. The chromatin of
S-phase nuclei undergoing pcc often appears to be pulverized.
The term premature centromere division (ped) may be used to describe premature separa­
tion of centromeres in metaphase. The ped may affect one or more chromosomes in a fraction
of the cells.
A marker chromosome (mar) is a structurally rearranged chromosome in which no part can
be identified (see Section 9.2.12).

10.2.2 Banded Preparations

When banded preparations allow adequate identification of chromosome segments or chro­

mosome aberrations, the nomenclature system recommended throughout this book can be
used. When not, the observations can be described in words.

10.3 Scoring of Aberrations

In the scoring of aberrations, the main types are chtg, chtb, chte, chrg, chrb, ace, min, r, die,
tr, qr, der, and mar, and reports should, where possible, give the data under these headings.
It is recognized, however, that aberrations are frequently grouped to give adequate numbers
for statistical analysis or for some other reason. When this is done, it should be indicated how
the groupings relate to the aberrations listed above, e.g.:

chromatid aberrations chtg, chtb, chte

fragments (= deletions) chrb, ace, min
asymmetric aberrations ace, die, r

The data should not be presented as deduced breakages per cell but in such a manner that it
is possible to calculate the number of aberrations per cell.

Chromosome Breakage Cytogenet Genome Res 2016;149:1-140 83

DOI: 10.1159/000445813
11 Neoplasia

Described below are definitions of terms and recommendations related to abnormalities com­
monly seen in neoplasia.

11.1 Clones and Clonal Evolution

11.1.1 Definition of a Clone

A clone is defined as a cell population derived from a single progenitor. It is common practice
to infer a clonal origin when a number of cells have the same or closely related abnormal chro­
mosome complements. A clone is therefore not necessarily completely homogeneous because
subclones may have evolved during the development of the tumor. A clone must have at least
two cells with the same aberration if the aberration is a chromosome gain or a structural rear­
rangement. If the abnormality is loss of a chromosome, the same loss must be present in at
least three cells to be accepted as clonal. The term may need to be operationally defined by
the author because the criteria for acceptance will depend on, e.g., the number of cells exam­
ined, the nature of the aberration involved, the type of culture, and the time cells spend in
vitro prior to harvest. In the special situation when in situ preparations are analyzed, the same
structural rearrangement or chromosomal gain must be present in at least two metaphase cells
from either different primary culture slides, or from well-separated areas or different cell col­
onies on the same slide. Loss of a single chromosome must be detected in at least three such
cells. However, two cells with identical losses of one or more chromosomes and the same chro­
mosome gain or structural aberration(s) may be considered clonal and included in the nomen­
clature.

XY,del(5)(ql3q33),-7,+8[2]/46,XY[18]
46,
46,
XX,t(6;ll)(q27;q23)[16]/45,X,-X,t(6;ll)(q27;q23)[2]/46,XX[l]

The karyotype designations of different clones and subclones are separated by a slant line (/).
For order of clone presentation, see Sections 11.1.4 and 11.1.6.
The general rule in tumor cytogenetics is that only the clonal chromosomal abnormalities
found in a tumor should be reported. If, for special reasons, nonclonal aberrations are pre­
sented, then these must be clearly separated from the clonal abnormalities and should not be
part of the description of the tumor karyotype. When the same abnormal clone has been found
in an initial and follow-up study, even in a single cell, it should be reported in the karyotype.

46,XX,t(9;22)(q34;q 11.2)[ 1 ]/46,XX[ 19]

84 Cytogenet Genome Res 2016;149:1-140 ISCN 2016

DOI: 10.1159/000445813
 Similarly, when a single abnormal cell is confirmed by a different method (e.g., FISH), and
thus shown to be clonal, it should be reported in the karyotype (see Section 13.3).

XX,del(20)(qll.2ql3.3)[l]/46,XX[19].nuc
46, ish(D20S108xl)[40/200]

When additional abnormalities are seen in a single cell, but not proven to be present with
another method, they should not be listed in the nomenclature but should be discussed in the
interpretation.

11.1.2 Clone Size

The number of cells that constitute a clone is given in square brackets [ ] after the karyotype.
When all cells are normal, the number of cells is still specified. In cancer cytogenetics, the
clones are written in order of increasing complexity, irrespective of the size of the clone.

46,XX[20]
A normal female karyotype identified in 20 metaphase cells.

46,XX,t(8;21)(q22;q22)[23]
A clone with t(8;21) identified in 23 metaphase cells.

46,XY,t(8;2 l)(q22;q22)[26]/47,XY,t(8;2 l)(q22;q22),+21 [7]

46,XY,t(8;21 )(q22;q22)[26]/47,idem,+2 1 [7]
46,XY,t(8;21 )(q22;q22)[26]/47,sl,+21 [7]
A clone with 46 chromosomes identified with a t(8;21) as the sole aberration in 26 cells and a subclone with
47 chromosomes with the t(8;21) and trisomy 21 in 7 cells. Alternatively, the terms idem or si may be used
to describe subclones (see Section 11.1.4 for details); however, the terms idem and si must never be intermixed
when describing a single tumor sample.

11.1.3 Mainline

The mainline is the most frequent chromosome constitution of a tumor cell population. It is
a purely quantitative term to describe the largest clone, and does not necessarily indicate the
most basic one in terms of progression. In some situations, when two or more clones are of
exactly the same size, a tumor may have more than one mainline. The terms idem and si may
be used to describe subclones (see Section 11.1.4 for details).

46,XX,t(9;22)(q34;ql 1.2)[3]/47,XX,+8,t(9;22)(q34;ql I.2)[17]

46,XX,t(9;22)(q34;qlI.2)[3]/47,sl,+8[17]
46,XX,t(9;22)(q34;qI1.2)[3]/47,idem,+8[17]
The clone with 47 chromosomes represents the mainline, although it has most probably evolved from the
clone with 46 chromosomes.

46,XX,der(2)t(2;5)(p23;q35)[10]/47,XX,+2,der(2)t(2;5)[16]
46,XX,der(2)t(2;5)(p23;q35)[10]/47,sl,+2[16]
46,XX,der(2)t(2;5)(p23;q35)[10]/47,idem,+2[16]
The clone with 47 chromosomes represents the mainline, although it has most probably evolved from the
clone with 46 chromosomes.

Neoplasia Cytogenet Genome Res 2016;149:1-140 85

DOI: 10.1159/000445813
11.1.4 Stemline, Sideline and Clonal Evolution

Cytogenetically related clones (subclones) are presented, as far as possible, in order of increas­
ing complexity, irrespective of the size of the clone. The stemline (si) is the most basic clone
of a tumor cell population and is listed first. All additional deviating subclones are termed
sidelines (sdl). To describe the stemlines or sidelines, these symbols, or the term idem [‘idem]
(Latin = same), can be used. If more than one sideline is present, these may be referred to as
sdll, sdl2, and so on.
In tumors with subclones the term idem can be used, followed by the additional changes
in relation to the stemline, which is listed first. Note that idem always refers to the karyotype
listed first. This means that in tumors with multiple subclones each clonal change in addition
to the first karyotype will have to be repeated. It also means that all plus and minus signs only
refer to changes in relation to the stemline karyotype. As an alternative, for more than one
sideline, si and sdl could be used. Note that when two or more stemlines are present, there
may also exist two or more sdll, sdl2 and so on, which will reduce clarity. In such instances
idem is preferred.

46,XX,t(9;22)(q34;qll.2)[3]/47,sl,+8[17]/48,sdll,+9[3]/49,sdl2,+ll[12]
46,XX,t(9;22)(q34;qll.2)[3]/47,idem,+8[17]/48,idem,+8,+9[3]/49,idem,+8,+9,+ll[12]
The clone with 46 chromosomes represents the stemline; the three subclones with 47,48 and 49 chromosomes
are sidelines. In the subclone with 47 chromosomes, the designation si indicates the presence of the abnormal
chromosomes seen in the stemline, i.e. t(9;22)(q34;ql 1.2) in addition to +8; this subclone is sideline 1 (sdll).
In the subclone with 48 chromosomes (sdl2), the designation sdll indicates the presence of the abnormal
chromosomes seen in the first sideline, i.e. t(9;22)(q34;ql 1.2),+8 in addition to +9, and so on. As an alterna­
tive, in each subclone the translocation 9;22 is replaced by idem.

46,XX,t(8;21)(q22;q22)[12]/45,sl,-X[19]/46,sdll,+8[5]/47,sdl2,+9[8]
46,XX,t(8;21)(q22;q22)[12]/45,idem,-X[19]/46,idem,-X,+8[5]/47,idem,-X,+8,+9[8]
The clone with t(8;21) as the sole anomaly is the most basic one and hence represents the stemline; the other
subclones are listed in order of increasing karyotypic complexity of the aberrations acquired during clonal
evolution.

XX,t(12;16)(ql3;pl
48, l.l),...[23]/49,sl,+6[8]/5O,sdl,+7,-8,+9[4]
48,
XX,t(12;16)(ql3;pll.l),...[23]/49,idem,+6[8]/50,idem,+6,+7,-8,+9[4]
The subclone with 49 chromosomes has all the abnormalities seen in the stemline plus an extra chromosome
6; the subclone with 50 chromosomes has all sdl abnormalities in addition to trisomy 7, monosomy 8, and
trisomy 9.

The term si or sdl times a number (x2, x3, etc.) may be used to designate aberrant polyploid
clones. Alternatively, the term idem times a number (x2, x3, etc.) may be used to designate
aberrant polyploid clones. Additional abnormalities in the polyploid clone may then be indi­
cated using conventional terminology (see Sections 8.1 and 9.1).

26,X,+4,+6,+21[3]/52,idemx2[13]
A near-haploid clone with two copies of chromosomes 4, 6, and 21, and a single copy of all other chromosomes
is the stemline. An abnormal subclone, a doubling of the near-haploid clone (due to endoreduplication), is
also identified.

46,XY,t(9;22)(q34;qll.2)[3]/92,slx2[5]/93,sdl,+8[2]
46,XY,t(9;22)(q34;ql 1.2)[3]/92,idemx2[5]/93,idemx2,+8[2]
The clone with the t(9;22) is the stemline. Two additional abnormal subclones are identified, one a doubling
product or tetrapioid subclone of the stemline (si) and a near-tetraploid (sdl) subclone with gain of chromo­
some 8. As an alternative, idem may be used, but all subclones refer back to the stemline.

86 Cytogenet Genome Res 2016;149:1-140 ISCN 2016

DOI: 10.1159/000445813
46,
XY,t(9;22)(q34;ql 1.2)[3]/47,sl,+8[10]/48,sdl,+der(22)t(9;22)[4]/47,sl,+19[3]
46,XY,t(9;22)(q34;q 11,2)[3]/47,idem,+8[ 10]/48,idem,+8,+der(22)t(9;22)[4]/47,idem,+ 19 [ 3]
The clone with the t(9;22) as the sole abnormality is the stemline. Three additional abnormal subclones are
identified, one with a trisomy 8 from the stemline (si) (now termed sdl), one that has an additional derivative
chromosome 22 in the previous clone or sideline (sdl), and one with trisomy 19 of the stemline.

XY,-7[5]/46,sl,+8[6]/46,XY,t(9;22)(q34;ql
45, 1.2)[3]/92,sl2x2[5]/93,sl2x2,+8[2]
45,XY,-7[5]/46,idem,+8[6]/46,XY,t(9;22)(q34;ql 1.2)[3]/92,XXYY,t(9;22)x2[5]/93,XXYY,
t(9;22)x2,+8[2]
In tumors with unrelated clones, there may be clonal evolution arising from each unrelated clone. In this in­
stance, the first stemline shows monosomy 7 and is designated si in the subclone showing trisomy 8. The sec­
ond stemline shows t(9;22) and is designated sl2 in the subclone showing tetraploidy. Further clonal evolution
is found in a sideline showing gain of chromosome 8, but to avoid confusion between sidelines of sll and sl2,
the use of the term sdl is avoided when referring to a second stemline. The alternative use of idem is listed
below for comparison.

48,XX,t(12;16)(ql3;pl l.l),...[31]/96,slx2[6]
48,XX,t(12;16)(ql3;pl l.l),...[31]/96,idemx2[6]
The subclone with 96 chromosomes represents a doubling product of the stemline with 48 chromosomes.

48,XX,t(12;16)(ql3;pll.l),...[27]/97,slx2,+8[3]
48,XY,t(12;16)(ql3;pll.l),...[27]/97,idemx2,+8[3]
The subclone with 97 chromosomes represents a doubling product of the hyperdiploid stemline and also has
an extra chromosome 8, i.e., there are five chromosomes 8 in this near tetrapioid subclone.

48,XX,t(12;16)(ql3;pll.l),...[7]/96,slx2,inv(3)(q21q27),t(3;6)(p25;q21)[19]
48,XX,t(12;16)(ql3;pl I.l),...[7]/96,idemx2,inv(3)(q21q27),t(3;6)(p25;q21)[19]
The mainline with 96 chromosomes is a doubling product of the hyperdiploid stemline and has in addition
an inv(3) and a balanced t(3;6), i.e., there are two normal chromosomes 3 and three normal chromosomes 6
in this near tetrapioid subclone.

48,XX,t(12;16)(ql3;pll.l),t(14;19)(q23;pll),+17,-19,+20,+21[32]/49,sl,+6[17]
48, XX,t(12;16)(ql3;pl l.l),t(14;19)(q23;pl l),+17,-19,+20,+21[32]/49,idem,+6[17]
The subclone with 49 chromosomes has all the abnormalities seen in the stemline plus an extra chromosome 6.

5 3,XY,t( 14; 18)(q32;q21),... [21 ]/5 3,sl,del(7)(q21 )[9]

53,XY,t(14;18)(q32;q21),...[21]/53,idem,del(7)(q21)[9]
The sideline has a deletion of the long arm of chromosome 7 in addition to the abnormalities seen in the
stemline.

53,XY,t(l;6)(p34;q22),-3,...[13]/57,sl,+3,+del(7)(ql 1.2),+8,+9[22]
53,XY,t(l;6)(p34;q22),-3,...[13]/57,idem,+3,+del(7)(qll.2),+8,+9[22]
There are four additional changes in the subclone with 57 chromosomes in relation to the stemline. Note,
however, that the stemline has monosomy 3 whereas the sideline has two normal chromosomes 3, i.e., +3 in
this situation does not denote that the clone has trisomy 3.

49, XX,inv(6)(p21 q25),... [ 17]/52,sl,-inv(6),+7,+8,+9,+mar[ 11 ]

XX,inv(6)(p2 1 q25),... [ 17]/52,idem,-inv(6),+7?+8,+9,+mar[ 11 ]
49,
The inv(6) present in the stemline has not been found in the sideline with 52 chromosomes. The breakpoints
in the inv(6) need not be repeated.

Neoplasia Cytogenet Genome Res 2016;149:1-140 87

DOI: 10.1159/000445813
11.1.5 Composite Karyotype

In many instances, especially in solid tumors, there is great karyotypic heterogeneity within
the tumor, but different cells nevertheless share some cytogenetic characteristics. Every effort
should be made to describe the subclones so that clonal evolution is made evident. However, in
some instances, a composite karyotype (cp) will have to be created. The composite karyotype
contains all clonally occurring abnormalities and should also give the range of chromosome
numbers in the metaphase cells containing the clonal abnormalities. The total number of cells
in which the clonal changes were observed is given in square brackets after the karyotype,
preceded by the symbol cp. The term cp should not be used to describe random loss.

47~55,XX,del(3)(pl2),+i(6)(pl0),del(7)(qll.2),+8,dup(ll)(ql3q25),+ 16,+ 17,der(18)t(18;20)

(q23;q 11.1 ),+21 ,+21 ,+22[cp24]
Each of the abnormalities in this example has been seen in at least two cells, but there may be no cell with all
abnormalities. The fact that it is a composite karyotype is obvious from the symbol cp and also because the
chromosome number is given as a range.

It is not apparent from a composite karyotype how many cells have each abnormality. This
information may be expressed by providing the number of cells in square brackets after each
abnormality.

45-48, XX, del(3)(pl2)[2],-5[4],+8[2],+l l[3][cp7]

In this composite karyotype, constructed on the basis of a total of seven cells, each with at least one of the
abnormalities listed, two cells had a terminal deletion of the short arm of chromosome 3 with a breakpoint in
3pl2, four cells had monosomy 5, two cells had trisomy 8, and three cells had trisomy 11. Some cells had more
than one of these abnormalities.

It should be noted that in a composite karyotype the sum of the aberrations listed may indi­
cate a higher or lower chromosome number than that actually seen. For example, if the fol­
lowing five cells are karyotyped

48,XX,+7,+9
48,XX,+7,+ ll
48,XX,+9,+ ll
48,XX,+9,+13
48,XX,+ 13,+21

then the composite karyotype will be

48,XX,+7,+9,+l 1,+ I3[cp5]

The chromosome number in each of the five cells containing a clonal abnormality is 48, which is given as the
chromosome number of the composite karyotype, although the sum total of all clonal changes indicates a
chromosome number of 50. No cell with 50 chromosomes was observed.

Note also that a composite karyotype may contain such seemingly paradoxical abnormalities
as loss and gain of the same chromosome. For example, if the following six cells are karyo­
typed

45, XX,-15,del(17)(ql 1.1)

46, XX,+7,-15,del(17)(ql 1.1)
46, XX,+ 12,-15
47, XX,+7
47, XX,+ 15,del(17)(qll.l)
48, XX,+ 12,+ 15

88 Cytogenet Genome Res 2016;149:1-140 ISCN 2016

DOI: 10.1159/000445813
 then the composite karyotype will be

45~48,XX,+7,+12,+15 -15,del( 17)(q 11.1 )[cp6]

Trisomy 15 and monosomy 15 are both clonal changes, present in two and three cells, respectively.

42, XX,-2,-16,-21,-22
44,XX,-1,-7,+8,-11
44,XX,-7,+8,-12,-13
43, XX,-7,-18,-20
46,XX,-7,+8

Composite karyotype:

43~46,XX,-7,+8[cp4]
Note that the cell with 42 chromosomes is not included because the abnormalities seen are due to random
loss and are not part of the clone.

