This repository contains the source code to the NeurIPS 2022 paper Probabilistic Transformer: Modelling Ambiguities and Distributions for RNA Folding and Molecule Design
Contains the configuration files for our experiments on the Synthetic Sequential Distribution, RNA folding and molecule design task we reported in the paper.
Contains training, validation and test data for the RNA folding and molecule design task. We use the processed Guacamol dataset from https://github.com/devalab/molgpt and created the RNA folding data based on the description in the paper.
Contains the source code of the ProbTransformer, the data handler and the training script train_transformer.py.
The train script runs out of the box on a downscaled config and creates an experiments folder in the base directory.
Please adjust the cuda toolkit version in the environment.yml file to fit your setup.
conda env create -n ptenv -f environment.yml
conda activate ptenv
pip install -e .
tar -xf data/rna_data.plk.xz -C data/
Download the Guacamol dataset and extract into data.
unzip data/guacamol2.csv.zip -d data/
Please find checkpoints for the ProbTransformer and the CNN head for RNA folding at:
https://ml.informatik.uni-freiburg.de/research-artifacts/probtransformer/prob_transformer_final.pth
https://ml.informatik.uni-freiburg.de/research-artifacts/probtransformer/cnn_head_final.pth
Please use the infer_rna_folding.py script to fold a sequence of nucleotides (ACGU).
python infer_rna_folding.py -s ACGUCCUGUGCGAGCAUGCAUGC
To evaluate the uploaded model checkpoints on the test set TS0 use the evaluate flag.
python infer_rna_folding.py -e
python prob_transformer/train_transformer.py -c configs/ssd_prob_transformer.yml
python prob_transformer/train_transformer.py -c configs/ssd_transformer.yml
python prob_transformer/train_transformer.py -c configs/rna_prob_transformer.yml
python prob_transformer/train_transformer.py -c configs/rna_transformer.yml
python prob_transformer/train_transformer.py -c configs/mol_prob_transformer.yml
python prob_transformer/train_transformer.py -c configs/mol_transformer.yml