Thanks to visit codestin.com
Credit goes to www.scribd.com

0% found this document useful (0 votes)
18 views8 pages

Zhao 2015

This research investigates the expression and resistance mechanisms of arsenic multi-operons in Rhodopseudomonas palustris CGA009, a model organism for arsenic detoxification. The study found that the ars2 and ars3 operons are differentially regulated based on environmental arsenite concentrations, with ars2 being expressed at lower concentrations. The findings suggest that R. palustris detoxifies arsenic through reduction and methylation mechanisms, particularly at higher arsenic concentrations.

Uploaded by

toanb2107608
Copyright
© © All Rights Reserved
We take content rights seriously. If you suspect this is your content, claim it here.
Available Formats
Download as PDF, TXT or read online on Scribd
0% found this document useful (0 votes)
18 views8 pages

Zhao 2015

This research investigates the expression and resistance mechanisms of arsenic multi-operons in Rhodopseudomonas palustris CGA009, a model organism for arsenic detoxification. The study found that the ars2 and ars3 operons are differentially regulated based on environmental arsenite concentrations, with ars2 being expressed at lower concentrations. The findings suggest that R. palustris detoxifies arsenic through reduction and methylation mechanisms, particularly at higher arsenic concentrations.

Uploaded by

toanb2107608
Copyright
© © All Rights Reserved
We take content rights seriously. If you suspect this is your content, claim it here.
Available Formats
Download as PDF, TXT or read online on Scribd
You are on page 1/ 8

ORIGINAL RESEARCH

published: 17 September 2015


doi: 10.3389/fmicb.2015.00986

Insights into arsenic multi-operons


expression and resistance
mechanisms in Rhodopseudomonas
palustris CGA009
Chungui Zhao 1*, Yi Zhang 1 , Zhuhua Chan 1, 2 , Shicheng Chen 3* and Suping Yang 1*
1
Department of Bioengineering and Biotechnology, Huaqiao University, Xiamen, China, 2 State Key Laboratory Breeding
Base of Marine Genetic Resource, Third Institute of Oceanography, State Oceanic Administration, Xiamen, China,
3
Department of Microbiology and Molecular Genetics, Michigan State University, East Lansing, MI, USA
Edited by:
Weiwen Zhang,
Tianjin University, China
Arsenic (As) is widespread in the environment and causes numerous health problems.
Reviewed by:
Rhodopseudomonas palustris has been regarded as a good model organism for
Patrick Hallenbeck, studying arsenic detoxification since it was first demonstrated to methylate environmental
University of Montreal, Canada
arsenic by conversion to soluble or gaseous methylated species. However, the detailed
Lei Chen,
Tianjin University, China arsenic resistance mechanisms remain unknown though there are at least three
Joseph Kuo-Hsiang Tang, arsenic-resistance operons (ars1, ars2, and ars3) in R. palustris. In this study, we
Arizona State University, USA
investigated how arsenic multi-operons contributed to arsenic detoxification in R.
*Correspondence:
Chungui Zhao and Suping Yang,
palustris. The expression of ars2 or ars3 operons increased with increasing environmental
Department of Bioengineering and arsenite (As(III)) concentrations (up to 1.0 mM) while transcript of ars1 operon was not
Biotechnology, College of Chemical
detected in the middle log-phase (55 h). ars2 operon was actively expressed even at the
Engineering, Huaqiao University, 668
Jimei Avenue, Xiamen 361021, China low concentration of As(III) (0.01 µM), whereas the ars3 operon was expressed at 1.0 µM
[email protected]; of As(III), indicating that there was a differential regulation mechanism for the three arsenic
[email protected];
Shicheng Chen,
operons. Furthermore, ars2 and ars3 operons were maximally transcribed in the early
Department of Microbiology and log-phase where ars2 operon was 5.4-fold higher than that of ars3 operon. A low level of
Molecular Genetics, Michigan State
ars1 transcript was only detected at 43 h (early log-phase). Arsenic speciation analysis
University, East Lansing, MI 48863,
USA demonstrated that R. palustris could reduce As(V) to As(III). Collectively, strain CGA009
[email protected] detoxified arsenic by using arsenic reduction and methylating arsenic mechanism, while
the latter might occur with the presence of higher concentrations of arsenic.
Specialty section:
This article was submitted to Keywords: Rhodopseudomonas palustris, operons, arsenic resistance, regulation
Microbial Physiology and Metabolism,
a section of the journal
Frontiers in Microbiology
Introduction
Received: 23 April 2015
Accepted: 04 September 2015 Arsenic (As) is a highly toxic, carcinogenic, clastogenic and teratogenic metalloid (Slyemi and
Published: 17 September 2015 Bonnefoy, 2012). Arsenic occurs primarily as inorganic forms of pentavalent arsenate As(V)
Citation: and trivalent arsenite As(III), with the latter being regarded as the most mobile and toxic form
Zhao C, Zhang Y, Chan Z, Chen S and (Yang et al., 2012). Arsenicals generated from natural and anthropogenic sources are the widely
Yang S (2015) Insights into arsenic
distributed contaminants of freshwater, groundwater and seawater (Stolz et al., 2010; Slyemi and
multi-operons expression and
resistance mechanisms in
Bonnefoy, 2012; Rodríguez-Lado et al., 2013). Combustion of fossil fuels, mining, and applications
Rhodopseudomonas palustris of arsenic-containing pesticides/herbicides account for most of the arsenic pollution sources (Stolz
CGA009. Front. Microbiol. 6:986. and Oremland, 1999). Microorganisms are the principal drivers of arsenic chemical speciation
doi: 10.3389/fmicb.2015.00986 by redox transformations and influence arsenic mobility and toxicity. Most of bacteria and