51 ,XY,+1 ,-7,+8,t(9;22)(q34;ql 1.2),+11,+13,+19,+der(22)t(9;22)

51 ,XY,+1,+5 ,-7,+8 ,t(9; 22)(q3 4;q 11.2),+11,+19,+der(22)t(9;22)
51 ,XY,+1 ,+5,-7,+8,t(9;22)(q34;q 11.2),+13,+19,+der(22)t(9;22)
52,XY,+1 ,+5,-7,+8,t(9;22)(q34;q 11.2),+11,+13,+19,+der(22)t(9;22)
46,XY,t(9;22)(q34;qll.2)[5]

Composite karyotype:

46,XY,t(9;22)(q34;qll.2)[5]/51~52,sl,+ l,+5,-7,+8,+ ll,+13,+ 19,+der(22)t(9;22)[cp4]

46,XY,t(9;22)(q34;q 11.2)[ 5 ]/51 -52,idem,+1 ,+5,-7,+8,+11,+13,+19,+der(22)t(9;22)[cp4]
This is an example of a stemline with a 9;22 translocation. Multiple cells were found with gain and loss of
chromosomes, likely due to clonal evolution. But because not all aberrations are present in all cells, these cells
have been combined into a composite karyotype.

11.1.6 Unrelated Clones

Clones with completely unrelated karyotypic anomalies are presented according to their size; the
largest first, then the second largest, etc. If there are two equal sized clones, they are listed as fol­
lows: clones with abnormalities of the sex chromosomes first and then those with the smallest to
largest numbered autosomes. A normal diploid clone, when present, is always listed last.

46,XX,t(3;9)(pl3;pl3)[14]/48,XX,+3,+9[ll]/46,XX,t(l;6)(pll;pl2)[9]/47,XX,t(6;10)
(ql2;pl5),+7[6]/46,XX,inv(6)(p22q23)[3]/46,XX[7]
Five different clones in the same tumor presented in order of decreasing frequency, irrespective of chromo­
some number or type of aberration.

If a tumor contains both related and unrelated clones, the former are presented first in order
of increasing complexity (see Section 11.1.4), followed by the unrelated clones in order of de­
creasing frequency.

XX,t(2;6)(p22;ql6),...[19]/51,sl,+8[7]/52,sdll,+9[12]/46,XX,del(3)(ql3)[ll]/47,XX,+7[6]/
50,
46, XX,t(l;3)(p22;pl4)[4]
XX,t(2;6)(p22;ql6),...[19]/51,idem,+8[7]/52,idem,+8,+9[12]/46,XX,del(3)(ql3)[ll]/
50,
47, XX,+7[6]/46,XX,t( 1; 3)(p22;p 14) [4]
The three related clones take precedence over the unrelated clones and are presented first. The three unre­
lated clones are presented in order of decreasing frequency.

Neoplasia Cytogenet Genome Res 2016;149:1-140 89

DOI: 10.1159/000445813
 Near-haploidy (23 ± ) <34 Near-pentaploidy (115 ±) 104-126
Hypohaploidy <23 Hypopentaploidy 104-114
Hyperhaploidy 24-34 Hyperpentaploidy 116-126
Near-diploidy (46 ±) 35-57 Near-hexaploidy (138 ±) 127-149
Hypodiploidy 35-45 Hypohexaploidy 127-137
Hyperdiploidy 47-57 Hyperhexaploidy 139-149
Near-triploidy (69 ±) 58-80 Near-heptaploidy (161 ± ) 150-172
Hypotriploidy 58-68 Hypoheptaploidy 150-160
Hypertriploidy 70-80 Hyperheptaploidy 162-172
Near-tetraploidy (92 ±) 81-103 Near-octaploidy (184 ±) 173-195
Hypotetraploidy 81-91 Hypooctaploidy 173-183
Hypertetraploidy 93-103 Hyperoctaploidy 185-195

However, if a previously identified abnormality is found among other unrelated clones, it

should be listed first, regardless of the number of cells it is identified in.

46,XY,t(9;22)(q34;ql 1.2)[6]/46,XY,t(l;3)(p22;pl4)[14]

11.2 Modal Number

The modal number is the most common chromosome number in a tumor cell population. The
modal number may be expressed as a range between two chromosome numbers.
Modal numbers in the haploid (n), diploid (2n), triploid (3n) or tetrapioid (4n) range, or near
but not equal to any multiple of the haploid number, and which cannot be given as a precise
number, may be expressed as near-haploid (n ±), hypohaploid (n-), hyperhaploid (n+), near­
diploid (2n±), hypodiploid (2n-), hyperdiploid (2n+), near-triploid (3n±), hypotriploid (3n-),
hypertriploid (3n+), near-tetraploid (4n ±), hypotetraploid (4n-), hypertetraploid (4n+), and so
on. Each range is determined as n±n/2, with n/2 defined operationally as 11 chromosomes.
Suggested examples of ploidy levels, including ranges of chromosome numbers constituting
each level, are given above.
Pseudodiploid, pseudotriploid, etc., are used to describe a karyotype, which has the number
of chromosomes equal to a multiple of the haploid number (euploid) but is abnormal because
of the presence of acquired numerical and/or structural aberrations. All chromosome numbers
deviating from euploidy are aneuploid.
The description of sex chromosome abnormalities poses a special problem in male tumors
with uneven ploidy levels (haploid, triploid, pentapioid, etc.) because the expected sex chro­
mosome constitution cannot be deduced. For example, the sex chromosome constitution of
a triploid tumor might theoretically be XXY or XYY. By convention, in males all sex chro­
mosome deviations should be expressed in relation to X in haploid tumors, to XXY in trip­
loid tumors, to XXXYY in pentapioid tumors, and so on:

68<3n>,XY,-X[10]
A tumor in a male shows triploidy with loss of a sex chromosome.

11.3 Constitutional Karyotype

The same clonality criteria (see Section 11.1.1) apply to cells containing the constitutional
karyotype as to cells containing acquired chromosome abnormalities. A normal diploid clone,
when present, is always listed last.

90 Cytogenet Genome Res 2016;149:1-140 ISCN 2016

DOI: 10.1159/000445813
 A constitutional anomaly is indicated by the letter c after the abnormality designation. In
the description of the karyotype, the constitutional anomaly is listed in chromosome number
order (see Chapter 6). A clone with only a constitutional anomaly is, as the normal diploid
clone, always listed last.

XX,+8,+21c[20]
48,
Tumor cells with a constitutional trisomy 21 and an acquired trisomy 8.

47,
X,t(X; 18 )(p 11.1 ;q 11.1 ),+21 c[20]
Tumor cells with a constitutional trisomy 21 and an acquired t(X;18).

47, XXYc,t(9;22)(q34;ql 1.2)[20]

Tumor cells with a constitutional XXY and an acquired t(9;22).

48, XY,+8,inv( 10)(p 12q22)mat,+21 [20]

Tumor cells with a constitutional inv(10) and acquired trisomies 8 and 21. Note that when the inheritance is
known, the mat or pat takes the place of the c.

47, XX,del(5)(ql5),+mar c[20]

Tumor cells with a constitutional marker chromosome of unknown origin and an acquired deletion of the long
arm of one chromosome 5. For constitutional markers, there is a space between mar and c.

48, XY,+8,+21c[3]/49,idem,+9[5]/47,XY,+21c[12]
Tumor cells with a constitutional trisomy 21 and acquired trisomies 8 and 9. The clone with only the consti­
tutional trisomy 21 is listed last irrespective of the size of this clone.

49, XX,t(2; 13)(q37;q 14),+18c,+18,+mar[3]/47,XX,+18c[ 17]

Tumor cells with a constitutional trisomy 18 as the sole anomaly in one clone and with acquired abnormali­
ties, including an additional chromosome 18, in another clone. The clone with 49 chromosomes thus has four
chromosomes 18. The clone with only the constitutional trisomy 18 is listed last.

To appropriately express acquired abnormalities affecting one of the chromosomes of a pair

that is involved in a constitutional anomaly, the constitutional aberration must always be
given, even if none of the tumor cells have this particular aberration. Thus, an acquired ab­
normality is always presented in relation to the constitutional karyotype.

46,XX,+21c,-21[20]
The patient has a constitutional trisomy 21 and the acquired abnormality in the tumor cells is a loss of one
chromosome 21.

45, Xc,t(X;18)(pll.l;qll.l)[20]
Tumor cells in a patient with Turner syndrome (45,X) have an acquired t(X;18), i.e., the only X chromosome
is involved in the translocation and consequently there is no normal X chromosome in the tumor cells.

46, XX,der(9)t(9;ll)(p22;q23)t(ll;12)(pl3;q22)c,der(ll)t(9;ll)t(ll;12)c,der(12)t(ll;12)c[20]
Female patient with a known constitutional t( 11; 12)(p 13;q22) presents with t(9;l 1) positive AML. The de­
rivative chromosome 11 involved in the t(l l;12)c is also involved in the t(9;l 1) aberration. The resulting
karyotype, with both constitutional and acquired aberrations, should list each aberrant chromosome as a de­
rivative chromosome.

Neoplasia Cytogenet Genome Res 2016;149:1-140 91

DOI: 10.1159/000445813
12 Meiotic Chromosomes

During late prophase-first metaphase, the bivalents may be grouped by size, and bivalent 9
can sometimes be distinguished by its secondary constriction. At these stages, the Q- and C-
staining methods are particularly informative. The autosomal bivalents generally show the
same Q-band patterns as somatic chromosomes. The C-staining method reveals the centro­
mere position, thus allowing identification of the bivalents in accordance with the convention­
ally stained somatic chromosomes. There are, however, minor differences in the C-band pat­
terns between the bivalents and mitotic chromosomes.
When the Q- and C-staining methods are used consecutively, further distinction of the bi­
valents is possible. Measurements of the relative length of orcein-stained bivalents, previ­
ously identified by these special techniques, are in good agreement with corresponding mi­
totic measurements. Chiasma frequencies have been determined for individual bivalents.
The Y chromosome can be identified at all meiotic stages by the intense fluorescence of its
long arm. Both the Q- and C-staining methods have revealed that the short arm of the Y is
associated with the short arm of the X in the first meiotic metaphase.

12.1 Terminology

The symbols PI, MI, Al, Mil, and All are used to indicate the stage of meiosis, namely, pro-
phase of the first division, first metaphase (including diakinesis), first anaphase, second meta­
phase. and second anaphase. This is followed by the total count of separate chromosomal ele­
ments. The sex chromosomes are then indicated by XY or XX when associated and as X,Y
when separate. Any additional, missing, or abnormal element follows, with that element spec­
ified within parentheses and preceded by the Roman numeral I, II, III, or IV to indicate if it
is a univalent, bivalent, trivalent. or quadrivalent, respectively. The absence of a particular
element is indicated by a minus (-) sign. The plus (+) sign is used in first metaphase only when
the additional chromosome is not included in a multivalent. The chromosomes involved in a
rearrangement are listed numerically within parentheses and separated by a semicolon (;).
A more detailed description, for instance, of the chromosomal segments involved in a re­
arrangement may be included within parentheses using the standard nomenclature, with
which this meiotic notation has been designed to conform. When necessary, use of the sym­
bols fem and mal is recommended for female and male, respectively, and when a more de­
tailed description of different premeiotic and meiotic stages is required, the following sym­
bols may be used:

92 Cytogenet Genome Res 2016;149:1-140 ISCN 2016

DOI: 10.1159/000445813
 spm Spermatogonial metaphase
oom Oogonial metaphase
lep Leptotene
zyg Zygotene
pac Pachytene
dip Diplotene
dit Dictyotene
dia Diakinesis

The symbol xma is suggested for chiasma(td). The total number of chiasmata in a cell can be
designated by placing this symbol, followed by an equal sign (=) and a two-digit number, in
parentheses, e.g., (xma=52). In the case of a meiotic cell with a low number of chiasmata, a
single digit should be preceded by a zero, e.g., (xma=09).
The number of chiasmata in a bivalent or multivalent or their arms may be indicated by
a single digit, e.g., (xma=4).
Location of chiasmata can be indicated by the standard arm symbols p and q, supplement­
ed by prx for proximal, med for medial, dis for distal, and ter for terminal. The band or region
number can be used when such precise information is available.
Chromosomes participating in a bivalent or multivalent are specified within parentheses
after the Roman numeral that describes the bivalent (II) or the type of multivalent (III, IV,
etc.). If the number of chiasmata within the multivalent is known, this is indicated within
parentheses in consecutive order, i.e., the number of chiasmata between the first and second
chromosome is given first, between the second and the third next, etc. The last figure then
indicates the number of chiasmata between the last and first chromosome. If the number of
chiasmata in non-interstitial and interstitial segments can be specified separately, these should
be represented by a plus (+) sign. The number of chiasmata in the non-interstitial segment is
written first, e.g., (xma=2+l), indicating two chiasmata in the non-interstitial and one in the
interstitial segment. It is assumed that a careful description of the mitotic karyotype of the
subject will be given separately.

12.1.1 Examples of Meiotic Nomenclature

MI,23,XY
A primary spermatocyte at diakinesis or metaphase I with 23 elements, including an XY bivalent.

MI,24,X,Y
A primary spermatocyte at diakinesis or metaphase I with 24 elements, including X and Y univalents.

MI,23,XY,111(21)
A primary spermatocyte with 23 elements from a male with trisomy 21. The three chromosomes 21 are rep­
resented by a trivalent.

MI,24,XY,+1(21)
A primary spermatocyte with 24 elements from a male with trisomy 21. The extra chromosome 21 is repre­
sented by a univalent.

MI,22,XY,III(13ql4q)
A primary spermatocyte with 22 elements from a der(13;14)(ql0;ql0) heterozygote. The translocation chro­
mosome is represented by a trivalent.

Meiotic Chromosomes Cytogenet Genome Res 2016;149:1-140 93

DOI: 10.1159/000445813
 MI,23,XY,(xma=52)
Spermatocyte in first metaphase with 23 elements, including an XY bivalent. The total number of chiasmata
in the cell is 52, the association between the X and Y chromosomes being counted as one chiasma.

fem dia,II(2,2)(xma=4)
Oocyte in diakinesis in which bivalent 2 has four chiasmata.

fem dia,II(2,2)(xma=4)(p=2,q=2)
Female diakinesis in which bivalent 2 has four chiasmata. The positions of the chiasmata are known. Thus
(xma=4)(p=2,q=2) indicates that there are two chiasmata on the short arm and two on the long arm. More
precise location of the chiasmata could then be indicated, e.g., by (xma=4) (pter,pprx,qmed,qdis). Alterna­
tively, if the chiasmata have been localized to specific regions, these could be indicated, e.g., by (xma=4)
(pter,pl,q2,qter).

mal MI,111(14,14q21q,21)(xma=3)
Male first metaphase with a trivalent composed of one chromosome 14, one 14q21q Robertsonian transloca­
tion chromosome, and one chromosome 21. There are three chiasmata, the positions of which have not been
specified.

MI,23,X,Y,111(13,13ql4q,14)(xma=2,l),(xma=51)
Spermatocyte in first metaphase with 23 elements, univalent X and Y chromosomes, and one trivalent com­
posed of one chromosome 13, one 13ql4q Robertsonian translocation chromosome, and one chromosome
14. There are two chiasmata between the normal chromosome 13 and the 13ql4q translocation chromosome
and one chiasma between the translocation chromosome and the normal chromosome 14. Altogether, there
are 51 chiasmata in the cell.

fem dia,IV(2,der(2),5,der(5))(xma=2+ 1,1,1 +0,1)

Oocyte in diakinesis with a quadrivalent composed of two normal chromosomes and two derivative chromo­
somes of chromosomes 2 and 5, respectively. There are three chiasmata between chromosomes 2 and der(2),
of which two are in the non-interstitial segment and one is in the interstitial segment. In addition, there is one
chiasma between der(2) and chromosome 5, one in the non-interstitial and none in the interstitial segment
between chromosome 5 and der(5), and finally one between der(5) and chromosome 2. The last chiasma in­
dicates that the quadrivalent has a ring shape.

MI,24,X,Y,III(2,der(2),5)(xma=4),I(der(5)),(xma=51)
Spermatocyte in first metaphase with 24 elements, including univalent X and Y chromosomes, one trivalent,
and one additional univalent. The trivalent is composed of one normal and one derivative chromosome 2, as
well as one normal chromosome 5. This trivalent has a total of four chiasmata, the positions of which are not
known. One univalent is composed of one derivative chromosome 5. The total number of chiasmata in the
cell is 51.

Mil,22,X -16,+16cht,+16cht
Oocyte at second meiotic metaphase in which chromosome 16 is absent, but is represented by its two single
chromatids.

12.1.2 Correlation between Meiotic Chromosomes and Mitotic Banding Patterns

Meiotic chromosomes from pachytene spermatocytes have been shown to exhibit chromo-
mere patterns without any pretreatment, which correspond well with Giemsa-dark bands of so­
matic chromosomes, suggesting that both represent a basic structural feature of the mamma­
lian chromosome. Just as in the case of somatic chromosome bands, the number of chromo-
meres that can be recognized is a function of the stage of contraction. The chromomere
patterns of human oocyte pachytene chromosomes are apparently similar to those of sper­
matocyte chromosomes, although the former exhibit less contraction and hence more chro-
momeres.

94 Cytogenet Genome Res 2016;149:1-140 ISCN 2016

DOI: 10.1159/000445813
 Figure 10 is an idiogram of the 22 autosomal bivalents from pachytene spermatocytes em­
ploying the nomenclature of the somatic chromosome banding patterns using the 850-band
stage nomenclature because this stage of contraction corresponds approximately to mid­
pachytene of spermatocyte meiosis. The chromomeres are given the numbers of Giemsa-pos­
itive bands and inter-chromomere regions are given the numbers of Giemsa-negative bands.
A special feature of human pachytene chromosomes is the presence of a particulate or puff­
like structure located at the heterochromatic region (9ql2). The structure is transient and is
limited to the pachytene stage.

Meiotic Chromosomes Cytogenet Genome Res 2016;149:1-140 95

DOI: 10.1159/000445813
Fig. 10. Chromomere idiogram of the 22 autosomal bivalents at pachytene. The nomenclature used is that of the
850-band stage of somatic chromosomes (ISCN 1981). Chromomere numbers are equivalent to those of Giemsa­
positive bands of somatic chromosomes and inter-chromomere region numbers are equivalent to those of Giem­
sa-negative bands of somatic chromosomes. Individual bivalent idiograms compared with photomicrographs of
bivalents (two Giemsa-stained and one quinacrine-stained). Lines between idiograms and photomicrographs
connect centromeres and chromomeres that correspond to landmark bands of somatic chromosomes. (Method
of Jhanwar et al., 1982; courtesy of Drs. R.S.K. Chaganti and S.C. Jhanwar).

