Data Warehousing
and Mining
Lecture 2
Dr. Hossen Asiful Mustafa
What is Data?
Attributes
Collection of data objects and their
Tid Refund Marital Taxable
attributes Status Income Cheat
An attribute is a property or 1 Yes Single 125K No
characteristic of an object 2 No Married 100K No
Examples: eye color of a person, 3 No Single 70K No
temperature, etc. 4 Yes Married 120K No
Attribute is also known as variable, 5 No Divorced 95K Yes
field, characteristic, or feature Objects 6 No Married 60K No
A collection of attributes describe 7 Yes Divorced 220K No
an object 8 No Single 85K Yes
Object is also known as record, 9 No Married 75K No
point, case, sample, entity, or 10 No Single 90K Yes
instance 10
2
Attribute Values
Attribute values are numbers or symbols assigned to
an attribute
Distinction between attributes and attribute values
Same attribute can be mapped to different attribute values
• Example: height can be measured in feet or meters
Different attributes can be mapped to the same set of values
• Example: Attribute values for ID and age are integers
• But properties of attribute values can be different
• ID has no limit but age has a maximum and minimum value
3
Types of Attributes
There are different types of attributes
Nominal: provide only enough information to distinguish one
object
• Examples: ID numbers, eye color, zip codes
Ordinal: provide enough information to order objects
• Examples: rankings (e.g., taste of potato chips on a scale from 1-
10), grades, height in {tall, medium, short}
Interval: the differences between values are meaningful
• Examples: calendar dates, temperatures in Celsius or
Fahrenheit.
Ratio: both differences and ratios are meaningful
• Examples: temperature in Kelvin, length, time, counts
4
Properties of Attribute
Values
The type of an attribute depends on which of the
following properties it possesses:
Distinctness: =
Order: < >
Addition: + -
Multiplication: */
Nominal attribute: distinctness
Ordinal attribute: distinctness & order
Interval attribute: distinctness, order & addition
Ratio attribute: all 4 properties
5
Attribute Description Examples Operations
Type
Nominal The values of a nominal attribute are zip codes, employee mode, entropy,
just different names, i.e., nominal ID numbers, eye color, contingency
attributes provide only enough sex: {male, female} correlation, 2 test
information to distinguish one object
from another. (=, )
Ordinal The values of an ordinal attribute hardness of minerals, median, percentiles,
provide enough information to order {good, better, best}, rank correlation,
objects. (<, >) grades, street numbers run tests, sign tests
Interval For interval attributes, the calendar dates, mean, standard
differences between values are temperature in Celsius deviation, Pearson's
meaningful, i.e., a unit of or Fahrenheit correlation, t and F
measurement exists. tests
(+, - )
Ratio For ratio variables, both differences temperature in Kelvin, geometric mean,
and ratios are meaningful. (*, /) monetary quantities, harmonic mean,
counts, age, mass, percent variation
length, electrical
current
6
Attribute Transformation Comments
Level
Nominal Any permutation of values If all employee ID numbers
were reassigned, would it
make any difference?
Ordinal An order preserving change of An attribute encompassing
values, i.e., the notion of good, better
new_value = f(old_value) best can be represented
where f is a monotonic function. equally well by the values
{1, 2, 3} or by { 0.5, 1, 2}.
Interval new_value =a * old_value + b Thus, the Fahrenheit and
where a and b are constants Celsius temperature scales
differ in terms of where
their zero value is and the
size of a unit (degree).
Ratio new_value = a * old_value Length can be measured in
meters or feet.
7
Discrete and Continuous
Attributes
Discrete Attribute
Has only a finite set of values
Examples: zip codes, counts, or the set of words in a
collection of documents
Often represented as integer variables.
Note: binary attributes are a special case of discrete attributes
Continuous Attribute
Has real numbers as attribute values
Examples: temperature, height, or weight.
Practically, real values can only be measured and represented
using a finite number of digits.
Continuous attributes are typically represented as floating-
point variables.