Frontiers in Microbiology | www.frontiersin.org 1 September 2015 | Volume 6 | Article 986


Zhao et al. Molecular regulation of multiple arsenic operons

archaea virtually carry arsenic-resistance (ars) genes that (iii) to analyze the arsenic speciation in anoxygenic phototrophic
potentially confer resistance to As(V) and/or As(III) (Jackson bacteria by using R. palustris CGA009 as a model organism; (iv)
and Dugas, 2003). The phenomenon (widespread occurrence to propose a working model for arsenic resistance in R. palustris
of ars genes) indicates the ubiquitous distribution of this toxic CGA009.
metalloids in nature.
Some of microorganisms have a significant impact on the Materials and Methods
biogeochemical transformations of arsenic and are considered
as bioremediation reagents for arsenic contamination (Zhang Bacterial Strains, Media, and Growth Conditions
et al., 2015). Increasing interests have been drawn to investigate R. palustris CGA009 (ATCC BAA-98) was obtained from the
microbial detoxification of arsenic compounds, particularly to American Type Culture Collection (ATCC, USA). Bacteria
study the arsenic metabolic mechanisms. Furthermore, some were anaerobically grown in modified Ormerod medium at
microorganisms such as chemoautotrophic arsenite oxidizers 30◦ C with continuous illumination (Zhao et al., 2011). Briefly,
oxidize As(III) to As(V) to gain energy for cell growth when fixing ammonium sulfate and DL-malic acid were substituted by 10 mM
inorganic carbon (CO2 ). Instead, microbes that use As(V) as an of ammonium chloride, 30 mM of sodium acetate, 10 mM of
electron acceptor in anaerobic respiration lead to the production sodium succinate, 10 mM of sodium pyruvate, 10 mM of sodium
of As(III), indicating that arsenic plays various roles in microbial malate, 10 mM of sodium bicarbonate and 0.1% yeast extract
metabolism (Heinrich-Salmeron et al., 2011; Kruger et al., 2013). (Oxoid, UK), pH 6.8.
Arsenic metabolism and its genetic determinants have been
investigated in many Gram-positive and Gram-negative bacteria Arsenic Resistance Determination
(Kruger et al., 2013). Bacteria acquired several different arsenic- Cells in the log-phase were dispensed into 20-ml screw cap test
metabolic strategies including arsenite oxidation (aio system) tube. Various concentrations of Na3 AsO4 ·12H2 O and NaAsO2
in arsenite oxidizers which oxidize As(III) to As(V) (Oremland (Merck, Germany) were added with final concentrations ranging
and Stolz, 2003; Heinrich-Salmeron et al., 2011), anaerobic from 0.5 to 6.0 mM and ranging from 0.5 to 2.5 mM, respectively.
arsenate respiration (arr system) in arsenate-reducing microbes Cell growth was estimated by measuring the optical density at
which respire and reduce As(V) to As(III) (Oremland and Stolz, 660 nm (OD660 ) after incubation anaerobically at 30◦ C and with
2003; Páez-Espino et al., 2009), arsenate system (ars system) 2500 lux light for 4 days (Carius et al., 2013). The starting OD660
in arsenate-resistant microbes which reduce cytoplasmic toxic was 0.09. The growth index was defined as the median effective
As(V) to As(III) (Oremland and Stolz, 2003; Kruger et al., 2013), concentration (EC50 ) and was used to assess the arsenic tolerance
and arsenic methylation (arsM system) in arsenic methylating in R. palustris.
bacteria which convert inorganic arsenic into methylated arsenic
(Qin et al., 2006; Kruger et al., 2013; Zhang et al., 2015). Determination of Arsenic Speciation
Arsenic-metabolic genes are assembled with multiple arsenic The process of determination of arsenic speciation as described
operons in some bacteria. For example, both arr and ars previously (Lin et al., 2014). Freeze-dried samples were extracted
operons are found in Shewanella sp. (Saltikov and Newman, with 10 ml of 1% nitric acid (Merck, Germany) in a microwave-
2003); Thiomonas sp. possess two operons (aio and ars system) accelerated reaction system (CEM Microwave Technology, UK).
(Arsène-Ploetze et al., 2010); Herminiimonas arsenicoxydans has This system was provided with a stably increasing temperature
aio and ars (Muller et al., 2007); Cyanidioschyzon sp. 5508 from 55 to 75◦ C within 10 min. Then the extracts were
has aio, arr, and ars operons (including arsM) (Qin et al., heated at 95◦ C for 30 min. Finally, the extracted solutions
2009). Arsenic-resistant microorganisms possibly benefited from were centrifuged and passed through a nylon filter with a size
multiple arsenic-resistance operons, e.g., they can utilize different of 0.22 µm. Arsenic speciation of cells was determined using
detoxification strategies under the complex environments. the high-performance liquid chromatography (HPLC) (Agilent
With extraordinary metabolic versatility, R. palustris has 1200, Japan) coupled with inductively-coupled plasma mass
been widely studied for wastewater treatment, bioremediation, spectrometry (ICP-MS) (Agilent 7500cx, USA) as described
hydrogen production and electricity generation (Zhao et al., previously (Lin et al., 2014). The mobile phases consisted of
2011; Fu et al., 2014; Liu et al., 2015). R. palustris is possibly 6.67 mM of NH4 H2 PO4 (Merck, Germany) and 6.67 mM of
exposed to a high concentration of arsenic under the above NH4 NO3 (Merck, Germany) at pH 6.2. Arsenic speciation in the
field application conditions. Despite considerable research on the samples were identified by comparing their retention times to
arsenic-metabolic mechanisms in chemotrophic bacteria, only the standards including arsenite, arsenate, dimethylarsinic acid
few studies have been conducted in anoxygenic phototrophic (DMA) (Chem Service, PA, USA) and monomethylarsonic acid
bacteria. R. palustris CGA009 has three arsenic-resistance (MMA) (Beijing Chemicals, China).
operons (ars1, ars2, and ars3) in the chromosome (Qin et al.,
2006). Deciphering the arsenic resistance mechanism(s) in Molecular Manipulation
anoxygenic phototrophic bacteria may facilitate engineering Genomic DNA was extracted using the One-4-all Genomic DNA
stronger arsenic resistant strains with desirable features in Mini-Preps Kit (Sangon, China). Total RNA was extracted and
industrial applications. The objectives of the present study were
as follows: (i) to examine the arsenic resistance capacity; (ii) to