96 Cytogenet Genome Res 2016;149:1-140 ISCN 2016

DOI: 10.1159/000445813
Meiotic Chromosomes Cytogenet Genome Res 2016;149:1-140 91
DOI: 10.1159/000445813
Fig. 10 continued (see legend on p 96)

98 Cytogenet Genome Res 2016;149:1-140 ISCN 2016

DOI: 10.1159/000445813
Meiotic Chromosomes Cytogenet Genome Res 2016;149:1-140 99
DOI: 10.1159/000445813
13 In situ Hybridization

13.1 Introduction

Major advances in human cytogenetics since the publication of ISCN (1985) have been the
development and implementation of a variety of non-isotopic in situ hybridization techniques
to detect (Lichter et al., 1990; Trask, 1991), and in some instances quantify (Kallioniemi et
al., 1992), specific DNA sequences, and to locate them to specific chromosomal sites. The
ever-increasing availability of a number of sequence-specific DNA probes, their amplification
by the polymerase chain reaction, and the availability of fluorochrome-tagged reporter mol­
ecules that are bound to DNA probes, have all contributed to bridging the gap between the
microscope and the molecule.
Techniques utilizing fluorescence in situ hybridization (FISH) allow the use of a number
of fluorochromes so that the locations of different and differently tagged probes, and the rela­
tive positions of their binding sites, may be visualized microscopically on a single chromosome
segment or DNA/chromatin fiber (Wiegant et al., 1993). In addition, the use of composite
probes, coupled with suppressive hybridization (Landegent et al., 1987), enables whole chro­
mosomes, or chromosome segments, to be specifically ‘painted’ and uniquely visualized
(Lichter et al., 1988; Pinkel et al., 1988; Guan et al., 1994). FISH banding methods are avail­
able and reviewed in Liehr et al. (2006). These developments have also enabled the cytoge­
neticist to detect the presence of specific DNA sequences in interphase nuclei and to visualize
their distribution (Cremer et al., 1986). FISH applied to free, linearly extended chromatin
fibers or naked DNA strands has increased the resolution of FISH interphase mapping to < 1
kb (Wiegant et al., 1992; Parra and Windle, 1993).
FISH techniques have provided the cytogeneticist with an increased ability to identify
chromosome segments, to correlate chromosome structures with gene locations, to reveal cryp­
tic abnormalities that are undetectable using standard banding techniques, and to analyze and
describe complex rearrangements. If FISH further clarifies the karyotype and, in retrospect,
the abnormality can be visualized with banding, the karyotype may be re-written to reflect
this new FISH information. If the abnormality is cryptic and cannot be visualized by band­
ing, the abnormality should not be listed in the banded karyotype.

100 Cytogenet Genome Res 2016;149:1-140 ISCN 2016

DOI: 10.1159/000445813
13.2 Prophase/Metaphase in situ Hybridization (ish)

If a standard cytogenetic observation has been made, it may be given followed by a period (.),
the symbol ish, a space, and the ish results. If a standard cytogenetic observation has not been
made, the ish observations only are given. The locus designations (in capital letters but not
in italics) are separated by commas and the status of each locus is given immediately after the
locus designation. When available, the clone name is preferred. If the clone name is not avail­
able, the locus designated according to either the UCSC or Ensembl Genome Browsers (www.
genome.ucsc.edu/ and www.ensembl.org/) should be used in order as they would appear on
the chromosome being described from pter to qter. If no locus is available, the gene name can
be used, according to HUGO-approved nomenclature (www.hugo-international.org/). Al­
though gene acronyms are usually italicized, they should not be italicized in the nomenclature.
Thus, at the discretion of the investigator or laboratory director the probe name, clone name,
accession number, gene name, or D-number can be used. When contig probes are used each
locus may be listed, separated by single slant lines (/). The band designation for the locus
should be based on the current UCSC Genome Browser.
Observations on structurally abnormal chromosomes are expressed by the symbol ish, fol­
lowed by a space and then the symbol for the structural abnormality (whether seen by standard
techniques and ish or only by ish), followed in separate parentheses by the chromosome(s), the
breakpoint(s), and the locus or loci for which probes were used. Presence (+) or absence (-) is
indicated within the same parentheses as the locus designation. When the number of signals
on an abnormal chromosome can be counted, this may be indicated by multiple “+” symbols.
Observations on normal chromosomes are expressed by the symbol ish followed by a space
and the chromosome, region, band, or sub-band designation of the locus or loci tested (not in
parentheses), followed in parentheses by the locus (loci) tested, a multiplication sign (x) and
the number of signals seen.

46,XY.ish 22ql 1.2(D22S75x2)

Conventional cytogenetic analysis showed a normal male karyotype and FISH using a probe in the DiGeorge
syndrome region (D22S75) showed a normal hybridization pattern on metaphase chromosomes.

46,XX.ish del(22)(qll.2qll.2)(D22S75-)
A female with a normal karyotype by cytogenetic analysis has a deletion in the DiGeorge syndrome critical
region (DGCR) on chromosome 22 identified by ish using a probe for locus D22S75.

ish del(22)(qll.2qll.2)(D22S75-)
Conventional cytogenetic analysis was not performed but a deletion in the DGCR on chromosome 22 was
identified by ish using a probe for locus D22S75.

ish del(22)(ql 1.2ql 1.2)(D22S75-),del(22)(ql 1.2ql 1.2)(D22S75-)

Conventional cytogenetic analysis was not performed but a deletion in the DGCR in both chromosomes 22
was identified by ish using a probe for locus D22S75.

ish del(22)(ql3.3ql3.3)(ARSA-)
Conventional cytogenetic analysis was not performed but an interstitial deletion of distal 22q was identified
by ish using a probe to the ARSA locus.

ish 22ql 1.2(HIRAx2),del(22)(ql3.3)(ARSA-)

Only the clinically relevant or informative results need to be in the karyotype. Both examples describe a dele­
tion of the ARSA locus after using a cocktail containing the ARSA and HIRA loci. Either example is correct.

In situ Hybridization Cytogenet Genome Res 2016;149:1-140 101

DOI: 10.1159/000445813
46,XX.ish del(7)(ql 1.23ql 1.23)(ELN-)
A microdeletion in the Williams syndrome region of chromosome 7 identified by ish with an elastin gene
(ELN) probe.

46,XX,del(15)(qll.2ql3).ish del(15)(ql 1.2ql 1.2)(SNRPN- D15S10-)

A cytogenetically detected deletion of bands 15ql 1.2ql 3 characterized by ish. Two loci (SNRPN and DI 5S10)
from the Prader-Willi/Angelman region are deleted.

46,XY.ish del( 15)(q 11,2q 11.2)(SNRPN-,D15S10-)

A microdeletion of the Prader-Willi/Angelman region of chromosome 15 identified by ish. The deletion in­
cludes the region defined by probes for the SNRPN and D15S10 loci.

46,XY.ish del(15)(qll.2ql2)(D15Sll+,SNRPN-,D15S1O-GABRB3+)
A microdeletion of chromosome 15 defined by ish using probes for loci D15S11, SNRPN, D15S10 and
GABRB3. SNRPNand DI5S10 are deleted while D15S11 and GABRB3 are retained.

46,XY.ish dup( 17)(p 11,2p 11,2)(RAI 1 ++)

The region containing the RAI1 locus on chromosome 17 is duplicated as detected by ish on metaphase chro­
mosomes. There is one signal in the homologous chromosome 17, not indicated in the karyotype.

46,XY.ish 17pl 1.2(RAIlx2)

The RAI1 locus on chromosome 17 is present in the normal copy number (two copies) as determined by ish
with a locus-specific probe.

46,XX,add(4)(pl6.3).ish dup(4)(pl5.2pl6.3)(RPl l-1076P8+,WHS+,wcp4+)

A chromosome 4 has extra material attached at band 4pl6.3. Utilizing a whole chromosome paint 4, the ex­
tra chromatin was identified as a duplicated region of chromosome 4, determined by G-banding to be 4pl5.2
to 4p 16.3. It contains one copy of the region covered by the RP11-1076P8 BAC probe and a probe for Wolf-
Hirschhorn syndrome.

46,XX,add(4)(q31).ish der(4)dup(4)(q31q34)(wcp4+)add(4)(q34)(wcp4-)
A chromosome 4 has extra chromatin attached at band 4q31. Using whole chromosome paint 4 the proximal
part of the additional material was shown to be derived from chromosome 4. G-banding suggested a duplica­
tion of bands 4q31 to 4q34. However, there was additional material distal to the duplication which did not
hybridize with whole chromosome 4 paint, and is therefore of unknown origin.

46,X,r(X).ish r(X)(p22.3q21)(KAL+,DXZl+,XIST+,DXZ4-)
A ring X was further defined by ish as containing the short arm marker KALI, the X alpha-satellite DXZ1
and the XIST gene on the long arm. It does not include DXZ4 at Xq24.

46,X,+r.ish r(X)(wcpX+,DXZl+)
A ring chromosome was identified by ish as a derivative X chromosome using whole chromosome paint X
and X alpha-satellite probe DXZ1.

46,X,?i(Y)(pl0).ish idic(Y)(ql 1)(DYZ3++,DYZ1-)

A presumed isochromosome for the short arm of Y was shown by ish to have two centromeres and no hetero­
chromatin.

46,XX.ish der(X)t(X;Y)(p22.3;pl 1.3)(SRY+)

A presumed unbalanced translocation between the X and Y short arms resulting in a derivative X containing
AR Fat Xp22.3.

46,XX.ish X(DXZlx2,SRYxO)
FISH with probes for the X centromere and the SRYgene was performed and no evidence of SRYwas found.

102 Cytogenet Genome Res 2016;149:1-140 ISCN 2016

DOI: 10.1159/000445813
46,XX.ish X(DXZlx2),der(7)(q3?)(SRY+)
FISH with probes for the X centromere and the SRYgene was performed, and the SRYgene was found to be
located in one of the chromosomes 7, in band q3, sub-band not known.

45,XY,der(14;21)(qlO;qlO).ish dic(14;21)(pl 1.2;pl 1.2)(D14Z1/D22Z1+;D13Z1/D21Z1+)

A Robertsonian translocation, rob(14;21) or der(14;21), shown to be dicentric using ish.

45, XY,der(14;21)(pll.2;pll.2).ish dic(14;21)(pl 1.2pl 1.2)(D14Z1/D22Z1+;

D13Z1/D21Z1+)
A Robertsonian translocation shown to be dicentric using ish. Therefore, the G-banded interpretation has
been re-written, as compared to the previous example, to reflect the FISH results and the reinterpretation of
the breakpoints.

46, XX.ish t(4;l I)(pl6.3;pl5)(wcpl l+,D4F26-,D4S96+,D4Zl+;D4F26+,wcpl 1+)

A cryptic reciprocal translocation between chromosomes 4 and 11 was identified by ish. The der(4) was pos­
itive with whole chromosome paint 11, a probe for D4S96 (Wolf-Hirschhorn region) and 4 alpha-satellite but
negative for D4F26 (4p telomere region). The der(l 1) was positive for D4F26 as well as whole chromosome
paint 11.

46,XX.ish der(4)t(4;l I)(pl6.3;pl5)mat(wcpl 1+,D4F26-,D4S96+,D4Z1+)

This child is an unbalanced offspring from the segregation of the cryptic translocation above. She has one
normal chromosome 4 and two normal chromosomes 11. The ish results of the der(4) are the same as der(4)
of the mother.

46,XY.ish 4pl6.3(D4F26,D4S96)x2
A normal male (father of the child in the previous example) was tested by ish using probes for loci D4F26 and
D4S96. There were two copies of both.

46,XX,ins(2)(p 13q21 q31 ).ish ins(2)(wcp2+)

A direct insertion of the long arm segment 2q2 lq31 into the short arm at band 2pl 3 was confirmed as derived
from chromosome 2 by ish using whole chromosome paint 2.

46,XY,ins(5;2)(pl4;q32q22).ish ins(5;2)(wcp2+)
An inverted insertion of a chromosome 2 segment into the short arm of chromosome 5 was confirmed as de­
rived from chromosome 2 using whole chromosome paint 2.

46,XX.ish ins(15;17)(q22;q21q21)(PML+,RARA+;RARA+)
A cryptic insertion of the segment 17q21 from the long arm of chromosome 17 into the 15q22 band of the
long arm of chromosome 15 identified using probes for PML and RARA.

46,XX.ish inv(21)(qll.2q22.1)(qll.2)(RUNXl+)(q22.1)(RUNXl-)
A cryptic inversion of the segment 21 q 11.2 to 21q22.1 was identified by ish using a probe for the RUNX1 lo­
cus. Note that the inversion breakpoints are in separate parentheses to make the FISH information apparent.

46, XY,t(9;22)(q34;qll.2)[20].ish t(9;22)(ABLl-;BCR+,ABLl+)[20]

A male karyotype with a t(9;22) that has been characterized by ish using a single-fusion probe. The probe se­
quence from the ABLI locus is missing from the derivative chromosome 9 and is present on the derivative
chromosome 22 distal to the BCR locus.

47, XY,t(9;22)(q34;qll.2),+der(22)t(9;22)[20].ish t(9;22)(ABLl-;BCR+,ABLl+),der(22)

(BCR+,ABL1+)[2O]
A male karyotype with a t(9;22) plus an extra copy of the der(22) that has been characterized by ish using a
single-fusion probe. The ABL1 locus is missing from the derivative chromosome 9 and is present on both de­
rivative chromosomes 22 distal to the BCR locus.

In situ Hybridization Cytogenet Genome Res 2016;149:1-140 103

DOI: 10.1159/000445813
46,XX,t(9;22)(q34;ql 1.2)[20].ish t(9;22)(ABLl+,BCR+;BCR+,ABLl+)[20]
A female karyotype with a t(9;22) detected using dual-fusion probes for BCR and ABL1. One copy of ABL1
and one copy of BCR are found on each derivative chromosome.

46,XX,t(9;22)(q34;qll.2)[20].ish der(9)t(9;22)del(9)(q34q34)(ABLl- BCR+),der(22)t(9;22)

(BCR+,ABL1+)[2O]
A female karyotype with a t(9;22) detected using dual-fusion probe for BCR and ABL1. There is a deletion
on the derivative 9, encompassing the ABL1 locus, not detected using conventional cytogenetic analysis.

46,XX,t(9;22)(q34;qll.2)[20].ish der(9)t(9;22)del(9)(q34q34)(ASSl- ABL1-,BCR+),

der(22)t(9;22)(BCR+,ABLl+)[20]
A female karyotype with a t(9;22) detected using a three-color dual-fusion probe for ASS 1, ABL1 and BCR.
There is a deletion on the derivative 9, encompassing the ASS1 and ABL1 loci, not detected using conven­
tional cytogenetic analysis.

46,XX,inv(16)(pl3.1q22)[20].ish inv(16)(pl3.1)(5'CBFB+)(q22)(3'CBFB+)[20]
Inversion of chromosome 16 separates the two probes for the CBFB locus into the 3' probe on the short arm
and the 5' on the long arm. Note in this and the following examples that the inversion breakpoints are in
separate parentheses to make the FISH information apparent.

46,XX,inv(16)(pl3.1q22)[20].ish inv(16)(pl3.1)(RPl 1-620P1 l+)(q22)(RPl 1-620P11+)[20]

Inversion of chromosome 16 separates the region corresponding to BAC probe RP11-620P11 giving a signal
on the short arm and on the long arm.

46,XX,inv(16)(pl3.1q22).ish inv(16)(pl3.1)(MYHl l+,CBFB+)(q22)(MYHl 1+,CBFB+)

Pericentric inversion in which breakage and reunion have occurred at bands 16p 13.1 and 16q22 is confirmed
by probes for MYH11 and CBFB.

46,XX,t(16;16)(pl3.1;q22)[20].ish t(16;16)(3'CBFB+;3'CBFB-)[20]
Translocation disrupts the CBFB locus resulting in translocation of the 3' probe from 16q22 to 16pl 3.1 on
the other homologue.

46,XX,t(2; 17)(q32;q24)[20].ish t(2; 17)(AC005181 +;AC005181 +)[20]

Translocation disrupts the region corresponding to BAC clone ACOO5181, at 17q24, resulting in a signal on
both derivative chromosomes.

46, XX,t(2;17)(q32;q24)[20].ish t(2;17)(CTD-3115L8+;RPll-959M22+)[20]

Same translocation as above. The breakpoint has been located between BAC clone RP11-959M22 and CTD-
3115L8 on chromosome 17, which results in CTD-3115L8 moving to chromosome 2 and RP11-959M22 be­
ing retained on chromosome 17.

47, XY,+mar.ish der(8)(D8Zl+)

An extra marker chromosome identified by ish to be derived from chromosome 8 using an 8-specific alpha­
satellite probe.

47,XY,+mar.ish der(17)(wcpl7+,D17Zl+)
An extra marker chromosome identified by ish as derived from chromosome 17 using whole chromosome
paint 17 and a 17-specific alpha-satellite probe.

47,XX,+mar.ish der( 18)t( 18; 19)(wcp 18+,D 18Z1+,wcp 19+)

An extra marker chromosome identified by ish to be derived in part from chromosome 18, using whole chro­
mosome paint 18 and an 18 alpha-satellite probe, and from chromosome 19 using whole chromosome paint
19.

104 Cytogenet Genome Res 2016;149:1-140 ISCN 2016

DOI: 10.1159/000445813
 47,XY,+mar.ish add(17)(pl2)(wcpl7+,CMTlA+,D17Zl+)
An extra marker chromosome identified by ish to be partially derived from chromosome 17 using whole chro­
mosome paint 17 and probes for CMT1A and D17Z1. Additional material of unknown origin has replaced
the segment distal to 17pl2.

47,XX,+mar.ish add(16)(p or q)(wcpl6+,D16Zl+)

An extra marker chromosome identified by ish to be partially derived from chromosome 16 (arm unknown)
using whole chromosome paint 16 and the 16 alpha-satellite probe. Additional material of unknown origin is
present in the marker.

mos 46,X,+r[15]/45,X[10].ish r(X)(wcpX+,DXZl+)

A female with two cell lines, one 45,X and another with 46 chromosomes including a ring. By ish, the ring
was identified as an X using the whole chromosome paint X and the X alpha-satellite probe. The number of
cells, not percentage, is given in square brackets.

46,X,+r.ish r(X)(wcpX+,DXZl+)[15]/r(X)(wcpX+,DXZl++)[10]
A ring chromosome replacing a sex chromosome was identified by ish as X using whole chromosome paint
X. Probe DXZ1, for the X alpha-satellite, showed the ring to be monocentric in some cells and dicentric in
other cells.

mos 45,X[3]/46,XY[12].ish X(DXZlxl,SRYxO)[32]/X(DXZlxl),Y(SRYxl)[68]

A male with two cell lines, one 45,X and the other with a normal male karyotype. Using ish, the cell line with
a single sex chromosome was confirmed to have one X chromosome but not to contain SRY. The 46,XY cell
line was confirmed to have a single X chromosome and one appropriately located SRYgene on the Y chro­
mosome.

ish del( 14)(q21.2q21,2)(RP 11 -45 3F20-)dn[6]/14q21,2(RP 11-453F20x2)[4]

A de novo cryptic deletion within band 14q21.2, originally identified by microarray, was present in 6 of 10
metaphases.