8
Types of data sets
Record
Data Matrix
Document Data
Transaction Data
Graph
World Wide Web
Molecular Structures
Ordered
Spatial Data
Temporal Data
Sequential Data
Genetic Sequence Data
9
Important Characteristics of
Structured Data
Dimensionality
• Curse of Dimensionality
Sparsity
• Only presence counts
Resolution
• Patterns depend on the scale
10
Record Data
Data that consists of a collection of records, each of
which consists of a fixed set of attributes
Tid Refund Marital Taxable
Status Income Cheat
1 Yes Single 125K No
2 No Married 100K No
3 No Single 70K No
4 Yes Married 120K No
5 No Divorced 95K Yes
6 No Married 60K No
7 Yes Divorced 220K No
8 No Single 85K Yes
9 No Married 75K No
10 No Single 90K Yes
11 10
Data Matrix
If data objects have the same fixed set of numeric
attributes, then the data objects can be thought of as
points in a multi-dimensional space, where each
dimension represents a distinct attribute
Such data set can be represented by an m by n
matrix, where there are m rows, one for each object,
and n columns, one for each attribute
Projection Projection Distance Load Thickness
of x Load of y load
10.23 5.27 15.22 2.7 1.2
12.65 6.25 16.22 2.2 1.1
12
Document Data
Each document becomes a `term' vector,
each term is a component (attribute) of the vector,
the value of each component is the number of times the
corresponding term occurs in the document.
timeout
season
coach
game
score
team
ball
lost
pla
wi
n
y
Document 1 3 0 5 0 2 6 0 2 0 2
Document 2 0 7 0 2 1 0 0 3 0 0
Document 3 0 1 0 0 1 2 2 0 3 0
13
Transaction Data
A special type of record data, where
each record (transaction) involves a set of items.
For example, consider a grocery store. The set of products
purchased by a customer during one shopping trip constitute
a transaction, while the individual products that were
purchased are the items.
TID Items
1 Bread, Coke, Milk
2 Beer, Bread
3 Beer, Coke, Diaper, Milk
4 Beer, Bread, Diaper, Milk
5 Coke, Diaper, Milk
14
Graph Data
Examples: Generic graph and HTML Links
2 <a href="papers/papers.html#bbbb">
Data Mining </a>
<li>
5 1 <a href="papers/papers.html#aaaa">
Graph Partitioning </a>
2 <li>
<a href="papers/papers.html#aaaa">
Parallel Solution of Sparse Linear System of Equations </a>
5 <li>
<a href="papers/papers.html#ffff">
N-Body Computation and Dense Linear System Solvers
15
Chemical Data
Benzene Molecule: C6H6
16
Ordered Data
Sequences of transactions
Items/Events
An element of
the sequence
17
Ordered Data
Genomic sequence data
GGTTCCGCCTTCAGCCCCGCGCC
CGCAGGGCCCGCCCCGCGCCGTC
GAGAAGGGCCCGCCTGGCGGGCG
GGGGGAGGCGGGGCCGCCCGAGC
CCAACCGAGTCCGACCAGGTGCC
CCCTCTGCTCGGCCTAGACCTGA
GCTCATTAGGCGGCAGCGGACAG
GCCAAGTAGAACACGCGAAGCGC
TGGGCTGCCTGCTGCGACCAGGG
18
Ordered Data
Spatio-Temporal Data
Average Monthly
Temperature of
land and ocean
19
Data Quality
What kinds of data quality problems?
How can we detect problems with the data?
What can we do about these problems?