purified by using an EasyPure RNA Kit (TransGen, China).
The contaminating DNA was removed by DNase I procedure
exam the differential regulation of the three arsenic operons; (Takara, China) if necessary. DNA-free RNA samples were

Frontiers in Microbiology | www.frontiersin.org 2 September 2015 | Volume 6 | Article 986


Zhao et al. Molecular regulation of multiple arsenic operons

confirmed by PCR amplification of the house-keeping gene gyrB For each transcript, the CT value was converted to a genomic
(encoding DNA gyrase subunit B) with the forward primer DNA equivalent in copies by comparing the CT of an unknown
gyrBF (AACTGAACGGCATTATGG) and the reverse primer sample to standard curves (prepared by using CGA009 genomic
gyrBR (GGGATGTTGTTGGTGAAG). cDNAs were synthesized DNA).

using an PrimeScript II 1st strand cDNA synthesis kit (Takara,
China) following the protocol. Prior to quantitative PCR, cDNAs Results and Discussion
were diluted 10-fold as template in nuclease-free water.
Functional genes arsB, arsC2 and arsM were chosen as Effects of As(V) (0.5∼6.0 mM) and As(III) (0.5∼2.5 mM) on
representative genes for ars1, ars2, and ars3 operons in this study, the bacterial growth of R. palustris were tested in modified
respectively. arsB was amplified with arsBF (GCTGATCGTTTC Ormerod medium and under anaerobic–light conditions
CAACCT) and arsBR (ACCATCACCGAGGCATAA); arsC2 (Figure 1). Negligible difference was observed between the
was amplified with arsCF (CGGGCACTTCAGATACTC) and culture supplemented with 0.5 mM of As(V) and the control (no
arsCR (CGTCGTCATCTATCACAAC); arsM was amplified with AS(V)), indicating that a low concentration of As(V) was not
arsMF (CCGACAGGTTGATGACGCAGT) and arsMR (CGT toxic to R. palustris. The cells could retain at least 60, 70, and
CGTCATCTATCACAAC). gyrB gene was used to normalize the 80% of the control growth when 3.0 mM, 2.0 mM and 1.0 mM
expression for arsB, arsC2, and arsM as described by Saltikov of As(V) were added to the culture respectively, indicating a
et al. (2005). General PCR experiments were conducted in a good resistance to As(V). However, higher concentrations of
T-100 Thermal Cycler (Bio-Rad). Quantitative real-time PCR As(V) (i.e., 4.0 mM to 6.0 mM) severely inhibited the bacterial
was carried out in the Applied Biosystems 7300 Real-Time PCR growth with the most significant inhibition (nearly 100%) at
System (Life Technologies). The cycle thresholds (CT ) were the concentration of 6.0 mM. R. palustris was more sensitive to
determined for samples and genomic DNA standards. Diluted environmental As(III) than that in As(V) as shown in Figure 1B.
CGA009 genomic DNA was used as standard for quantification. For example, 2.0 mM and 2.5 mM of As(III) inhibited up to 90