An exception to using the multiplication sign can occur in cancer, as shown in these examples
below. When the number of signals can be counted, the number of signals should be listed.

ish dmin(MYCNx20~50)[20]
Double minutes, identified to contain MYCN, are found in 20-50 copies per cell.

ish ider(21 )(q 10)dup(21 )(q22q22)(RUNX 1 x4)

An isoderivative chromosome 21 with a duplication of the band q22 is identified by two RUNX1 copies in
each arm of the isoderivative chromosome, for a total of four copies of RUNX1.

The abbreviation amp can be used if the number of signals cannot be enumerated.

ish der(21)(RUNXl amp)

A derivative chromosome 21 that has an increase in RUNX1 copies so numerous that they cannot be reliably
quantified.

13.2.1 Use of dim and enh

46,Y,del(X)(pll.2pll.4).ish del(X)(pl 1.2pl 1.4)(RP1-112K5 dim,RPll-265Pll dim)

Deletion of the short arm of chromosome X. On the deleted chromosome, the signals of clones RP1-112K5
(Xpl 1.2) and RP11-265P11 (Xpl 1.4) are consistently less intense than on the normal homologue, indicating
that they are partially deleted and recognize the proximal and distal breakpoints respectively.

46,XX.ish 17pll.2(RAIl enh)

Enhanced signal at 17p 11.2 using a probe to the RAI1 locus.

In situ Hybridization Cytogenet Genome Res 2016;149:1-140 105

DOI: 10.1159/000445813
13.2.2 Subtelomeric Metaphase in situ Hybridization

Subtelomeric FISH is usually performed in panels so that the 41 unique chromosome ends
are hybridized simultaneously. A short system is appropriate to describe a normal result after
using a subtelomeric FISH panel, for example:

ish subtel(41x2)
Normal result using 41 probes to the 41 subtelomeric regions.

ish t(13;20)(q34-,pl3+;pl3-,q34+)(RPl 1-63L17-,RP5-1103G7+;RP5-1103G7-,

RP11-63L17+)
A balanced translocation between the distal long arm of chromosome 13 and the distal short arm of chromo­
some 20.

ish der(13)t(13;20)(q34-,pl3+)(RPl I-63LI7-,RP5-1103G7+)

An unbalanced translocation between the distal long arm of chromosome 13 and the distal short arm of chro­
mosome 20. The subtelomeric region of 13q is deleted and replaced with the subtelomeric region of 20p. The
designation pter and qter may be used instead of the distal bands. Alternatively, clone names may be used.

13.3 Interphase/Nuclear in situ Hybridization (nuc ish)

Information of interest in interphase ish, signified by the symbols nuc ish, includes the num­
ber of signals and their positions relative to each other. ISCN (1995) provided for the use of
a band designation in interphase FISH. This is considered an optional detailed form to be
used at the discretion of the investigator or laboratory director. A short nomenclature descrip­
tion has now been provided that does not indicate chromosome band locations, providing for
the ambiguity of hybridization location in interphase nuclei in the absence of discernible
bands (chromosomes). Especially in the case of amplification, the short nomenclature descrip­
tion is recommended. If a collection of contiguous probes is used to designate a locus, a single
designation may be used in the nomenclature and the composition is described in the report
or all probes can be designated and separated by single slant lines.

13.3.1 Number of Signals

To indicate the number of signals, the symbols nuc ish are followed immediately in parenthe­
ses by the locus designation, a multiplication sign (x), and the number of signals seen. If the
detailed system is used, a space should follow ish, and then the band designation.
If probes for two or more loci are used in the same hybridization, they follow one another in
a single set of parentheses, separated by a comma (,), and a multiplication sign (x) outside the
parentheses if the number of signals for each probe is the same and inside the parentheses if
the number of hybridization signals varies. If multiple probes on the same chromosome are
used, they are listed pter->qter, separated by commas. For a single locus visualized with probes
to the 3' and 5' ends of a gene, they should be listed as they reside on the chromosome pter
to qter. If loci on two different chromosomes are tested, results are reported in a string, sepa­
rated by commas, in the order sex chromosomes and autosomes 1 to 22. If the study is on a
cancer specimen, the number of cells scored is placed in square brackets. Normal results from
multiple hybridizations can be combined in a single set of parentheses.

106 Cytogenet Genome Res 2016;149:1-140 ISCN 2016

DOI: 10.1159/000445813
nuc ish(D21S65x2)
nuc ish 21q22(D21S65x2)
Two copies of locus D21S65.

nuc ish(D21S65x3)
nuc ish21q22(D21S65x3)
Three copies of locus D21S65.

nuc ish(DXZlx3)
Three copies of locus DXZ1.

nuc ish(MYCNxl2—>50)[200]
Twelve to more than 50 copies of MYCN found in 200 cells.

nuc ish(MYCN amp)[200]

Number of MYCN copies cannot be quantified because it is increased in copy number beyond that which can
be reliably counted.

nuc ish(D17Zl,ERBB2)x2[100]
Two copies of ERBB2 (HER-2) were found in 100 cells with two copies of the centromere 17 probe D17Z1.

nuc ish(D 17Z1 ,ERBB2) x4~5[ 100/200]

Four to five copies of D17Z1 and ERBB2 were found in 100 out of 200 cells.

nuc ish(D 17Z1 x2,ERBB2x 10-20) [ 100/200]

Ten to 20 copies of ERBB2 were found in 100 cells as compared to two copies of the centromere 17 probe
D17Z1.

nuc ish(D17Zlx2-3,ERBB2 amp)[100/200]/(D17Zl,ERBB2)x3[20/200]

Amplification of ERBB2 was found in comparison to two to three copies of D17Z1 in 100 cells. In addition,
there were three copies of both D17Z1 and ERBB2 in 20 cells.

nuc ish(D 13S319x1 ,D 13S319 dimx 1 ,LAMP 1 x2)[ 197/200]

One signal for the locus D13S319 of normal intensity, one signal for the locus D13S319 of diminished inten­
sity, and two signals for the locus of LAMP1 of normal intensities were found in 197 out of 200 cells. Note
that only the abnormal cells are described.

nuc ish(D21S65,D21S64)x3
Three copies of locus D21S65 and three copies of locus D21S64.

nuc ish(DXZlx2,DYZ3xl,D18Zlx3),(RBl,D21S259/D21S341/D21S342)x3
Three copies of 13, 18 and 21, two copies of X and one copy of Y were found, which may indicate a triploid
69,XXY. Note that the chromosome 21 contig probe shows each locus listed, separated by slant lines.

nuc ish(ABLl,BCR)x2[400]
nuc ish 9q34(ABLlx2),22ql 1.2(BCRx2)[400]
Two copies of each locus ABL1 and BCR found in 400 cells, expressed with or without band designations.

nuc ish(KALl,D21S65)x2
Two copies of locus KALI and two copies of locus D21S65.

nuc ish(KALl,GK,DMD)xl
One copy of each locus, listed pter->qter.

If chromosome analysis and interphase FISH are performed, each is reported within the
string, separated by a period (.).

In situ Hybridization Cytogenet Genome Res 2016;149:1-140 107

DOI: 10.1159/000445813
46,XY[20].nuc ish(TP53x2)[400]

If metaphase and interphase FISH are both performed, each is reported within the string,
separated by a period (.). For cancer studies, the number of cells scored is shown in square
brackets for each.

46,XY[20].ish 9q34(ABLlx2),22ql 1.2(BCRx2)[20].nuc ish(TP53x2)[400]

Interphase analysis may be used to determine donor versus recipient. For explanation of the
use of double slant line (//) in chimeras, see section 4.1.

nuc ish(DXZlx2)[400]//
400 cells all representing the recipient.

//nuc ish(DXZl,DYZ3)xl[400]
400 cells all representing the donor.

nuc ish(DXZlx2)[50]//(DXZl,DYZ3)xl[350]
Fifty recipient XX cells and 350 donor XY cells were found using X and Y centromere probes.

nuc ish(DXZlx2)[50]//(DXZl,DYZ3)xl[300]/(DXZlxl)[10]
Fifty recipient XX cells were found among 300 donor XY cells and loss of the Y chromosome from 10 cells,
listed as though they are presumed from the donor.

nuc ish(ATM,D12Z3,D13S319,LAMPl,TP53)x2[200]
Normal hybridization patterns from different hybridizations showing two copies of each of the probes used.
Note that they may be listed within one set of parentheses.

When normal and abnormal cells are found, the number of abnormal cells is listed over the
total number of cells scored for each abnormal locus. The normal cells are not listed as it is
implied that they are the remainder of the total. Probe sets co-hybridized are included in the
same parentheses. The probe set with the lowest chromosome number is listed first.
nuc ish(ATM,TP53)x2[200],(D12Z3x3,D13S319x2,LAMPlx2)[100/200]
Two separate hybridizations were performed. In the first, there was a normal hybridization pattern showing
two copies each of the probes for the loci ATM and TP53 in all 200 cells. In the second hybridization, there
were three signals seen for the probe for the locus D12Z3 and two signals each for the probes for loci D13S319
and LAMP1 in 100 out of 200 cells.

nuc ish(ATMxl,TP53x2)[200/400],(D12Z3x3,D13S319x2,LAMPlx2)[100/400]
Two separate hybridizations were performed. In the first, loss of ATM signal is found in 200 cells. The re­
maining cells scored, 200, had a normal signal pattern. In the second hybridization, a gain of signal is seen
for D12Z3 in 100 cells. Three hundred cells show the normal pattern. Note, DI 3S319, TP53 and LAMP1 each
showed a normal hybridization pattern in 400 cells analyzed.

nuc ish(D13S319x0)[100/400]
Homozygous deletion of D13S319 in 100 among 400 cells scored. Three hundred cells show a normal pattern.

nuc ish(D13S319x0)[100/400]/(D13S319xl)[50/400]
Homozygous deletion of D13S319 in 100 among 400 cells scored. Fifty cells show a heterozygous deletion.
The remainder, 250 cells, show a normal pattern.

108 Cytogenet Genome Res 2016;149:1-140 ISCN 2016

DOI: 10.1159/000445813
 nuc ish(D13S319x0,LAMPlx2)[100/400]/(D13S319xl,LAMPlx2)[50/400]
Homozygous deletion of D13S319 in 100 among 400 cells scored. Fifty cells show a heterozygous deletion.
The remainder, 250 cells, show a normal pattern. LAMP1 is used as a control locus and shows two normal
hybridization signals in the 400 interphase cells analyzed.

nuc ish(TP73xl,ANGPTLx2)[107/200],(ZNF443x2,GLTSCRxl)[105/200]
Interphase ish shows one TP73 (maps to lp36) signal with two ANGPTL signals (1 q25) in 107 nuclei. In a second
hybridization, interphase ish shows two ZNF443 signals (19p 13) with one GLTSCR signal (19ql3) in 105 inter­
phase nuclei. Thus, the specimen shows loss of both Ip and 19q.

nuc ish(D20Z 1 x2,D20S 108x 1) [ 100/200]

Interphase ish showing one copy of D20S108 as compared to two copies of the centromere probe in 100 cells.

13.3.2 Relative Position of Signals

If loci on two separate chromosomes are tested, they are expected under normal circumstanc­
es to be spatially separated and results are expressed as follows:

nuc ish(ABLl,BCR)x2[400]

® = probe for ABL1

O = probe for BCR

However, if they have become juxtaposed on one chromosome because of a t(9;22), the results
are expressed with the first set of parentheses indicating the number of signals and the second
set of parentheses describing the relative position of the signals to one another:

nuc ish(ABLl,BCR)x2(ABLl con BCRxl)[400]

• = probe for ABL 7

O = probe for BCR

If they are found to be juxtaposed on two chromosomes using dual-fusion probes, the results
are expressed as:

nuc ish(ABLl,BCR)x3(ABLl con BCRx2)[400]

9 = probe for ABL1

O = probe for BCR

If a strange rearrangement has occurred resulting in the juxtaposition of one BCR locus with
two ABL1 loci, the results are expressed as follows:

In situ Hybridization Cytogenet Genome Res 2016;149:1-140 109

DOI: 10.1159/000445813
nuc ish(ABLl,BCR)x3(ABLl con BCRxl)(ABLl con BCR con ABLlxl)[400]

• = probe for ABL1

O = probe for BCR

Other possibilities using a dual-fusion probe are as follows:

nuc ish(ABLl,BCR)x2(ABLl con BCRxl)[400]

Deletion of the ABL1-BCR fusion on one derivative chromosome.

nuc ish(ABLlx2,BCRx3)(ABLl con BCRxl)[400]

Deletion of the ABL1 locus from one fusion on one derivative chromosome.

nuc ish(ABLl,BCR)x4(ABLl con BCRx3)[198]

Addition of one BCR-ABL1 fusion through gain of one derivative chromosome.

If hybridization signals are normally juxtaposed because of close physical association of the
respective loci on the same chromosome, normal results would be expressed as follows:

nuc ish(KALl,STS)x2

• = probe for KALI

O = probe for STS

However, if the loci (example above) are separated because of a structural rearrangement
of one X chromosome, the result is expressed as follows:

nuc ish(KALl,STS)x2(KALl sep STSxl)

• = probe for KALI

O = probe for STS

Amplification of the probe for one of the loci when juxtaposed to a normal signal is expressed
as follows:

nuc ish(IGHx3,BCL2x2,BCL2 amp)(IGH con BCL2xl)(IGH con BCL2 ampxl)

• = probe for BCL2

O = probe for IGH

Cytogenet Genome Res 2016;149:1-140 ISCN 2016

DOI: 10.1159/000445813
 Amplification of the probe for one of the loci when separated and not juxtaposed to a normal
signal is expressed as follows:

nuc ish(IGHx3,BCL2x2,BCL2 amp)(IGH con BCL2x2)

• = probe for BCL2

O = probe for IGH

nuc ish(PAX7xl,PAX7 amp,FOXOlxl,FOXOl amp)(PAX7 con FOXOl)amp

One normal signal each for the loci PAX7 and FOXO1 with fusion of the PAX7 and F0X01 loci on multiple
copies of a single chromosome too numerous to count identified through interphase analysis.

• = probe for PAX7

O = probe for F0X01

13.3.2.1 Single Fusion Probes

nuc ish(ABLl,BCR)x2(ABLl con BCRxl)[400]

Single fusion of the ABL1 and BCR loci on a single chromosome identified through interphase analysis.

13.3.2.2 Single Fusion with Extra Signal Probes

nuc ish(ETV6x2,RUNXlx3)(ETV6 con RUNXlxl)[300/400]

ETV6 and RUNX1 fusion with an extra RUNX1 signal.

nuc ish(ETV6xl,RUNXlx3)(ETV6 con RUNXlxl)[300/400]

ETV6 and RUNX1 fusion and deletion of ETV6 with an extra RUNX1 signal.

13.3.2.3 Dual Fusion Probes

nuc ish(ABLl,BCR)x3(ABLl con BCRx2)[400]

Dual fusion of the ABL1 and BCR loci in interphase.

nuc ish(D8Zlx2,MYCx3,IGHx3)(MYC con IGHx2)[l 00/200],(IGHx3,BCL2x2)[ 100/200]

Dual fusion of the MYC and IGHloci in interphase in 100 cells. In a separate hybridization, three copies of
JGHXqxq seen as compared to two copies of BCL2 in 100 cells, indicating an IGH translocation is present
but it does not involve BCL2.

nuc ish(MYHl l,CBFB)x3(MYHl 1 con CBFBx2)

Dual fusion of the MYH11 and CBFB loci in interphase.

13.3.2.4 Break-Apart Probes

Given that break-apart probes are made of two probes, the short form does not convey that
the normal situation is the presence of two fusion signals.

In situ Hybridization Cytogenet Genome Res 2016;149:1-140 111

DOI: 10.1159/000445813
 nuc ish(MLLx2)[400]
nuc ish(5'MLL,3'MLL)x2(5'MLL con 3'MLLx2)[400]
Two MLL probe fusion signals in interphase cells, indicating no disruption of the KMT2A gene.

nuc ish(CBFBx2)[400]
nuc ish(5'CBFB,3'CBFB)x2(5'CBFB con 3'CBFBx2)[400]
Two CBFB fusion signals in normal interphase cells.

Abnormal cells show the separation of signals.

nuc ish(MLLx2)(5'MLL sep 3'MLLxl)[200]

Two MLL probe signals, but one has separated into the 5' probe and the 3' probe, presumably because of a
translocation involving the KMT2A gene.

nuc ish(5'MLLx2,3'MLLxl)(5'MLL con 3'MLLxl)[200]

Two 5'MLL probe signals and one 3'MLL probe signal, presumably because of a deletion.

nuc ish(CBFBx2)(5'CBFB sep 3'CBFBxl)[200]

Two CBFB signals, but one has separated into the 5' probe and 3' probe, presumably because of an inversion
or translocation.

nuc ish(3'IGHx2,5'IGHx3)(3'IGH con 5'IGHxl)[210/237]

Using the IGH break-apart probe, an IGH rearrangement was observed with an extra 5' signal. Note that the
orientation is from pter to qter.

nuc ish(3'DDIT3x2,5'DDIT3xl,5'DDIT3 amp)(3'DDIT3 con 5'DDIT3xl)(3'DDIT3 con

5'DDIT3 ampxl)[ 192/200]
Using the DDIT3 break-apart probe, a DDIT3 rearrangement was observed with amplification of the 5' signal.
Note that the orientation is from pter to qter.

. = probe for 5'DDIT3

13.4
O O = probe for 3'DDIT3

In situ Hybridization on Extended Chromatin/DNA Fibers (fib ish)

Hybridization can be carried out on extended chromatin/DNA fibers usually obtained from
interphase nuclei, abbreviated fib ish. In this situation, the object of interest is the relative
position of the loci at a particular chromosomal location. Where the order of the loci tested
is known, they are recorded in the order pter to qter and the chromosomal band is indicated.