FIGURE 1 | Growth curves of R. palustris CGA009 in the presence of different concentrations of arsenate (A) and arsenite (B), respectively. Strain
CGA009 was anaerobically grown at 30◦ C with continuous illumination. Error bars indicate the standard deviation from three independent experiments.

FIGURE 2 | The relationship between the growth rate and arsenate (A) and arsenite (B) concentrations in R. palustris CGA009. Growth rate (k) was
calculated from the increased OD660 values in log phase cultures grown in different concentrations of arsenic (c). The equations were obtained by nonlinear fitting.
EC50 was obtained from c value which corresponded to a half of maximum of k value by equations.

Frontiers in Microbiology | www.frontiersin.org 3 September 2015 | Volume 6 | Article 986


Zhao et al. Molecular regulation of multiple arsenic operons

FIGURE 3 | Schematic comparison of arsenic gene clusters from seven R. palustris strains. Genes were shown as different color and arrows indicated the
direction of transcription. arsR was arsenite-responsive transcriptional regulator gene. arsC/arsC’ was As (V) reductases gene, arsC was As (V) reductases genes,
arsC1 and arsC2 were glutathione (GSH)/glutaredoxin (Grx)-coupled reductases genes, arsC3 was thioredoxin (Trx)/thioredoxin reductase (TrxR)-dependent
reductases gene; arsB was arsenite efflux pump gene, acr3 was arsenite permease (ACR3) gene, they came from unrelated As(III) transporter families; arsH was
NADPH-dependent flavin mononucleotide reductase gene; arsM was As(III)-methyltransferase gene. Other genes found in or adjacent to the ars clusters were shown
as empty boxes.

FIGURE 5 | Dynamics of expression of ars1, ars2 and ars3 operons. The


expression of arsB (black bars), arsC2 (white bars) and arsM (bias bars) was
FIGURE 4 | Effects of As (III) concentrations on the expressions of normalized to the expression of gyrB. The growth curve(N) of R. palustris
ars1, ars2 and ars3 operons in R. palustris CGA009. The expressions of CGA009 grown on 0.5 mM arsenate is shown as dash line. Error bars indicate
arsB(), arsC2(#), and arsM(N) represent the expression of ars1, ars2, and the standard deviation from three independent experiments.
ars3 operons, respectively. The expression of genes was calculated by
determing the content ratio of functional genes to house-keeping gene (gyrB).
Cultures were harvested in the middle-log phase (50 h). Error bars indicate the
arsenic in strain CQV97 was higher or comparable to E. coli, P.
standard deviation from three independent experiments.
aeruginosa, Rhodococcus equi, and Methylosinus trichosporium.
However, compared to those bacteria with a “high” arsenic
and 100% of the bacterial growth, respectively. However, cells resistance capability (>100 mM), there is still considerable room
retained at least 70 and 60% of the control growth when 1.0 and for further improvement.
1.5 mM of the As(III) were added, respectively. Furthermore, we The genome-mining analysis showed that arsRBC operon
studied the relationship between the growth rate and the arsenic existed in seven R. palustris strains (CGA009, HaA2, TIE-1,
concentrations (Figure 2). Median effective concentration DX-1, BisB5, BisA53, and BisB18) (Figure 3), while additional
(EC50 ) values for As(V) and As(III) were estimated to be 2.44 arsRM operon was only found in strains CGA009, HaA2, TIE-1,
and 1.55 mM, respectively. DX-1, and BisB5 (Figure 3) (Lv et al., 2012a). The first operon
LV et al. investigated the arsenic resistance in three resembles ars operon (named ars1 operon, arsRCBH type),
purple non-sulfur bacteria and reported the EC50 for As(V) consisting of arsenite-responsive transcriptional regulator gene
and As(III) Rhodopseudomona palustris CQV97 (2.4 and (arsR1), arsenate reductase gene (arsC1), arsenite efflux pump
0.9 mM, respectively), Rhodobacter azotoformans 134K20 (1.6 gene (arsB) and NADPH-dependent flavin mononucleotide
and 0.2 mM, respectively) and Rhodobacter capsulatus XJ-1 (1.9 reductase gene (arsH). The second operon [named ars2 operon,
and 0.3 mM, respectively) (Lv et al., 2012a,b). The EC50 -value for arsRRCC (acr3) type] contains two arsR genes (arsR2 and arsR3),

Frontiers in Microbiology | www.frontiersin.org 4 September 2015 | Volume 6 | Article 986


Zhao et al. Molecular regulation of multiple arsenic operons

two As(V) reductases genes (arsC2 and arsC3), one arsenite arsB, arsC2, and arsM as marker genes for ars1, ars2, and ars3
permease gene (acr3), and two genes encoding the hypothetical operons, respectively (Figure 4). Gene expression of arsB, arsC2,
proteins. Both ars1 and ars2 operons encode these proteins that and arsM were undetectable when As(III) was absent, indicating
perform As(V) reduction and As(III) extrusion mechanisms. the three operons were not expressed without arsenic induction.
The third operon (named ars3 operon, arsRM type) consists arsB was not transcribed when As(III) was added to the culture
of arsenite-responsive transcriptional regulator gene (arsR4) at concentrations ranging from 0 to 1.0 mM. Remarkably, the
and As(III)-methyltransferase gene (arsM). ars3 operon encode expression of ars2 operon (arsC2) was readably detected when
methylation protein that methylate As(III) to a number of cells were even exposed to a low level of As(III) (0.01 µM).
methylated intermediates such as onomethylarsenite [MMA(III)] Compared to the control, its transcript level was increased 9.5,
and dimethylarsenite [DMA(III)]. It should be note that arsenic 23.8, and 126.8–fold when 0.01, 0.1, and 1.0 mM of As(III) were
resistance in microorganisms did not show a direct correlation added respectively, demonstrating that ars2 expression was up-
with arsenic operon number(s) (Kruger et al., 2013). For example, regulated by As(III). However, arsM was not transcribed when
at least five arsenic operons were found in Herminiimonas the cells were exposed to 1.0 µM of As(III), indicating that gene
arsenicoxydans while its tolerance to arsenic was much lower than product of arsM was not critical for detoxifying As(III) under
that in Corynebacterium glutamicum which has only two arsenic low environmental As(III) conditions (<1.0 µM). However, its
operons. Despite of their widespread distribution in various expression level was 3.86-fold higher than the control when
bacteria, the arsenic multi-operons were understudied. Due to 1.0 µM concentration of As(III) was present in the medium
arsenic multi-operons co-existing in one microorganism, it is (Figure 4). Furthermore, arsM transcript level increased with
difficult to define the arsenic resistance mechanisms. Therefore, the increasing environmental As(III) concentration (Figure 4).
it is necessary to further investigate how these arsenic multi- It should be noted that the expression levels of arsM and arsC2
operons were differentially regulated and their contributions to were almost equal when As(III) concentration reached a 1.0 mM,
arsenic speciation. showing that R. palustris CGA009 probably required expression
In this study, we preliminary investigated their respective of ars2 and ars3 operons to detoxify the high concentrations
gene expression in the three ars operons by using quantitative of As(III).
real-time PCR in order to understand which one was actively The expression dynamics of arsB, arsC2 and arsM (ars1, ars2,
involved in arsenic resistance in R. palustris CGA009. It should and ars3 operons) were investigated in R. palustris CGA009
be noted that studying ars operon regulation by As(V) is at different phases of growth (Figure 5). arsC2 expression was
difficult because it can be quickly reduced to As(III) by As(V) highly induced by arsenate at the log-phase (between 43 and
reductase in vivo. Therefore, we first examined the effect of 60 h); the expression level decreased when cells entered the
As(III) (rather than As(V)) on the expression of ars1, ars2 stationary phase (67–80 h). A similar expression pattern was
and ars3 operons. To do that, we selected the functional genes found in arsM; however, a relatively low level of expression of
arsM was recorded during the whole growth phase, compared to
that in arsC2. ars1 transcript level was much lower than those in
ars2 and ars3 at different phases of growth.
Unfortunately, only few studies have been conducted to exam
the differential regulation of arsenic multi-operons by arsenic.
In bacteria and archaea, ars operons are often controlled by
ArsR (Figure 3). When As(III) is absent, ArsR binds to the
operator/promoter region of the operon and thus repressed
the downstream genes’ transcription. When As(III) is available,
ArsR binds to it and goes through conformational changes,
resulting in dissociation from the operator/promoter region.
In our transcript analysis experiments, we could not detect a
significant ars1 expression (Figure 4). However, this observation
was not new. For example, in C. glutamicum, only arsC1’
was constitutively transcribed though there were two arsenic
resistance operons (ars1 and ars2) (Villadangos et al., 2011).
Furthermore, the expression of ars3 operon in R. palustris
CGA009 was induced with the presence of 1.0 µM of As(III),
indicating it may only contribute to the arsenic detoxification
under the higher concentrations of As(III) (see next). However,
FIGURE 6 | Arsenic speciation of R. palustris CGA009 determined by the expression pattern was not similar to those previously
anion exchange HPLC-ICP-MS. (A) Chromatogram of the standards, observed in Synechocystis sp. PCC 6803 and P. alcaligenes
including As (III), dimethylarsine (DMA), monomethylarsine (MMA) and As (V). NBRC14159 (López-Maury et al., 2003; Zhang et al., 2015).
(B) Speciation of arsenic of R. palustris CGA009 grown on 1.0 mM arsenite in Synechocystis sp. PCC 6803 has at least two operons (ars
the middle-log phase. (C) Speciation of arsenic of R. palustris CGA009 grown
on 0.5 mM arsenate in the middle-log phase.
and arsM) on its chromosome. ars operon was regulated by
ArsR though arsR was located far away from ars. DNase I