= D15S11
= SNRPN
xxxx =GABRB3

fib ish 15qll.2(D15Sll+,SNRPN+,GABRB3+)

Signifies that the three loci are present and in the order D15S11, SNRPN, GABRB3.

pter -------- ■■------- ••••—xxxx------------------qter

112 Cytogenet Genome Res 2016;149:1-140 ISCN 2016

DOI: 10.1159/000445813
13.5 Reverse in situ Hybridization (rev ish)

Reverse in situ hybridization (rev ish) refers to the in situ hybridization of complex DNA
probes derived from a test tissue to normal reference chromosomes. Chromosomes or chro­
mosome segments with enhanced (enh) or diminished (dim) fluorescence intensity ratios in­
dicate a relative increase or decrease of the copy number with regard to a basic euploid state.
For example, a chromosome present in three copies in a near-diploid cell line would show an
enhanced fluorescence intensity ratio, while a chromosome present in three copies in a near-
tetraploid cell line would show a diminished ratio. This method can only reveal alterations in
copy number of chromosomes or chromosomal segments.
Another method of reverse in situ hybridization uses DNA probes derived from parts of
the genome from a test tissue, such as the DNA of sorted or microdissected marker chromo­
somes. In situ hybridization of such DNA probes to normal reference chromosomes or to
DNA arrays reveals the composition of the isolated chromosome. This method is applicable
both to constitutional and acquired abnormalities, and can reveal structural rearrangements
not involving copy-number changes (e.g., inversions, balanced translocations).

13.5.1 Chromosome Analyses Using Probes Derived from Sorted or Microdissected Chromosomes

47,XX,+mar.rev ish 15q

Signifies that the marker chromosome is composed largely or wholly of material from 15q.

46, XY,add(5)(pl5).rev ish der(5)t(5;10)(pl5;q22)

Signifies a derivative chromosome consisting of part of the long arm of chromosome 10 translocated onto the
short arm of chromosome 5.

13.6 Chromosome Comparative Genomic Hybridization (cgh)

Comparative genomic hybridization (cgh) involves the simultaneous hybridization of test

DNA from cells suspected of carrying imbalance of chromosomes or chromosome segments
with reference (control) DNA from cells with a known, usually normal, karyotype. The two
DNA specimens are differentially labeled and hybridized to metaphase chromosomes from a
karyotypically normal reference. CGH is a method which can detect relative copy-number
changes. Only unbalanced gains or losses can be detected with this method. After chromo­
somal CGH, the karyotype can be re-written based on the knowledge gained from the FISH
results. Alterations based on CGH alone can be written as follows:

47, XX,+mar.ish cgh enh(10)(p)

Signifies that the marker chromosome is composed mostly or wholly of material from lOp.

46, XX,add(7)(q36).ish cgh der(7)t(7;21)(q36;q22)enh(21)(q22)

Signifies that the additional material on 7q is composed of material from 21q22.

47, XY,+r.ish cgh enh(l)(q32q43),enh(12)(ql3)

Signifies that the ring chromosome is composed of material from Iq32q43 and 12ql 3.

ish cgh enh(21)

Signifies extra copies of chromosome 21.

ish cgh dim(7)(q21qter)

Signifies a decrease in signal intensity from 7q21 to qter after chromosomal CGH.

ish cgh dim(18)(q21qter)

Signifies a decrease in signal intensity from 18q21 to 18qter.

In situ Hybridization Cytogenet Genome Res 2016;149:1-140 113

DOI: 10.1159/000445813
13.7 Multi-Color Chromosome Painting

24-color karyotyping and FISH banding are techniques used to paint chromosomes with a
distinct color or spectrum of colors. They can be used as a tool to clarify the G-banded anal­
ysis. The karyotype can be re-written based on the knowledge gained from the FISH results
using these techniques. The use of these FISH techniques should be stated in the report. No
special nomenclature has been devised for these techniques. However, a nomenclature simi­
lar to that used for wcp (Section 13.2) may be used.

13.8 Partial Chromosome Paints

Band-specific or arm-specific probes can be used as partial chromosome paints (pep). The no­
menclature is similar to that of wcp (13.2).
46,XX,?dup( 18)(p 11.2p 11.3).ish dup( 18)(pcp 18p 11.2+)
A questionable duplication on 18p is shown to contain 18p 11.2 material by a partial chromosome paint.

46,XY,inv(8)(p21ql3).ish inv(8)(pcp8p++)
An inversion of chromosome 8 is confirmed by a partial chromosome paint.

114 Cytogenet Genome Res 2016;149:1-140 ISCN 2016

DOI: 10.1159/000445813
14 Microarrays

14.1 Introduction

Microarray-based chromosome analysis has become an adjunct to traditional chromosome

analysis and FISH; for postnatal analysis, it has become the laboratory method of choice for
identifying chromosome abnormalities. Microarrays can be constructed in at least two ways:
with the use of large pieces of cloned DNA such as bacterial artificial chromosomes (BACs),
or with small, synthetic sequences of DNA, termed oligonucleotides, which may be designed
to detect copy number or to detect single nucleotide polymorphisms (SNPs). Each segment of
DNA has a known position within the human genome. These DNA segments are spotted onto
a solid support, usually a glass slide or silicon chip, and serve as a target for the genomic DNA
sample.
In array-based comparative genomic hybridization (aCGH) to BACs or oligonucleotides,
this method uses a test DNA and a reference (control) DNA, differentially labeled and simul­
taneously applied to the microarray. In SNP-based microarray analysis, the patient DNA is
hybridized to the microarray and compared by computer analysis to a pool of normal indi­
viduals. In either approach, the DNA of the patient is compared to the control or reference
DNA and gains or losses can be detected. The nomenclature has been refined to encompass
either type of array, built out of BACs, oligonucleotides for copy number detection only, or
SNPs, so that arrays made out of combinations of oligonucleotides and SNPs may be described
with a single nomenclature. In this improved nomenclature, the number and type of clones
used as targets (BAC, cosmid, fosmid, oligonucleotide, etc.) are not included. Two systems
have been devised; a detailed description that includes the span of the abnormal nucleotides,
as well as the bordering normal nucleotides, and a short description that includes only the
abnormal nucleotides. In both the detailed and short descriptions, the nucleotide numbers are
given without commas and the span is separated by an underscore (_), in line with the mo­
lecular genetic nomenclature outlined by Human Genome Variation Society (HGVS) recom­
mendations (www.HGVS.org/varnomen ). When nucleotide numbers are used to define an
abnormal result, the specified genome build (e.g. [GRCh38]) is placed within the string as il­
lustrated in this chapter. Note that there is a space after the square bracket and that the spe­
cific genome build is not necessary when describing a normal male or female result or an an-
euploidy with the short description as shown in this chapter.
In highly complex array results, the laboratory may choose to display results using ISCN
nomenclature in a table instead of in a string. This is often the case in cancer. At the discre­
tion of the lab, the information can include an estimate of the proportion of cells with the
abnormality.

Microarrays Cytogenet Genome Res 2016;149:1-140 115

DOI: 10.1159/000445813
14.2 Examples of Microarray Nomenclature

If the results are normal using any type of array that has probes targeted to multiple loci across
all chromosomes, the results are expressed as follows with no space between arr and the open­
ing parenthesis. The sex chromosomes are separated from the autosomes, which are listed
first.

arr(l-22,X)x2 normal female

arr(l-22)x2,(X,Y)xl normal male

The descriptive narrative, or interpretation, in the report should indicate the platform used,
the resolution, and whether the array represents the entire genome of all chromosomes.

If the results are abnormal, list only the aberrations. Regardless of whether it is a copy
number gain or loss, the aberrations are listed from lowest to highest chromosome; sex
chromosome abnormalities should be listed last. Only the band designations of the abnor­
mal clones are shown. The aberrant nucleotides are listed from pter to qter, consistent with
the public databases of current genome builds on UCSC or Ensembl Genome Browsers
(www.genome.ucsc.edu or www.ensembl.org). Multiple nucleotides may be listed, sepa­
rated by commas, or an underscore may be used to indicate that the gain or loss encom­
passes the segment between the listed clones. To indicate a mixed cell population, the pro­
portion of cells with the abnormality can be estimated and included in brackets following
the copy number.

arr(X)xl[0.6]
arr[GRCh38] Xp22.33q28(168546_155233730)xl[0.6]
Microarray analysis shows a single copy loss of the X chromosome in approximately 60% of cells. The GRCh38
refers to the Genome Reference Consortium Human Build 38 assembly.

arr(8)x3,(21)x3
Microarray analysis shows a single copy gain of chromosomes 8 and 21.

arr(X)x2,(Y)xl
Microarray analysis shows a single copy gain of the X chromosome in a male.

arr(16q)x3
Microarray analysis shows a single copy gain of the whole long arm of chromosome 16.

arr[GRCh38] 6q21q25.1(l 13900000_149100000)xl,(21)x3

Microarray analysis (based on the GRCh38 assembly) shows loss in the long arm of chromosome 6 at bands
q21 through q25.1 and a single copy gain (trisomy) of chromosome 21.

arr(l-22)x3,(X)x2,(Y)xl
Microarray analysis shows triploidy 69,XXY.

arr(l-22,X)x3
Microarray analysis shows triploidy 69,XXX.

arr(l-19,21,22,X)x3
Microarray analysis shows a near-triploid female with only two copies of chromosome 20.

116 Cytogenet Genome Res 2016;149:1-140 ISCN 2016

DOI: 10.1159/000445813
arr[GRCh38] 4q32.2q35.1(163146681_183022312)xl
arr[GRCh38] 4q32.2q35.1(163002425x2,163146681.183022312x1,184322231x2)
Microarray analysis shows a loss of the long arm of chromosome 4 at bands q32.2 through q35.1, which is at
least 19.8 Mb in size. The detailed description shows that the next neighboring proximal nucleotide that does
not show a loss is 144,256 nucleotides away and the next neighboring distal nucleotide that does not show a
loss is 1.3 Mb away from the alteration.

Because microarray analysis can only demonstrate a relative gain or loss of DNA, FISH anal­
ysis or karyotype is necessary to definitively demonstrate the structure of deletions, duplica­
tions, insertions, unbalanced translocations, etc. The parental origin of the abnormality may
follow the copy number (xl, x3, etc.). There is a space between the copy number and the in­
heritance symbol (dn, mat, pat, inh), but no space if the inheritance symbol follows a paren­
thesis in the detailed system.

arr[GRCh38] 4q32.2q35.1(163146681_183022312)xl dn
arr[GRCh38] 4q32.2q35.1(163002425x2,163146681.183022312x1,18432223lx2)dn

arr[GRCh38] Xq25(126228413_126535347)x0 mat

arr[GRCh38] Xq25(126023321xl,126228413.126535347x0, 126556900xl)mat
Microarray analysis shows a loss of the long arm of the X chromosome at band q25 in a male. The hemizy-
gous loss is at least 306,934 nucleotides. The next neighboring proximal nucleotide that does not show a loss
is 205,092 nucleotides away and the next neighboring distal nucleotide that does not show a loss is 21,553
nucleotides away from the alteration. This deletion was inherited from the mother.

arr[GRCh38] Xq25(126228413_126535347)xl
arr[GRCh38] Xq25(126023321x2,126228413.126535347x1,126556900x2)
Same abnormality as the above example, but found in a female.

arr[GRCh38] Xp22.31(6467202_8091950)x0 mat

Microarray analysis in a male shows a loss of the short arm of the X chromosome at band p22.31, inherited
from a carrier mother.

arr[GRCh38] Xpl 1.22(53215290_53986534)x2 mat

Microarray analysis in a male shows a gain of the short arm of the X chromosome at band pl 1.22, inherited
from a carrier mother.

arr[GRCh38] Xpl 1.22(53215290_53986534)x3

Same abnormality as the above example, but found in a female.

arr[GRCh38] 1 lpl2(37741458_39209912)x3
arr[GRCh38] 1 lpl2(37003221x2,37741458.39209912x3,39752007x2)
Microarray analysis shows a single copy gain of the short arm of chromosome 11 at band pl2. The duplica­
tion is at least 1.47 Mb in size. The next neighboring distal clone that does not show a gain is 738,237 nucle­
otides away from the alteration and the next neighboring proximal clone that does not show a gain is 542 kb
away from the alteration.

arr[GRCh38] 17pl 1.2(16512256.20405113)x3 dn

Microarray analysis shows a single copy gain of the short arm of chromosome 17 at band pl 1.2. The duplica­
tion is at least 3.9 Mb in size and is de novo in origin.

Microarrays Cytogenet Genome Res 2016;149:1-140 117

DOI: 10.1159/000445813
Observations combined with banded chromosome analysis and microarrays can be expressed
by using the symbol arr followed by the genome build, a space and the chromosome region,
band or sub-band designation of the locus. A period (.) precedes the microarray nomenclature.
Where multiple techniques are used, the karyotype is listed first followed by FISH, followed
by results obtained with other techniques.

47,XY,+mar.arr[GRCh38] lpl2pl 1.2(117596421_121013236)x3 dn

Microarray analysis shows a single copy gain of the short arm of chromosome 1, spanning approximately 3.4
Mb, likely identifying the marker chromosome. Because most microarrays will not contain the heterochroma­
tin near the centromeres, the centromeric bands are rarely included in the nomenclature of rings and markers
after microarray analysis, although the centromere is probably included in the aberration and would need to
be confirmed by FISH. An amended result after FISH analysis could be written as:

47,XY,+mar.ishr(l)(pl3.1qll?)(DlZl+).arr[GRCh38] lpl2pl 1.2(117596421_

121013236)x3 dn

47,XY,+mar.arr[GRCh38] lpl2pl 1.2(117596421_121013236)x3 dn,15q25.1q26.3

(78932946.100201 136) x3 dn
Microarray analysis shows two de novo aberrations: a single copy gain of the short arm of chromosome 1 and
a single copy gain of the long arm of chromosome 15, likely identifying a complex marker comprised of mate­
rial from chromosome 1 and chromosome 15.

46,XX.arr[GRCh38] 3pl2.2(80395073_83498191)x3 inh,12pl2.1(23543231_

23699047)xl dn
Normal female chromosome analysis showing a gain in 3p by microarray analysis, inherited from a parent,
and a loss of 12p at band 12p 12.1 of de novo origin.

arr[GRCh38] 8q23.1q24.3(105171556_14620191 l)x3,15q26.2q26.3(96062102_

100201136)xl
Microarray analysis shows a single copy gain of 8q and a single copy loss of 15q. Double segmental imbal­
ances are indicative of unbalanced translocations. However, microarrays can only detect relative imbalances
in DNA copy number. After chromosome analysis and FISH visualization, the nomenclature can be written
as follows:

46,XY,der(15)t(8;15)(q22.3;q26.2)mat.ish der(15)t(8;15)(RPll-U43I12+,RPll-
14C10-).arr[GRCh38] 8q23. lq24.3(105171556,14620191 l)x3,15q26.2q26.3
(96062102.100201 136) xl
mat is placed after the conventional cytogenetic result because the derivative was determined to be inherited
from a balanced translocation in the mother.

Note that the conventional cytogenetic banding assignments are those derived from banded
chromosomes, while the array banding assignments are those derived from genome browsers.
These are not always concordant with each other.

arr[GRCh38] 20ql3.13ql3.33(51001876_62375085)xl,22ql3.32ql3.33(4853321 1,
49525263)x3
Microarray analysis shows a single copy loss of 20q and a single copy gain of 22q.

arr[GRCh38] 4q28.2(128184801_129319376)x3 mat,16pl 1.2(29581254,

30066186)x3 pat
Microarray analysis shows a gain of 4q, inherited from the mother, and a gain of 16p, inherited from the fa­
ther.

118 Cytogenet Genome Res 2016;149:1-140 ISCN 2016

DOI: 10.1159/000445813
arr[GRCh38] 9p24.3(1310386_1709409)xl mat,9p22.3p22.2(16455330_16763471)xl dn,
18q22.33q22.1(62747805_67920791)xl dn
Microarray analysis shows three abnormalities. The first abnormality is a loss of maternal origin; the other two
abnormalities are de novo losses. Therefore, the inheritance of each is listed after the specific gain or loss. Note
that the two abnormalities on chromosome 9 are listed from pter to qter.

arr[GRCh38] 14q31.1(82695844_82855387)xl,14q32.33(105643093_106109395)x3
Microarray analysis shows two abnormalities on chromosome 14. Note that the abnormalities are shown from
pter to qter, irrespective of whether they are gains or losses.

arr[GRCh38] 9p24.3pl3.1(204166_38756057)xl,18q21.33q22.1(63877984_64683663)xl,
21qll.2q21.1(13600026_20175986)x3
Microarray analysis shows three abnormalities; a deletion of the short arm of the 9p covered by the array, a
deletion of the long arm of chromosome 18 and a duplication of the distal long arm of chromosome 21. Note
that the chromosomes are listed in numerical order, regardless of whether they show a gain or loss.

arr[GRCh38] lp36.33p36.32(827048_3736354)x3,lq41q44(221649655_247175095)xl
Microarray analysis shows a gain of the short arm of chromosome 1 and a loss of the long arm of chromosome
1. This result may indicate a duplication/deletion recombinant chromosome from an inversion parent, but
further studies of the parents and/or child by FISH or chromosome analysis are required.

arr[GRCh38] 18pll.32(102328_2326882)xl,18q21.31q23(56296522_76093443)x3
Microarray analysis shows a loss of the short arm of chromosome 18 and a gain of the long arm of chromosome 18.

46,XY,rec(18)dup(18q)inv(18)(pll.32q21)pat.arr[GRCh38] 18pll.32(102328_2326882)xl,
18q21.31q23(56296522_76093443)x3
Same example as above, showing conventional cytogenetic nomenclature as part of the string. Chromosome
analysis in the father demonstrated a balanced pericentric inversion. Thus, this is a duplication/deletion re­
combinant chromosome from an inversion carrier parent.

arr[GRCh37] 20ql3.2ql3.33(51840606_62375085)x3,Yqll.23(26887746_27019505)x0
Microarray analysis shows a loss of the long arm of the Y chromosome and a gain of the long arm of chromo­
some 20. Note that the sex chromosome abnormality is listed last.

46,X,der(Y)t(Y;20)(ql 1.23;ql3.2).arr[GRCh38] 20ql3.2ql3.33(51840606_62375085)x3,

Yql 1.23(26887746_27019505)x0
Same example as above, showing the banded chromosome nomenclature. Note that there is no normal Y
chromosome in this individual.

46,XY,der(20)t(Y;20)(qll.23;ql3.2).arr[GRCh37] 20ql3.2ql3.33(51840606_62375085)xl,
Yql 1.23(26887746_27019505)x2
Microarray analysis shows an unbalanced translocation derived from rearrangement between the long arm of
the Y chromosome, resulting in a gain of distal Yq, and the long arm of one chromosome 20, resulting in a
deletion of distal 20q. Note that the array nomenclature lists the sex chromosome abnormality last and that
there is a normal Y chromosome in addition to the derivative chromosome 20 in this individual.

46,XX.arr[GRCh38] 5ql4.3(88018766_89063989)xl,Xp22.31(6923924_7253485)x3
Microarray analysis shows a single copy gain of the short arm of the X chromosome and a single copy loss of
the long arm of chromosome 5. Note that the sex chromosome abnormality is listed last.

46,X,der(Y)t(X;Y)(p22.33;ql2).arr[GRCh37] Xp22.33(701_2679502)x3,Xp22.33p22.2
(2709521_15955588)x2,Yqll.221qll.23(16139805_27177529)x0
Chromosome and microarray analyses show a single copy gain of the X chromosome from two regions of Xp
and loss of the long arm of the Y chromosome, resulting from an unbalanced translocation between the short
arm of the X chromosome and the long arm of the Y. The two regions of Xp are shown separately because the
gain of the pseudoautosomal region results in three total copies and the gain proximal to the pseudoautosomal
region results in two total copies.

Microarrays Cytogenet Genome Res 2016;149:1-140 119

DOI: 10.1159/000445813
ish mos del(2)(ql 1.2ql3)(RPl 1-1 lP22-)[10/30].arr[GRCh38] 2ql 1.2ql3(100982729_
112106760)x1(0.4]
FISH and microarray analyses show a mosaic deletion in the long arm of chromosome 2. By microarray ap­
proximately 40% of cells have the deletion.

47,XY,+mar.ish der(2)(pl 1.2ql3)(D2Z2+)[5/30].arr[GRCh38] 2pl 1.2ql 3(90982729.

112106760)x3[0.15]
Microarray and FISH analyses demonstrate a mosaic marker chromosome derived from chromosome 2. By
microarray approximately 15% of cells have 3 copies of the defined region.

47,XX,+mar.arr[GRCh38] 21ql 1.2q21.1(13461349_17308947)x4,21q22.3(46222759_

46914885)x3
Microarray analysis shows a two copy gain of 2 lql 1.2q21.1 and a single copy gain of 2 lq22.3, indicating that
the marker chromosome is likely a complex rearrangement involving two different segments of chromosome
21, resulting in partial tetrasomy of proximal 21q and partial trisomy of distal 21q.

arr[GRCh38] 15ql l.lql3.2(20366669_30226235)x4

Microarray analysis shows a two copy gain of proximal 15q, resulting in tetrasomy 15qll.lql3.2. Distinguish­
ing a marker chromosome from a triplication of this region requires FISH.

arr[GRCh38] 12pl3.33pl l.l(84917_34382567)x2~4

Microarray analysis shows a two copy gain of the short arm of chromosome 12, resulting in tetrasomy 12p.
Although this result likely indicates an isochromosome of 12p, such as those found in Pallister Killian syn­
drome, FISH or chromosome analysis is required to confirm. The approximate sign is used to indicate that
the number of copies of this region varies from 2 to 4.

arr[GRCh38] 18pl 1.32q23(102328_79093443)x3

Microarray analysis shows a single copy gain of the entire chromosome 18, likely indicating trisomy 18.

arr[GRCh38] 21ql 1.2q22.3(13531865_46914745)x3

Microarray analysis shows a single copy gain of the entire long arm of chromosome 21, likely indicating tri­
somy 21. Note that most microarrays will not have coverage of the repetitive short arm sequences; thus the
short arm is not designated. Trisomy 21 is implied, but FISH or chromosome analysis is required to exclude
a Robertsonian or other translocation.

arr[GRCh38] 18pll.32pll.21(102328_15079388)xl,18q22.3q23(69172132_79093443)xl
Microarray analysis shows a single copy loss of the distal short arm of chromosome 18 and a single copy loss
of the distal long arm of chromosome 18, likely indicating a ring chromosome 18, although FISH or chromo­
some analysis is required to confirm.

arr[GRCh38] Xq28 or Yql2(155790872_156030895 or 56959165_57217415)xl

Microarray analysis shows a single copy loss of the pseudoautosomal region that is found at Xq28 and Yql2.
It is not possible to determine if the loss is from X or Y in a male; FISH or chromosome analysis is required
to confirm the origin of the loss.

arr[GRCh38] 7pl 1.2(54290345_55087100)amp

Microarray analysis of a solid tumor shows amplification of a region in 7pl 1.2. The exact copy number is too
high to be enumerated accurately by array.

arr[GRCh38] Hq22.3q23.2(104669588_113439979)xl[0.3],13ql4.13ql4.3(46290874_
51390298)xl[0.8]
Microarray analysis of a CLL shows deletion in the long arm of chromosome 11 in approximately 30% of cells
along with a deletion in the long arm of chromosome 13 in approximately 80% of cells.

120 Cytogenet Genome Res 2016;149:1-140 ISCN 2016

DOI: 10.1159/000445813
 arr[GRCh38] (l-7)xl,(9-12)xl,13ql2.1 lql4.2(19438807_48800573)xl,13ql4.2
(48986461_49176936)x0~l,13ql4.2qter(49176999_115095706)xl,(15-20)xl,(22)xl,(X)xl
Microarray analysis in a cancer in a female shows a near haploid genome, with single copies of chromosomes
1 to 7, 9 to 12, 15 to 20, 22 and X. The result for chromosome 13 showed regions of single copy loss and a
region in 13ql4.2 with a mixture of homozygous loss and single copy loss. Results for chromosomes 8, 14,
and 21 were normal two copies.

14.2.1 Nomenclature Specific to SNP Arrays

Single nucleotide polymorphisms (SNP) can be identified using certain types of oligonucleotide
microarrays. The use of SNP arrays may uncover regions of homozygosity that have been re­
duced from previously known heterozygosity. The symbols htz and hmz can be used to define
the zygosity of the chromosomal region.

arr[GRCh38] 1 lpl2(37741458_39209912)x2 hmz

SNP array analysis shows homozygosity in the short arm of chromosome 11, at band pl 2, at least 1.47 Mb in
size.

arr[GRCh38] 1 lpl2(37741458_39209912)x2 mos hmz mat

SNP array analysis shows mosaic homozygosity in the short arm of chromosome 11, at band pl2, at least
1.47 Mb in size and of maternal origin.

upd(16)mat.arr[GRCh38] 16pl3.3q23.1(31010_78001824)x2 htz,16q23.1q24.2

(78003664_88690776)x2 hmz
SNP array analysis shows heterozygosity for the majority of chromosome 16 in the region 16pl3.3q23.1 and
homozygosity for the distal long arm of chromosome 16 in the region 16q23.1q24.2. In combination with
subsequent SNP array data obtained from the parents, uniparental disomy for a maternally derived chromo­
some 16 was identified.

arr[GRCh38] 15ql 1.2q26.3(23123715_101888908)x2 hmz pat,21ql 1.21q22.3(14595263_

48084819)x2 hmz pat
SNP array analysis shows homozygosity for the entire long arms of chromosomes 15 and 21, respectively.
Based on additional SNP array analyses in the parents, both regions of homozygosity reveal uniparental isodi­
somy obtained from the father.

arr(15q,21q)x2 hmz pat

arr[GRCh38] (15ql 1.2q26.3(23123715_101888908),21ql 1.21q22.3(14595263_
48084819))x2 hmz pat
SNP array analysis shows homozygosity for the entire long arms of chromosomes 15 and 21, respectively.
Based on additional SNP array analyses in the parents, both regions of homozygosity reveal uniparental isodi­
somy obtained from the father. In some circumstances, a short form may be sufficient to describe the abnor­
malities. Note the use of the parentheses in the long form with multiple regions of homozygosity being grouped.

arr(7)x2 htz mat

SNP array analysis shows maternal uniparental heterodisomy for chromosome 7.

arr[GRCh38] 1 Ipl5.5pl5.4(2265338_6275434)x2 hmz c,19ql3.33qter(49759500_

58586384)x2 hmz
This is a possible example of a Beckwith-Wiedemann syndrome patient with inherited, segmental UPD for
1 Ipl5.5pl5.4 and an acquired region of homozygosity of 19ql3.33qter. Segmental UPD may be better re­
ferred to in cancer cases as copy neutral loss of heterozygosity (LOH) and in constitutional cases as absence
of heterozygosity (AOH).

Microarrays Cytogenet Genome Res 2016;149:1-140 121

DOI: 10.1159/000445813
 arr[GRCh38] 1 Ipl5.5pl5.4(2265338_6275434)x2 hmz,19ql3.33qter(49759500_
58586384)x2 hmz
In this second example, both regions of homozygosity are acquired or the inheritance is not known.

arr(3,7,9q, 13-17,19,20,22,X)xl
SNP array profile result indicating near-haploidy in a female with acute lymphoblastic leukemia. Chromo­
somes 1, 2, 4-6, 8, 9p, 10-12, 18, and 21 show a heterozygous state, which does not need to be emphasized,
since this represents the normal situation, whereas the other chromosomes and 9q show homozygosity, which
also does not to be emphasized because this is already clear by the x 1 notation. Based on only SNP array data,
it is not always possible to conclude/deduce whether this concerns a near-haploid complement or a mixture
of near-haploid and doubled near-haploid complements. Doubling the string to arr(l,2)x4,(3)x2 hmz,(4-
6)x4,(7)x2 hmz,(8,9p)x4,(9q)x2 hmz,(10-12)x4,(13-17)x2 hmz,(18)x4,(19,20)x2 hmz,(21)x4,(22,X)x2 hmz
would also be correct. In this way, it becomes clear that all chromosomes are actually abnormal compared to
normal diploidy, either by copy number or by being homozygous.

arr(l-13)x2 mos hmz,(14)x2~3,(16-20)x2 mos hmz,(21)x2~3,(22)x2 mos hmz,(X)xl~2,

(Y)xl~2
Consistent with a doubled near-haploid complement in a male with acute lymphoblastic leukemia. Because
of the mixture of DNA from normal and leukemic cells, SNP array analysis shows mosaic homozygosity for
chromosomes 1 to 13, 16 to 20, and 22. There was copy number gain for chromosomes 14, 21, X, and Y.

14.2.2 Complex Array Results

The symbol ex for complex chromosome rearrangement is used for multiple complex rear­
rangements across the entire genome.
arr(l-22,X)cx
Microarray analysis shows multiple complex rearrangements across the entire genome in a female.

arr(l-22)cx
Microarray analysis shows multiple complex rearrangements in chromosomes 1 through 22. The sex chromo­
somes appear normal and are therefore not shown.

arr(l-22,X,Y)cx
Microarray analysis shows multiple complex rearrangements across the entire genome in a male.

Chromothripsis (cth) refers to complex patterns of alternating copy number changes

(normal, gain, or loss) along a chromosome or chromosomal segment.

arr(lp)cth
Microarray analysis shows multiple alternating changes (normal segments, gains, and/or losses within the re­
gion) in the short arm of chromosome 1. All material is from the short arm of chromosome 1.

arr(l,13)cth
Short description of a microarray analysis that shows chromothripsis in chromosome 1 (all material is from
chromosome 1) and chromosome 13 (all material is from chromosome 13).

arr[GRCh38] (l)cth,6q25.1q27(149100000_170899992)xl,(13)cth
Microarray analysis shows chromothripsis as in the above example with a loss of the long arm of chromosome
6 at bands q25.1 through q27.

122 Cytogenet Genome Res 2016;149:1-140 ISCN 2016

DOI: 10.1159/000445813
15 Region-Specific Assays

15.1 Introduction

Several technologies exist that can be used to quantify the number of copies of a particular
locus. Multiplex ligation-dependent probe amplification (MLPA), quantitative fluorescent
PCR, real-time PCR, and bead-based assays can all be used to determine the number of cop­
ies of a chromosome or chromosomal region. These assays have collectively been referred to
in this chapter as region-specific assays (rsa). When a kit is used, the name of the kit can be
designated if the genomic coordinates are not known; however, the greatest precision is
achieved by providing nucleotide numbers. As is done for microarray, the span of the abnor­
mal nucleotides is separated by an underscore. When nucleotide numbers are used, the spec­
ified genome build (e.g. [GRCh38]) is placed within the string as illustrated in this chapter.
Aberrations are listed from lowest to highest chromosome; sex chromosome abnormalities
should be listed last. The use of rsa can be applied also to small, targeted arrays that are lim­
ited to a number of regions that can be reasonably listed in the nomenclature. The decision
to list the normal loci included in the assay is at the discretion of the laboratory.

15.2 Examples of RSA Nomenclature for Copy Number Detection

46,XX.rsa(13,18,21,X)x2
Normal female karyotype and normal copy number of chromosomes 13, 18, 21 and X using a region-specific
assay.

rsa( 13,18,2 l)x2,(X,Y)xl

Normal copy number of chromosomes 13, 18, 21, X and Y in a male using a region-specific assay.

rsa( 13,18)x2,(21 )x3,(X,Y)xl

Abnormal copy number result for chromosome 21 showing a gain for the whole chromosome (trisomy) in a
male using a region-specific assay. For clarity, the also tested normal disomic states for the chromosomes 13
and 18 are included in the nomenclature.

rsa(13,18)x2,(21)x3,(X)x2
Abnormal copy number result for chromosome 21 showing a gain for the whole chromosome (trisomy) in a
female using a region-specific assay. For clarity, the also tested normal disomic states for the chromosomes 13
and 18 are included in the nomenclature.

Region-Specific Assays Cytogenet Genome Res 2016;149:1-140 123

DOI: 10.1159/000445813
 rsa( 13,18,2 l)x2,(X)xl
Abnormal copy number showing a loss of one sex chromosome using a region-specific assay, consistent with
monosomy X. For clarity, the also tested normal disomic states for the chromosomes 13, 18 and 21 are in­
cluded in the nomenclature.

rsa( 13,18,21 )x2,(X)x2,(Y)x 1

Abnormal copy number showing an additional X chromosome in a male using a region-specific assay. For
clarity, the also tested normal disomic states for the chromosomes 13, 18 and 21 are included in the nomen­
clature.

rsa(21)x3,(X)x2,(Y)xl
Abnormal copy number result for chromosome 21 showing a gain for the whole chromosome (trisomy) along
with an additional X chromosome in a male using a region-specific assay.

rsa[GRCh38] lp36.33(849466_2432509)xl
Abnormal copy number result for lp36.33 showing a loss using a region-specific assay.

arr[GRCh38] 8p23.1(8479797_l 1897580)xl.rsa 8p23.1(GATA4)xl

Microarray analysis shows a deletion of 8p at sub-band 8p23.1 which was confirmed using a region-specific
assay targeting the GATA4 locus.

rsa 22ql 1.2(“kit name”)xl

Abnormal result showing a loss of 22ql 1.2 using an MLPA kit. The name of the kit can be inserted in the
parentheses without the quotation marks.

rsa Xp21.1(DMDexons22-27)xl
Abnormal result showing loss of exons 22 to 27 of the DMD gene by MLPA in a female.

rsa 22ql 1.21(HIRA)xl

Abnormal result showing a loss of 22ql 1.21 using a region-specific assay targeting the HIRA locus.

15.3 Examples of RSA Nomenclature for Balanced Translocations or Fusion Genes

rsa(BCR:: ABL1 )neg

Normal result using a region-specific assay to identify a BCR-ABL1 translocation or juxtaposition.

rsa(BCR:: ABL 1 )pos

Abnormal result using a region-specific assay that shows a BCR-ABL1 translocation or juxtaposition.

arr[GRCh38] (8)x3,9q34.1 lq34.3(129300000_140273252)xl.rsa(BCR::ABLl)pos,

(CBFB::MYHll)pos
Abnormal array result showing a gain of chromosome 8 and loss of chromosome band 9q34. In addition, two
translocations were identified with region-specific assays.

124 Cytogenet Genome Res 2016;149:1-140 ISCN 2016

DOI: 10.1159/000445813
16 Sequence-Based Assays

16.1 Introduction

Historically, the ISCN has covered the description of numerical and structural chromo­
some changes detected using a variety of traditional and molecular cytogenetic techniques,
while the Human Genome Variation Society (HGVS) recommendations (www.HGVS.org/
varnomen) cover the description of changes at the nucleotide level detected using sequencing.
Given the increased use of sequencing technologies to characterize chromosomal abnormali­
ties (Schluth-Bolard et al., 2013; Ordulu et al., 2014; Newman et al., 2015), and the standards
already established by ISCN and HGVS, it has become evident that a combined ISCN and
HGVS standard for the description of chromosome rearrangements identified by sequence­
based technologies is required. The following method of combining ISCN-like description of
chromosome rearrangements with HGVS-like nucleotide variant descriptions has been devel­
oped jointly between the ISCN and HGVS.

16.2 General Principles

Key aspects of the combined standard:

• Only aberrant findings are described.
• Both the ISCN-like description of chromosome aberrations and the HGVS-like nucleotide
variant descriptions must be included for full clarity and information.
• The ISCN-like portion of the description appears first and can be modelled on short or long
form ISCN description of structural rearrangements.
• The ISCN-like portion of the description begins with seq to indicate that the aberration
was identified by sequence-based technology. It must include the genome build in square
brackets after seq.
• Observations combined with other techniques, such as banded chromosome analysis or
microarrays can be expressed by using the symbol .seq, where a period (.) precedes the se­
quencing nomenclature.
• The combined nomenclature uses the existing HGVS standards for the HGVS-like portion
(see below and www.hgvs.org/mutnomen/) along with additional recommendations out­
lined below for the description of an aberration.

Briefly, existing HGVS standards include the following:

• An underscore indicates a range of nucleotides. For example, g. 123_456del indicates a de­
letion of segment including nucleotides 123 to 456.

Sequence-Based Assays Cytogenet Genome Res 2016;149:1-140 125

DOI: 10.1159/000445813
• Uncertainty is indicated by enclosing the uncertainty with parentheses. Thus, g.l23_
(450_856)del indicates that the deletion extends to an unknown location between nucleo­
tides 450 and 856.
• In runs of identical nucleotides, the most 3' base in the run is designated as the variant.
This is termed the “3' rule”. For example, g.4delT (not g.2delT or g.3delT) describes the
change CTTTA to CTTA.
• Curly braces { } are used to indicate differences in the altered segment compared to the
reference sequence in duplications, inversions, conversions, insertions, etc., e.g.,
g.l23_456dup{234G>A}.
• Inverted sequences are described using inv.