Frontiers in Microbiology | www.frontiersin.org 5 September 2015 | Volume 6 | Article 986


Zhao et al. Molecular regulation of multiple arsenic operons

FIGURE 7 | Proposed arsenic metabolic model for R. palustris CGA009.

footprinting experiments indicated that ArsR binds to two 17-bp (Figure 6). However, we failed to detect dimethylarsine (DMA),
direct repeats (ATCAA(N)6TTGAT) in the promoter-operator monomethylarsine (MMA) even in the growth stage where arsM
region. However, the upstream sequence of arsM does not transcript approached to the highest level (Figure 6). DMA
have the 17-bp repeats (López-Maury et al., 2003). Authors and MMA, the intermediates produced in As(III) methylation
proposed that ArsM is constitutively expressed whilst how ArsM process did not accumulate in the cells and were immediately
expression is regulated has yet to be investigated. In P. alcaligenes converted into volatile trimethylarsine (TMA). Thereafter, TMA
NBRC14159, PaarsM was expressed in the absence of As(III) were rapidly expelled to extracellular space (Qin et al., 2006).
and the expression was further enhanced by As(III) exposure In the same study, Qin et al. heterologously expressed the arsM
(Zhang et al., 2015). Our results revealed that the expression of gene from R. palustris CGA009 in an arsenic-sensitive strain of E.
the different arsenic operons were affected by growth cycle: the coli. Their results showed that ArsM catalyzed the formation of a
maximal expressions of both ars2 and ars3 operons in CGA009 number of methylated intermediates from As(III), with TMA as
appeared at early log-phase (43 h) and maintained at high level the end product and increased the arsenic resistance, indicating
during the growth of middle log-phase (55 h). It is different from that it was very possible for arsM to be functional in vivo (Qin
expression patterns reported in the earlier studies in Shewanella et al., 2006).
sp. ANA-3 (Saltikov et al., 2005). The highest arr expression A working model for the arsenic detoxification by the arsenic
appeared at the log-phase while peak expression level of ars was multi-operons was proposed in R. palustris (Figure 7). In this
observed in the stationary phase, respectively. That transcription model, the As(V) enters into cells through inorganic phosphate
of the ars operon in Shewanella sp. ANA-3 could involve other (Pit) or phosphate specific transport (Pst) systems (Kruger et al.,
factors, such as those related to quorum sensing and energy 2013); once As(V) arrives inside the cells, it is reduced to As(III)
production. In fact, a quorum-sensing-based response was shown by ArsC produced from ars1 and/or ars2 operon (possible at a
to be a second regulatory circuit for aio transcription in A. low expression) (Figure 3). As(III) formed in the reaction then
tumefaciens (Kashyap et al., 2006). inactivates ArsR, initiating the transcription of the arsRRCC
HPLC-ICP-MS analysis in middle log-phase demonstrated (acr3) operon (ars2). Due to the two copies of arsC in ars2,
that As(V) was reduced to As(III), indicating that strain CGA009 it allows to reduce arsenate more promptly, leading to As(III)
detoxified arsenate by reducing As(V) to As(III) by ArsC accumulation in the cells. If the accumulated As(III) could not

Frontiers in Microbiology | www.frontiersin.org 6 September 2015 | Volume 6 | Article 986