To cover the joint standards for the description of chromosome abnormalities, existing HGVS
recommendations have been extended:
• Aberrations affecting autosomes are listed first (numbers from low to high), followed by
those affecting sex chromosomes (X then Y).
• Breakpoint location is determined by the first breakpoint encountered starting as described
above, i.e. from pter of the chromosome with the lowest number involved.
• Multiple breakpoints in one chromosome are listed in order of occurrence from pter to
qter.
• Variant descriptions are always in the forward orientation (from nucleotide 1 to the end
of the chromosome), determined by the chromosomal origin of the intact centromere.
• The start of the chromosome is described as pter, the end as qter since the genomic refer­
ence sequence contains Ns at the start and end of the chromosome (telomeres) making the
use of specific nucleotide positions undesirable.
• The centromere is described as cen since this helps to recognize the derivative chromo­
some.
• Breakpoint junctions are designated by a double colon (::).
• Non-template sequences (inserts) at imperfect breakpoints are described using the format
-sequence::, e.g., ::AAGTAC::
• The presence of an additional sequence (marker/ring chromosome) is indicated by add.

To determine the location of the breakpoint, the general HGVS rule of maintaining the lon­
gest unchanged sequence applies (the 3' rule).

Application of the 3' rule to chromosome rearrangements:

chr2: TCAGC A CGTTGG
*der(2): TCAGC A tc t g c c
der(2): TCAGC a tc tgcc
der(X): c a gt t A CGTTGG
*der(X): c a g 11 a CGTTGG
chrX: c a g 11 a t c t g c c

A translocation joins chr2 (light shading) to chrX (dark shading). According to the chr2 and
chrX reference sequences (in bold) there are two options to align the breakpoints (shown in
normal and italic). Based on these, the translocation breakpoint for der(2) can be described as
either g.[chr2:6::chrX:7] or g.[chr2:5::chrX:6] (in italic) depending on whether the A is counted
as derived from chr2 or chrX. The 3' rule determines that, starting with the lowest chromosome
involved (here chr2), the sequence should be aligned as far 3' as possible. The A should there­
fore be counted as derived from chr2 and the correct description* of the breakpoint is therefore
g.[chr2:6::chrX:7]. Consequently, the der(X) breakpoint is described asg.[chrX:6::chr2:7].

126 Cytogenet Genome Res 2016;149:1-140 ISCN 2016

DOI: 10.1159/000445813
16.3 Examples of Sequence-Based Nomenclature for Description of Chromosome
Rearrangements

16.3.1 Deletions

seq[GRCh38] del(X)(q21.31q22.1)
chrX:g.89555676_100352080del
Based on genome build GRCh38, genomic reference sequence NC_000023.11, a deletion within the long arm
of one X chromosome from band Xq21.31 to band Xq22.1 has been identified. It includes the segment from
nucleotide 89,555,676 to nucleotide 100,352,080.

16.3.2 Derivative Chromosomes

seq[GRCh38] der(2)t(2; 11 )(p25.1 ;p 15.2)

g.[chr2:pter_8247756delinschrl l:pter_l 5825266]
A derivative chromosome 2 from a translocation between short arms of chromosomes 2 and 11 with break­
points at 2p25.1 and 1 Ipl 5.2 results in deletion of the first 8,247,756 nucleotides of chromosome 2 and an
extra copy of the first 15,825,266 nucleotides of chromosome 11, based on genome build GRCh38.

seq[GRCh37] der(3)(3pter->3q25.32::8q24.21-»8qter)
g.[chr3:158573187_qterdelinschr8:(128534000_128546000)_qter]
An unbalanced translocation between the long arms of chromosomes 3 and 8 results in a der(3) with an esti­
mated nucleotide range for the breakpoint on chromosome 8.

seq[GRCh37] der(4)ins(4;X)(q28.3;q22.2q21.31)
g.[chr4:134850793_134850794inschrX:89555676_100352080inv]
An unbalanced interchromosomal insertion with inserted sequence from the X chromosome reversed in ori­
entation relative to chromosome 4 sequence which contains the centromere.

seq[GRCh37] der(5)t(5;10)(pl3.3;q21.3)
g. [chr 5 :pter_29658442delinschr 10:6753999 5_qterin v]
An unbalanced translocation between the short arm of chromosome 5 and the long arm of chromosome 10
results in a der(5) chromosome. The segment including pter to nucleotide 29,658,442 of chromosome 5 has
been replaced by nucleotides 67,539,995 to qter from chromosome 10, which are present in an inverted ori­
entation relative to the orientation of the original sequence of chromosome 10. There is homology of 3 nucle­
otides at the break and reunion; following the 3' rule, the breakpoint is assigned to the most 3' nucleotide
within the region of homology in the derivative chromosome i.e. reunion between chromosome 10 nucleotide
67,539,995 (not 67,539,998) and chromosome 5 nucleotide 29,658,443 (not 29,658,440).

seq[GRCh37] der(6)t(6;13)(ql3.3;q31.1),der(13)t(6;13)(ql3.3;q31.1)inv(6)(ql4.3ql4.3)
g.[chr6:pter_cen_85897870::A::chrl3:80659609_qter]
g.[chrl3:pter_cen_80659606::chr6:85897899_85900540inv::85900541_86488291::
93909933_qter)
A complex rearrangement between chromosomes 6 and 13. There is a non-templated A inserted at the break­
point on the derivative chromosome 6. There is a 2-bp deletion of chromosome 13 material (80,659,607 to
80,659,608) and a 28-bp deletion (85,897,871 to 85,897,898) of chromosome 6 material at the breakpoint.
The derivative chromosome 13 has a 2,641-bp inversion (85,897,899 to 85,900,540) along with a 7.4-Mb de­
letion (86,488,292 to 93,909,932) of chromosome 6 material.

Sequence-Based Assays Cytogenet Genome Res 2016;149:1-140 127

DOI: 10.1159/000445813
16.3.3 Duplications

seq[GRCh37] dup(8)(q24.21q24.21)
chr8:g.l28746677_128749160dup
A 2,484-bp duplication within chromosome 8, reference sequence NC_000008.10, band q24.21 including
nucleotides 128,746,677 to 128,749,160 based on genome build GRCh37. The orientation of the duplicated
segment is the same as original.

seq[GRCh37] dup(8)(q24.21q24.21)
chr8:g. 128746677_128749160dupinv
A 2,484-bp duplication within chromosome 8, reference sequence NC_000008.10, band q24.21 including
nucleotides 128,746,677 to 128,749,160 based on genome build GRCh37. The orientation of the duplicated
segment is reversed relative to the original sequence.

16.3.4 Insertions

seq[GRCh37] ins(4;X)(q28.3;q21.31q22.2)
g.[chr4:134850793_134850794inschrX:89555676_100352080]
chrX:g.89555676_100352080del
A balanced interchromosomal insertion of chromosome X long arm material into the long arm of chromo­
some 4. The inserted sequence from the X chromosome is in the same orientation relative to chromosome 4
sequence which contains the centromere.

seq[GRCh37] ins(4;X)(q28.3;q22.2q21.31)
g.[chr4:l 34850793_l 34850794inschrX:89555676_100352080inv]
chrX:g.89555676_100352080del
A balanced interchromosomal insertion of chromosome X long arm material into the long arm of chromo­
some 4. The inserted sequence from the X chromosome is reversed in orientation relative to chromosome 4
sequence which contains the centromere.

16.3.5 Inversions

seq[GRCh37] inv(6)(pter->p25.3::ql6.1->p25.3::ql6.1->qter)
chr6:g.[776788_cen_93191545inv;93191546T>C]
A pericentric inversion in chromosome 6 with a single base substitution at the breakpoint.

seq[GRCh37] inv(2)(pter->p22.3::q31.1->p22.3::q31.1->qter)dn
chr2:g.[32310435.32310710del;323107 ll_171827243inv::G]
A de novo pericentric inversion in chromosome 2 with a 276-bp deletion and 1-bp insertion at the breakpoints.

seq[GRCh37] inv(6)(p21.2p22.3)
chr6:g.[20000000_40000000inv;40000001T>C]
A paracentric inversion in the short arm of chromosome 6 with a single base substitution at the breakpoint.

16.3.6 Ring Chromosomes

seq[GRCh37] r(8)(p23.2q24.3)
chr8 :g. [pter_3 300000del:: 140000000_qterdel]
A ring derived from chromosome 8 with breakpoints at band p23.2 and q24.3 joining nucleotide 3,300,001
to nucleotide 139,999,999, based on genome build GRCh37.

128 Cytogenet Genome Res 2016;149:1-140 ISCN 2016

DOI: 10.1159/000445813
 seq[GRCh37] +r(8)(p23.2q24.3)
chr8 :g. [pter_3 300000del:: 140000000_qterdel]add
A supernumerary ring derived from chromosome 8 with breakpoints at band p23.2 and q24.3 joining nucle­
otide 3,300,001 to nucleotide 139,999,999, based on genome build GRCh37.

16.3.7 T ranslocations

46,XX,t(2;ll)(p24;pl5.1).seq[GRCh38] t(2;lI)(p25.1;pl5.2)
g.[chrl l:pter_15825272::chr2:8247757_cen_qter]
g.[chr2:pter_8247756::chrl l:15825273_cen_qter]
A balanced translocation between the short arms of chromosomes 2 and 11. The breakpoints, at bands 2p24
and 1 Ipl 5.1 by banding, were further defined by sequencing to bands 2p25.1 and 1 Ipl 5.2. Based on genome
build GRCh38, there is joining of chromosome 11 nucleotide 15,825,272 to chromosome 2 nucleotide
8,247,757 on the derivative chromosome 2, and joining of chromosome 2 nucleotide 8,247,756 to chromo­
some 11 nucleotide 15,825,273 on the derivative chromosome 11.

seq[GRCh37] t(9;9)(9qter^9q22.33::9p21.2^9qter;9pter->9q22.33::9p21.2->9pter)
g.[chr9:102425452_qterinv::chr9:26393002_cen_qter]
g.[chr9:pter_cen_102425451::chr9:26393001_pterinv]
A balanced translocation between homologous chromosomes with breakpoints at 9p21.2 and 9q22.33.

seq[GRCh37] t(2; 1 l)(q31.1 ;q22.3)

g.[chr2:pter_cen_174500098::chrl 1:108111987_qter]
g.[chrl l:pter_cen_1081 11981::chr2:174500099_qter]
A translocation between the long arms of chromosomes 2 and 11. There is a 5-bp deletion of chromosome 11
sequence evident from the nucleotide numbers given for the two chromosome 11 breakpoints (108,111,981
and 108,111,987).

seq[GRCh37] t(3;14)(14qter->14ql2::3p22.2->3qter;14pter->14ql2::3p22.2->3pter)
g.[chrl4:29745314_qterinv::CATTTGTTCAAATTTAGTTCAAATGA::chr3:36969142_
cen_qter]
g.[chrl4:pter_cen_29745313::chr3:pter_36969141inv]
A translocation between the short arm of chromosome 3 and the long arm of chromosome 14, with insertion
of non-templated sequence at the breakpoint on the derivative chromosome 3.

Sequence-Based Assays Cytogenet Genome Res 2016;149:1-140 129

DOI: 10.1159/000445813
17 References

Caspersson T, Farber S, Foley GE, Kudynoski J, Modest EJ, Simonsson E, Wagh U, Zech L: Chemical differen­
tiation along metaphase chromosomes. Exp Cell Res 49:219-222 (1968).
Caspersson T, Lomakka G, Zech L: The 24 fluorescence patterns of human metaphase chromosomes - distingu­
ishing characters and variability. Hereditas 67:89-102 (1972).
Chicago Conference (1966): Standardization in Human Cytogenetics. Birth Defects: Original Article Series, Vol
2, No 2 (The National Foundation, New York 1966).
Cremer T, Landegent J, Bruckner A, Scholl HP, Schardin M, Hager HD, Devilee P, Pearson P, van der Ploeg M:
Detection of chromosome aberrations in the human interphase nucleus by visualization of specific target
DNAs with radioactive and non-radioactive in situ hybridization techniques: diagnosis of trisomy 18 with
probe LI.84. Hum Genet 74:346-352 (1986).
Denver Conference (1960): A proposed standard system of nomenclature of human mitotic chromosomes. Lancet
i:1063—1065 (1960).
Dutrillaux B: Obtention simultanee de plusieurs marquages chromosomiques sur les memes preparations, apres
traitement par le BrdU. Humangenetik 30:297-306 (1975).
Ford CE, Hamerton JL: The chromosomes of man. Nature 178:1020-1023 (1956).
Francke U: High-resolution ideograms of trypsin-Giemsa banded human chromosomes. Cytogenet Cell Genet
31:24-32 (1981).
Francke U: Digitized and differentially shaded human chromosome ideograms for genomic applications. Cyto­
genet Cell Genet 65:206-218 (1994).
Francke U, Oliver N: Quantitative analysis of high-resolution trypsin-Giemsa bands on human prometaphase
chromosomes. Hum Genet 45:137-165 (1978).
Guan XY, Meltzer PS, Trent JM: Rapid generation of whole chromosome painting probes (WCPs) by chromo­
some microdissection. Genomics 22:101-107 (1994).
ISCN (1978): An International System for Human Cytogenetic Nomenclature. Birth Defects: Original Article
Series, Vol 14, No 8 (The National Foundation, New York 1978); also in Cytogenet Cell Genet 21:309-404
(1978).
ISCN (1981): An International System for Human Cytogenetic Nomenclature - High Resolution Banding. Birth
Defects: Original Article Series, Vol 17, No 5 (March of Dimes Birth Defects Foundation, New York 1981);
also in Cytogenet Cell Genet 31:1-23 (1981).
ISCN (1985): An International System for Human Cytogenetic Nomenclature, Harnden DG, Klinger HP (eds),
Birth Defects: Original Article Series, Vol 21, No 1 (March of Dimes Birth Defects Foundation, New York
1985).
ISCN (1991): Guidelines for Cancer Cytogenetics, Supplement to An International System for Human Cytogene­
tic Nomenclature, Mitelman F (ed), (S Karger, Basel 1991).
ISCN (1995): An International System for Human Cytogenetic Nomenclature, Mitelman F (ed), (S Karger, Basel
1995).
ISCN (2005): An International System for Human Cytogenetic Nomenclature, Shaffer LG, Tommerup N (eds),
(S Karger, Basel 2005).
ISCN (2009): An International System for Human Cytogenetic Nomenclature, Shaffer LG, Slovak ML, Campbell
LJ (eds), (S Karger, Basel 2009).
ISCN (2013): An International System for Human Cytogenetic Nomenclature, Shaffer LG, McGowan-Jordan J,
Schmid M (eds), (S Karger, Basel 2012).

130 Cytogenet Genome Res 2016;149:1-140 ISCN 2016

DOI: 10.1159/000445813
Jhanwar SC, Burns JP, Alonso ML, Hew W, Chaganti RSK: Mid-pachytene chromomere maps of human auto­
somes. Cytogenet Cell Genet 33:240-248 (1982).
Kallioniemi A, Kallioniemi OP, Sudar D, Rutovitz D, Gray JW, Waldman F, Pinkel D: Comparative genomic
hybridization for molecular cytogenetic analysis of solid tumors. Science 258:818-821 (1992).
Landegent JE, Jansen in de Wai N, Dirks RW, Baao F, van der Ploeg M: Use of whole cosmid cloned genomic
sequences for chromosomal localization by non-radioactive in situ hybridization. Hum Genet 77:366-370
(1987).
Lichter P, Cremer T, Borden J, Manuelidis L, Ward DC: Delineation of individual human chromosomes in me­
taphase and interphase cells by in situ suppression hybridization using recombinant DNA libraries. Hum
Genet 80:224-234 (1988).
Lichter P, Tang CJ, Call K, Hermanson G, Evans GA, Housman D, Ward DC: High-resolution mapping of hu­
man chromosome 11 by in situ hybridization with cosmid clones. Science 247:64-69 (1990).
Liehr T, Claussen U, Starke H: Small supernumerary marker chromosomes (sSMC) in humans. Cytogenet Ge­
nome Res 107:55-67 (2004).
Liehr T, Starke H, Heller A, Kosyakova N, Mrasek K, Gross M, Karst C, Steinhaeuser U, Hunstig F, Fickelscher
I, et al: Multicolor fluorescence in situ hybridization (FISH) applied to FISH-banding. Cytogenet Genome
Res 114:240-244 (2006).
London Conference on the Normal Human Karyotype. Cytogenetics 2:264-268 (1963).
Magenis RE, Barton SJ: Delineation of human prometaphase paracentromeric regions using sequential GTG-
and C-banding. Cytogenet Cell Genet 45:132-140 (1987).
Newman S, Hermetz KE, Weckselblatt B, Rudd K: Next-generation sequencing of duplication CNVs reveals that
most are tandem and some create fusion genes at breakpoints. Am J Hum Genet 96:208-220 (2015).
Ordulu Z, Wong KE, Currall BB, Ivanov AR, Pereira SA, Gusella JF, Talkowski ME, Morton CC: Describing
sequencing results of structural chromosome rearrangements with a suggested next-generation cytogenetic
nomenclature. Am J Hum Genet 94:1-15 (2014).
Paris Conference (1971): Standardization in Human Cytogenetics. Birth Defects: Original Article Series, Vol 8,
No 7 (The National Foundation, New York 1972); also in Cytogenetics 11:313-362 (1972).
Paris Conference (1971), Supplement (1975): Standardization in Human Cytogenetics. Birth Defects: Original
Article Series, Vol 11, No 9 (The National Foundation, New York 1975); also in Cytogenet Cell Genet 15:
201-238 (1975).
Parra I, Windle B: High resolution visual mapping of stretched DNA by fluorescent hybridization. Nat Genet 5:
17-21 (1993).
Patau K: The identification of individual chromosomes, especially in man. Am J Hum Genet 12:250-276 (1960).
Pinkel D, Landegent J, Collins C, Fuscoe J, Segraves R, Lucas J, Gray JW: Fluorescence in situ hybridization
with human chromosome-specific libraries: detection of trisomy 21 and translocations of chromosome 4. Proc
Natl Acad Sci USA 85:9138-9142 (1988).
Pinkel D, Segraves R, Sudar D, Clark S, Poole I, Kowbel D, Collins C, Kuo WL, Chen C, Zhai Y, et al: High re­
solution analysis of DNA copy number variation using comparative genomic hybridization to microarrays.
Nat Genet 20:207-211 (1998).
Schluth-Bolard C, Labalme A, Cordier M-P, Till M, Nadeau G, Tevissen H, Lesda G, Boutry-Kryza N, Rossignol
S, Rocas D, et al: Breakpoint mapping by next generation sequencing reveals causative gene disruption in
patients carrying apparently balanced chromosome rearrangements with intellectual deficiency and/or con­
genital malformations. J Med Genet 50:144-150 (2013).
Stephens PJ, Greenman CD, Fu B, Yang F, Bignell GR, Mudie LJ, Pleasance ED, Lau KW, Beare D, Stebbings
LA, et al: Massive genomic rearrangement acquired in a single catastrophic event during cancer development.
Cell 144:27-40 (2011).
Tjio JH, Levan A: The chromosome number of man. Hereditas 42:1-16 (1956).
Trask BJ: Fluorescence in situ hybridization: applications in cytogenetics and gene mapping. Trends Genet 7:
149-154(1991).
Viegas-Pequignot E, Dutrillaux B: Une methode simple pour obtenir des prophases et des prometaphases. Annis
Genet 21:122-125 (1978).
Wiegant J, Kalle W, Mullenders L, Brookes S, Hoovers JM, Dauwerse JG, van Ommen GJ, Raap AK: High-re­
solution in situ hybridization using DNA halo preparations. Hum Mol Genet 1:587-591 (1992).
Wiegant J, Wiesmeijer CC, Hoovers JM, Schuuring E, d’Azzo A, Vrolijk J, Tanke HJ, Raap AK: Multiple and
sensitive fluorescence in situ hybridization with rhodamine-, fluorescein-, and coumarin-labeled DNAs. Cy­
togenet Cell Genet 63:73-76 (1993).
Wyandt HE, Tonk VS (eds): Atlas of Human Chromosome Heteromorphisms (Springer, New York 2008).
Yunis JJ: High resolution of human chromosomes. Science 191:1268-1270 (1976).
Yunis JJ, Sawyer JR, Ball DW: The characterization of high-resolution G-banded chromosomes of man. Chro­
mosoma 67:293-307 (1978).

References Cytogenet Genome Res 2016;149:1-140 131

DOI: 10.1159/000445813
18 Members of the ISCN Standing Committee
and Advisors

Members of the Standing Committee

Jaclyn Biegel Department of Pathology and Laboratory Medicine

Children’s Hospital Los Angeles
Los Angeles, Calif., USA

Myriam Chaabouni Faculte de Medecine Tunis

Laboratory of Human Genetics
Tunis, Tunisia

Johan T. den Dunnen Clinical Genetics and Human Genetics

Leiden University Medical Center
Leiden, The Netherlands

Jin-Yeong Han Department of Laboratory Medicine

Dong-A University College of Medicine
Busan, South Korea

Nils Mandahl Department of Clinical Genetics

University and Regional Laboratories
Lund University
Lund, Sweden

Jean McGowan-Jordan (Chair) Genetics Diagnostic Laboratory

Children’s Hospital of Eastern Ontario
Department of Pathology and Laboratory Medicine
University of Ottawa
Ottawa, Ont., Canada

Kathleen W. Rao Department of Pediatrics, Cytogenetics Laboratory

University of North Carolina School of Medicine
Chapel Hill, N.C., USA

Annet Simons Department of Human Genetics, Laboratory of Tumor Genetics

Radboud University Medical Center
Nijmegen, The Netherlands

Advisors to the Committee

Cynthia Morton Departments of Obstetrics and Gynecology and of Pathology

Brigham and Women’s Hospital, Harvard Medical School
Boston, Mass., USA

Michael Schmid Department of Human Genetics

University of Wurzburg
Wurzburg, Germany

132 Cytogenet Genome Res 2016;149:1-140 ISCN 2016

DOI: 10.1159/000445813
Acknowledgements

The 2014 Committee meeting and ISCN (2016) publication were made possible by generous
contributions from Karger Publishers. The Committee gratefully acknowledges Martina Gut-
tenbach, University of Wurzburg, Germany, for her copy editing and members of the cytoge­
netics community for their suggestions and examples.

Members of the ISCN Standing Cytogenet Genome Res 2016;149:1-140 133

Committee and Advisors DOI: 10.1159/000445813
19 Appendix

Diagrammatic representation of human chromosome bands as observed with the Q-, G-, and
R-staining methods; centromeric regions are representative of Q-staining method only (Paris
Conference, 1971).

7 8 9 10 11 12

134 Cytogenet Genome Res 2016;149:1-140 ISCN 2016

DOI: 10.1159/000445813
 Negative or pale staining 'Q' & 'G' bands
Positive 'R' bands

Positive 'Q' & 'G' bands

Negative 'R' bands

Variable bands

Appendix Cytogenet Genome Res 2016;149:1-140 135

DOI: 10.1159/000445813
20 Index

Abnormality, acquired 40, 55, 91, 113 Brackets, angle 34, 54

additional material 34, 59, 126 square 34, 38, 85, 88, 106, 115, 125
alternative interpretation 48 Break, chromatid 81
autosomal 56 chromosome 40, 82
clonal 84, 88 isochromatid 82
constitutional 40, 55, 90, 113 isolocus 82
nonclonal 84 Break-apart probes 111
numerical 38, 50, 54, 55 Breakpoint, designation 40, 126
order 37,50,116,126 uncertainty 48, 126
sex chromosome 55, 90, 116
structural 38, 40, 42, 58, 101 C-band 8,13,14,92
Abnormally banded region 68 Centromere, designation 11,43,126
Acentric fragment 34, 72, 81, 82 fission 35, 67
Achromatic lesion 81,82 index 7
Acquired abnormality 40, 55, 91, 113 premature division 35, 83
Additional material 34, 59, 126 suppressed 66
Adjacent, segregation 44 Chiasma, abbreviation 36, 93
signal 109 frequency 93
Alternative interpretation 48 interstitial 93
Amplification 110, 112 location 93
Anaphase 34, 92 Chimera 34, 38
Aneuploid 90 Chromatid, break 81
Angle brackets 34, 54 deletion 82
Approximate sign 34, 38, 48, 120 exchange 81, 82
Arab ic numb er 71,74 gap 81
Arm ratio 7 interchange 81
Array-based CGH 115 intrachange 81
Arrow 34, 43 inversion 82
Association, telomeric 36, 74 Chromatin, fiber 100,112
Autosomal abnormality 56 X 9
Y 9
Bacterial artificial chromosome (BAC) 115 Chromosome, band 8, 9, 14, 43
Balanced rearrangement 45,77,124 break 40,42,82
Band, definition 8, 9 derivative 34, 44, 51, 60, 71, 77, 127
designation 11,43 dicentric 34, 65, 73, 79
high resolution 12 double minute 35, 71, 82
interface 40, 68 exchange 77, 82
interval 48 gap 82
landmarks 9, 15 group 7
Banding, high resolution 12 homologous 37, 64, 75
molecular basis 14 in situ hybridization 101
technique 8, 12 iso 35, 70
Bivalent 92, 93, 95 isoderivative 35, 63

136 Cytogenet Genome Res 2016;149:1-140 ISCN 2016

DOI: 10.1159/000445813
 isodicentric 35, 65, 70 Designation, band 11, 43
landmark 9, 15 breakpoint 40
marker 35, 44, 70, 83, 126 centromere 11,43
meiotic 92 locus 101
minute 82 region 9, 11
morphology 7 sub-band 11
nomenclature 9 Detailed system 40, 42
normal missing 38,58 Diakinesis 34, 93
number 7, 90 Dicentric chromosome 34, 65, 73, 79
order in karyotype 7 Dictyotene 35, 93
paint 36, 114 Diminished 34, 105, 113
Philadelphia 35, 62 Diploid 90
premature condensation 83 Diplotene 35, 93
pseudodicentric 66 Disomy, uniparental 36, 57, 121
pseudotricentric 66 Distal 35,93
pulverization 82 DNA, fiber 112
range 48,71,90 gain 117
recombinant 36, 45, 46, 60 loss 117
region 9 Double minutes 35, 71, 82
ring 36, 72, 128 Dual fusion probes 109, 110
sub-band 11 Duplication 35, 67, 128
tricentric 36, 73, 79
uncertainty 38, 47 Endoreduplication 35, 39
unknown origin 59, 70 Enhanced 35, 105, 113
Chromothripsis 34, 82, 122 Equal sign 35, 93
Clone, criteria 84 Euploid 90
definition 84 Exchange, asymmetrical 81
evolution 84, 86 chromatid 81, 82
frequency 84 chromosome 82
normal 38, 89 complete 81
order 86, 89 incomplete 81
polyploid 86 sister chromatid 36,81
presentation 38, 86, 89 symmetrical 81
related 86
size 85 Fiber, chromatin 100,112
unrelated 89 DNA 112
Code, banding technique 14 extended 112
Colon, double 34, 43, 126 FISH, see In situ hybridization
single 34, 43 Fission, centric 35, 67
Comma 34, 37, 106, 116 Four-break rearrangement 42,76
Comparative genomic hybridization 34, 113 Fragile site 35, 53, 67
Complete exchange 81 Fragment, acentric 34, 72, 81, 82
Complex, array results 122 Fusion, centric 78
interchange 81 genes 124
rearrangement 34, 42, 76 probes 111
Composite karyotype 34, 88
Connected signal 34,109 Gap, chromatid 81
Constitutional abnormality 55, 90, 113 chromosome 82
Constitutional karyotype 90 isochromatid 82
Copy number 106,113,116,123 isolocus 82
Curly braces 34, 126 G-band 8,10,14,16,30
Genome build 41,115,123,125
Decimal point 11, 34
Definition, band 8, 9 Haploid 12,90
landmark 9, 15 Heptapioid 90
region 9 Heterochromatin 8, 35, 52, 53
sub-band 11 Heterogeneity 88
Deletion 60, 127 Heteromorphism 12
chromatid 82 Heterozygosity 35, 121
interstitial 60 Hexapioid 90
terminal 60 High resolution banding 12
De novo 35,40,117 History of ISCN 1
Derivative chromosome 34, 44, 51, 60, 71, 7 , Homogeneously staining region 35,68

Cytogenet Genome Res 2016;149:1-140 137

Index DOI: 10.1159/000445813
Homologous chromosomes 37, 64, 75 Microarray 115
single underlining 37, 64, 75 nomenclature 116
Homozygosity 35, 121 Minus sign 35, 38, 52, 54, 92, 101
Human Genome Variation Society (HGVS) 115, 125 Minute 82
Hybridization, comparative genomic 34, 113 double 35,71,82
in situ 35,100 Modal number 90
Hyperdiploid, -triploid, -tetrapioid 90 Mosaicism 38
Hypodiploid, -triploid, -tetrapioid 90 Multi-color chromosome painting 114
Multiple copies 35, 38, 71, 79
Idem 35,86 Multiplex ligation-dependent probe
Identification, questionable 36, 47 amplification (MLPA) 123
Idiogram 7, 16, 96 Multiplication sign 35, 38, 79, 86, 101, 105, 106
Incomplete, exchange 81 Multivalent 92
karyotype 35, 48
Inherited 35, 39 Near-diploid 90
Insertion 35, 68, 128 Near-haploid 90
In situ hybridization, comparative 113 Neocentromere 35, 72
extended fiber 112 Neoplasia 84
fluorescence 100 Nomenclature, chromosome band 9
interphase 106 meiotic 93
metaphase 101, 106 microarray 116
nuclear 35, 106 region-specific assay 123,124
prophase 101 sequence-based 127
reverse 113 SNP array 121
Interchange, chromatid 81 Nonclonal aberration 84
Interpretation, alternative 35, 48 NOR-band 8, 12
Interstitial, chiasma 93 Normal karyotype 37
deletion 60, 127 Number of cells, designation 85
Interval 48 Numeral, Arabic 71, 74
Intrachange, chromatid 81 Roman 36, 92
Inversion 69, 128 Numerical abnormality 38, 50, 54
chromatid 82
paracentric 70 Octaploid 90
pericentric 45, 46, 70 Oligonucleotides 115
Isochromatid, break 82 Oogonial metaphase 35,93
gap 82 Or 35,38,48
Isochromosome 35, 70 Order, abnormalities 37, 50, 116, 126
Isoderivative chromosome 35,63 clones 38, 85, 89
Isodicentric chromosome 35, 65, 70 karyotype 50
Isolocus, break 82
gap 82 Pachytene 35, 93, 95, 96
diagram 43
Jumping translocation 79 Paint, partial chromosome 35,114
whole chromosome 36,102
Karyotype, composite 34, 88 Paracentric inversion 70
constitutional 90 Parentheses 35,37,41,81,92,106,126
definition 7 Partial chromosome paint 35, 114
designation 37 Paternal origin 35, 39, 117
incomplete 48 Pentapioid 90
normal 37 Pericentric inversion 45, 46, 70
Karyotypic heterogeneity 88 Period 35, 101, 107, 108, 118, 125
Philadelphia chromosome 35, 62
Landmark 9,15,96 Ploidy level 34, 39, 54, 90
Leptotene 35, 93 Plus sign, double 36, 101
Level of ploidy 34, 39, 54, 90 single 36, 38, 52, 54, 71, 86, 92, 93, 101
List of abbreviations 14, 34, 93 Polyploid 39, 86, 90
Locus designation 101 Premature centromere division 35, 83
Loss of heterozygosity 121 Premature chromosome condensation 35, 83
Proximal 36, 93
Marker chromosome 35, 44, 70, 83, 126 Pseudodicentric, -tricentric 66
Maternal origin 35, 39, 117 Pseudodiploid, -triploid 90
Medial 35, 93 Pulverization 36, 82
Meiotic chromosomes 92

138 Cytogenet Genome Res 2016;149:1-140 ISCN 2016

DOI: 10.1159/000445813
Q-band 8, 9, 14 Slant line, double 36, 38, 108
Quadriradial 36, 81 single 36, 38, 84, 101, 106
Quadrivalent 92 Spermatogonial metaphase 36, 93
Quadruplication 36, 72 Square brackets 34, 38, 85, 88, 106, 115, 125
Questionable identification 36, 47 Stemline 36, 86
Question mark 36, 38, 47, 59, 64 Sub-band 10,11
Subclone 84
R-band 8,11,14,32 Subtelomeric region 106
Rearrangement, balanced 45, 77, 124 Suppressed centromere 66
complex 34, 42, 76, 122 Symbols, list 14, 34, 93
four-break 42, 76
three-break 41, 75 T-band 8
two-break 41, 75 Telomeric association 36, 74
Reciprocal translocation 43,75 Terminal 93
Recombinant chromosome 36, 45, 46, 60 Terminal deletion 60
Region-specific assay 123 Tetrapioid 54, 90
Region, abnormally banded 68 Three-break rearrangement 41,75
definition 9 Translocation 75, 129
homogeneously staining 35, 68 balanced 75, 124
Ring chromosome 36,72,128 complex 76
dicentric 73 jumping 79
monocentric 73 reciprocal 43, 75, 129
tricentric 7 3 Robertsonian 36, 78
Robertsonian translocation 36, 78 segregation 44
Roman numeral 36, 92 whole-arm 77
3'Rule 126 Tricentric chromosome 36, 73, 79
Triplication 79
Satellite 36, 52 Triploid 90
Satellite stalk 36, 52 Triradial 36, 81
Semicolon 36, 37, 41, 92 Trivalent 92
Separated signal 36,109,110 Two-break rearrangement 41,75
Sequencing 36, 125
Sex, chromatin 9 Uncertainty, breakpoint localization 48, 126
chromosome abnormality 55, 90, 116 chromosome number 48
Short system 41 Underlining 36, 37, 64, 75
Sideline 36, 86 Underscore 36, 123, 126
Sign, approximate 34, 38, 48, 120 Uniparental disomy 36, 57, 121
equal 35, 93 Univalent 92
minus 35, 38, 52, 54, 92, 101 Unknown material 59
multiplication 35, 38, 79, 86, 101, 105, 106 Unrelated clones 89
plus 36,38,52,54,71,86,92,93,101
Signal, adjacent 109 Variable chromosome region 8, 13, 36, 53
amplified 110, 111, 112
connected 34, 109 Whole-arm translocation 77
intensity 105, 113 Whole chromosome paint 36,102
number 106
position 109 X-chromatin 9
separated 36, 109, 110
Single fusion probes 111 Y-chromatin 9
Single nucleotide polymorphism (SNP) 115, 121
Sister chromatid exchange 36, 81 Zygotene 36, 93

Index Cytogenet Genome Res 2016;149:1-140 139

DOI: 10.1159/000445813
The Normal Human Karyotype G- and R-bands

Photographs of G- and R-banded human metaphase chromosomes and their diagrammatic repre­
sentations (approximately 550-band stage). The diagrams are identical in the position and width of
bands to those of the basic diagram (Fig. 5). For the G-band diagram (left) the G-positive bands have
been shaded to match the intensity of the chromosomal bands in the photographs. In the case of the
R-band diagram (right) the R-positive bands have been shaded to match the photographs. In both
cases the negative bands are uniformly white. For convenience and clarity, only the G-positive bands
are numbered. For the full numbering refer to Fig. 5. (Modified from ISCN 1985).

The G-banded photographs are taken, with permission from Francke, Cytogenet Cell Genet 31:24 (1981) and the R-banded
photographs were provided by Dr. M. Prieur, with the assistance of her technicians, in the laboratory of Professor M. Veke-
mans, Hopital Necker, Enfants Malades, Paris.
6 8 9

13 14 15

19 20 21
 10 11 12

16 17 18

22
X
ISCN
An International System for
Human Cytogenomic Nomenclature (2016)
2016

The 2016 edition of the International System for Human Cytogenomic Nomenclature
(ISCN 2016) offers standard nomenclature that is used to describe'any genomic rear­
rangement identified by techniques ranging from karyotyping to FISH, microarray, vari­
ous region-specific assays, and DNA sequencing. Suggestions from the international
cytogenetics community have been reviewed by the Standing Committee, an interna­
tional group of experts, nominated by their peers.

This updated edition offers:

• many new examples, particularly for microarray and region-specific assays
• trackable changes in the main text compared to the previous edition for easier identi­
fication
• a nomenclature standard to facilitate the description of chromosome rearrangements
characterized by DNA sequencing developed through collaboration between the
Human Genome Variation Society (HGVS) and ISCN to accommodate the increased
use of sequencing technologies in the characterization of chromosomal abnormalities

The ISCN 2016 is an indispensable reference volume for human cytogeneticists, molecu­
lar geneticists, technicians, and students for the interpretation and communication of
human cytogenetic and molecular cytogenomic nomenclature.

After a long collaboration with Cytogenetic and Genome Research, ISCN is now again
part of this leading journal on chromosome and genome research, combining day-to-
day business with the latest findings.

ISCN 2016
An International System for Human Cytogenomic Nomenclature (2016)
Editors: JeanMcGowan-Jordan, Ottawa, Ont.; Annet Simons, Nijmegen; Michael Schmid, Wurzburg
VI + 140 p., 10 fig., 4 tab., soft cover + foldout, 2016. ISBN 978-3-318-05857-4
Reprint of Cytogenetic and Genome Research (ISSN 1424-8581), Vol. 149, No. 1-2,2016

KARGER. 9H783318 058574