Zhao et al. Molecular regulation of multiple arsenic operons

be expelled out of the cells by arsenite permease (Acr3), the phototrophic bacteria. R. palustris possessed good arsenic
increasing As(III) triggers the ars3 transcription by releasing resistance which possibly linked to the arsenic multi-operons
ArsR which originally binds arsM promoter/operator. Arsenic in the chromosome. Our results showed ars2 and ars3 operons
resistance genetic units ars2 and ars3 in R. palustris contribute were upregulated by increasing As(III) concentrations while
to detoxifying arsenic at a high dose because their transcription ars3 operon was only expressed when exposed to the arsenic
level is comparable when cells are treated with 1.0 mM arsenite. concentrations more than 1.0 µM. However, the expression of
With cooperation of ars2 and ars3, R. palustris detoxifying As(III) ars1 operon was very low, indicating that ars1 may not be actively
by extruding it out of the cell by As(III) transporter (Acr3) or used. Collectively, our preliminary data showed that arsenic
transforming As(III) to volatile methylated As(III) (TMA) by was possibly transformed by the combination mechanisms
ArsM. It is reasonable to assume that ars2 is more important of the cytoplasmic As(V) reduction, As(III) extrusion and
when cells are exposed to lower levels of arsenic due to its activity arsenic methylation when exposed to arsenic at a high
expression. However, a relatively complex arsenate detoxification concentration.
system described here suggests that R. palustris growing in the
natural environment must be equipped to deal with rapidly
changing and perhaps relatively high levels of arsenic. Acknowledgments
This work has been supported by the National Natural
Conclusion Science Foundation of China (No. 31070054), by National
Marine Public Industry Research (No. 201505026), by
This study provided a novel insight into arsenic resistance Natural Science Foundation of Fujian Province (No.
mechanisms in R. palustris CGA009, a member of anoxygenic 2015J01137).

References Lv, C. J., Zhao, C. G., Yang, S. P., and Qu, Y. B. (2012a). Arsenic metabolism in
purple nonsulfur bacteria. Acta Microbiol. Sinica 52, 1497–1507.
Arsène-Ploetze, F., Koechler, S., Marchal, M., Coppée, J. Y., Chandler, M., Muller, D., Médigue, C., Koechler, S., Barbe, V., Barakat, M., Talla, E.,
Bonnefoy, V., et al. (2010). Structure, function, and evolution of the Thiomonas et al. (2007). A tale of two oxidation states: bacterial colonization of
spp. Genome. PLoS Genet. 6:e1000859. doi: 10.1371/journal.pgen.1000859 arsenic-rich environments. PLoS Genetics 3:e53. doi: 10.1371/journal.pgen.00
Carius, L., Carius, A. B., McIntosh, M., and Grammel, H. (2013). Quorum sensing 30053
influences growth and photosynthetic membrane production in high-cell- Oremland, R. S., and Stolz, J. F. (2003). The ecology of arsenic. Science 300,
density cultivations of Rhodospirillum rubrum. BMC Microbiol. 13:189. doi: 939–944. doi: 10.1126/science.1081903
10.1186/1471-2180-13-189 Páez-Espino, D., Tamames, J., de Lorenzo, V., and Canovas, D. (2009).
Fu, Q. M., Zhao, C. G., Yang, S. P., and Wu, J. H. (2014). The photoelectric Microbial responses to environmental arsenic. Biometals 22, 117–130. doi:
performance of dye-sensitized solar cells fabricated by assembling pigment– 10.1007/s10534-008-9195-y
protein complexes of purple bacteria on nanocrystalline photoelectrode. Mater. Qin, J., Lehr, C. R., Yuan, C., Le, X. C., McDermott, T. R., and Rosen, B. P.
Lett. 129, 195–197. doi: 10.1016/j.matlet.2014.05.054 (2009). Biotransformation of arsenic by a Yellowstone thermoacidophilic
Heinrich-Salmeron, A., Cordi, A., Brochier-Armanet, C., Halter, D., Pagnout, C., eukaryotic alga. Proc. Natl. Acad. Sci. U.S.A. 106, 5213–5217. doi:
Abbaszadeh-fard, E., et al. (2011). Unsuspected diversity of arsenite-oxidizing 10.1073/pnas.0900238106
bacteria as revealed by widespread distribution of the aoxB gene in Prokaryotes. Qin, J., Rosen, B. P., Zhang, Y., Wang, G., Franke, S., and Rensing, C. (2006).
Appl. Environ. Microbiol. 77, 4685–4692. doi: 10.1128/AEM.02884-10 Arsenic detoxification and evolution of trimethylarsine gas by a microbial
Jackson, C. R., and Dugas, S. L. (2003). Phylogenetic analysis of bacterial and arsenite S-adenosylmethionine methyltransferase. Proc. Natl. Acad. Sci. U.S.A.
archaeal arsC gene sequences suggests an ancient, common origin for arsenate 103, 2075–2080. doi: 10.1073/pnas.0506836103
reductase. BMC Evol. Biol. 3:18. doi: 10.1186/1471-2148-3-18 Rodríguez-Lado, L., Sun, G., Berg, M., Zhang, Q., Xue, H., Zheng, Q., et al. (2013).
Kashyap, D. R., Botero, L. M., Franck, W. L., Hassett, D. J., and McDermott, T. R. Groundwater arsenic contamination throughout China. Science 341, 866–868.
(2006). Complex regulation of arsenite oxidation in Agrobacterium tumefaciens. doi: 10.1126/science.1237484
J. Bacteriol. 188, 1081–1088. doi: 10.1128/JB.188.3.1081-1088.2006 Saltikov, C. W., and Newman, D. K. (2003). Genetic identification of a respiratory
Kruger, M. C., Bertin, P. N., Heipieper, H. J., and Arsène-Ploetze, F. arsenate reductase. Proc. Natl. Acad. Sci. U.S.A. 100, 10983–10988. doi:
(2013). Bacterial metabolism of environmental arsenic–mechanisms and 10.1073/pnas.1834303100
biotechnological applications. Appl. Microbiol. Biotechnol. 97, 3827–3841. doi: Saltikov, C. W., Wildman, R. A. Jr., and Newman, D. K. (2005). Expression
10.1007/s00253-013-4838-5 dynamics of arsenic respiration and detoxification in Shewanella sp.
Lin, Z. H., Yue, H. Y., Lü, C. J., Zhao, C. G., and Yang, P. S. (2014). Variation strain ANA-3. J. Bacteriol. 187, 7390–7396. doi: 10.1128/JB.187.21.7390-73
in composition and relative content of accumulated photopigments in a newly 96.2005
isolated Rhodobacter capsulatus strain XJ-1 in response to arsenic. J. Environ. Slyemi, D., and Bonnefoy, V. (2012). How prokaryotes deal with arsenic. Environ.
Sci. Health A 49, 1493–1500. doi: 10.1080/10934529.2014.937168 Microbiol. Reports 4, 571–586. doi: 10.1111/j.1758-2229.2011.00300.x
Liu, Y., Ghosh, D., and Hallenbeck, P. C. (2015). Biological reformation of ethanol Stolz, J. F., Basu, P., and Oremland, R. S. (2010). Microbial arsenic metabolism:
to hydrogen by Rhodopseudomonas palustris CGA009 Bioresource Technology new twists on an old poison. Microbe 5, 53–59. doi: 10.1128/microbe.5.53.1
176, 189–195. doi: 10.1016/j.biortech.2014.11.047 Stolz, J. F., and Oremland, R. S. (1999). Bacterial respiration of arsenic
López-Maury, L., Florencio, F. J., and Reyes, J. C. (2003). Arsenic sensing and and selenium. FEMS Microbiol. Rev. 23, 615–627. doi: 10.1111/j.1574-
resistance system in the cyanobacterium Synechocystis sp. strain PCC 6803. 6976.1999.tb00416.x
J. Bacteriol. 185, 5363–5371. doi: 10.1128/JB.185.18.5363-5371.2003 Villadangos, A. F., Van Belle, K., Wahni, K., Dufe, V. T., Freitas, S., Nur, H.,
Lv, C. J., Zhang, Y. Y., Zhao, C. G., Guo, S. W., Yang, S. P., and Chen, S. H. et al. (2011). Corynebacterium glutamicum survives arsenic stress with arsenate
(2012b). Arsenic resistance mechanisms in Rhodopseudomonas palustris under reductases coupled to two distinct redox mechanisms. Mol. Microbiol. 82,
anaerobic and light conditions. Acta Sci. Circumstantiae 32, 2375–2383. 998–1014. doi: 10.1111/j.1365-2958.2011.07882.x

Frontiers in Microbiology | www.frontiersin.org 7 September 2015 | Volume 6 | Article 986


Zhao et al. Molecular regulation of multiple arsenic operons

Yang, H. C., Fu, H. L., Lin, Y. F., and Rosen, B. P. (2012). Pathways of arsenic Conflict of Interest Statement: The authors declare that the research was
uptake and efflux. Curr. Top. Membr. 69, 325–358. doi: 10.1016/B978-0-12- conducted in the absence of any commercial or financial relationships that could
394390-3.00012-4 be construed as a potential conflict of interest.
Zhang, J., Cao, T., Tang, Z., Shen, Q., Rosen, B. P., and Zhao, F. J. (2015).
Arsenic methylation and volatilization by arsenite S-adenosylmethionine Copyright © 2015 Zhao, Zhang, Chan, Chen and Yang. This is an open-access article
methyltransferase in Pseudomonas alcaligenes NBRC14159. Appl. Environ. distributed under the terms of the Creative Commons Attribution License (CC BY).
Microbiol. 81, 2852–2860. doi: 10.1128/AEM.03804-14 The use, distribution or reproduction in other forums is permitted, provided the
Zhao, L., Zhao, C. G., Han, D. X., Yang, S. P., Chen, S. H., and Yu, C. P. original author(s) or licensor are credited and that the original publication in this
(2011). Anaerobic utilization of phenanthrene by Rhodopseudomonas palustris. journal is cited, in accordance with accepted academic practice. No use, distribution
Biotechnol. Lett. 33, 2135–2140. doi: 10.1007/s10529-011-0681-x or reproduction is permitted which does not comply with these terms.

Frontiers in Microbiology | www.frontiersin.org 8 September 2015 | Volume 6 | Article 986

You might also like