Examples of data quality problems:
Noise and outliers
missing values
duplicate data
20
Noise
Noise refers to modification of original values
Examples: distortion of a person’s voice when talking on a
poor phone and “snow” on television screen
Two Sine Waves Two Sine Waves + Noise
21
Outliers
Outliers are data objects with characteristics that are
considerably different than most of the other data
objects in the data set
22
Missing Values
Reasons for missing values
Information is not collected
(e.g., people decline to give their age and weight)
Attributes may not be applicable to all cases
(e.g., annual income is not applicable to children)
Handling missing values
Eliminate Data Objects
Estimate Missing Values
Ignore the Missing Value During Analysis
Replace with all possible values (weighted by their
probabilities)
23
Duplicate Data
Data set may include data objects that are duplicates,
or almost duplicates of one another
Major issue when merging data from heterogeous sources
Examples:
Same person with multiple email addresses
Data cleaning
Process of dealing with duplicate data issues
24
Data Preprocessing
Aggregation
Sampling
Dimensionality Reduction
Feature subset selection
Feature creation
Discretization and Binarization
Attribute Transformation
25
Aggregation
Combining two or more attributes (or objects) into a
single attribute (or object)
Purpose
Data reduction
• Reduce the number of attributes or objects
Change of scale
• Cities aggregated into regions, states, countries, etc
More “stable” data
• Aggregated data tends to have less variability
26
Aggregation
Variation of Precipitation in Australia
Standard Deviation of Average Standard Deviation of Average
Monthly Precipitation Yearly Precipitation
27
Sampling
Sampling is the main technique employed for data
selection.
It is often used for both the preliminary investigation of the
data and the final data analysis.
Statisticians sample because obtaining the entire set
of data of interest is too expensive or time consuming.
Sampling is used in data mining because processing
the entire set of data of interest is too expensive or
time consuming.
28
Sampling …
The key principle for effective sampling is the
following:
using a sample will work almost as well as using the entire
data sets, if the sample is representative
A sample is representative if it has approximately the same
property (of interest) as the original set of data
29
Types of Sampling
Simple Random Sampling
There is an equal probability of selecting any particular item
Sampling without replacement
As each item is selected, it is removed from the population
Sampling with replacement
Objects are not removed from the population as they are
selected for the sample.
• In sampling with replacement, the same object can be picked up
more than once
Stratified sampling
Split the data into several partitions; then draw random
samples from each partition
30
Sample Size
8000 points 2000 Points 500 Points
31
Sample Size
What sample size is necessary to get at least one
object from each of 10 groups.
32
Curse of Dimensionality
When dimensionality
increases, data
becomes increasingly
sparse in the space
that it occupies
Definitions of density
and distance between
points, which is critical
for clustering and • Randomly generate 500 points
outlier detection, • Compute difference between max and min
become less distance between any pair of points
meaningful
Dimensionality Reduction
Purpose:
Avoid curse of dimensionality
Reduce amount of time and memory required by data mining
algorithms
Allow data to be more easily visualized
May help to eliminate irrelevant features or reduce noise
Techniques
Principle Component Analysis (PCA)
Singular Value Decomposition
Others: supervised and non-linear techniques
34
Feature Creation
Create new attributes that can capture the important
information in a data set much more efficiently than
the original attributes
Three general methodologies:
Feature Extraction
• domain-specific
Mapping Data to New Space
Feature Construction
• combining features
35
Mapping Data to a New
Space
Fourier transform
Wavelet transform
Two Sine Waves Two Sine Waves + Noise Frequency
36
Discretization Using Class
Labels
Entropy based approach
3 categories for both x and y 5 categories for both x and y
37
Attribute Transformation
A function that maps the entire set of values of a
given attribute to a new set of replacement values
such that each old value can be identified with one of
the new values
Simple functions: xk, log(x), ex, |x|
Standardization and Normalization
38
Similarity and Dissimilarity
Similarity
Numerical measure of how alike two data objects are.
Is higher when objects are more alike.
Often falls in the range [0,1]
Dissimilarity
Numerical measure of how different are two data objects
Lower when objects are more alike
Minimum dissimilarity is often 0
Upper limit varies
Proximity refers to a similarity or dissimilarity
39
Similarity/Dissimilarity for
Simple Attributes
p and q are the attribute values for two data objects.
40
Euclidean Distance
Euclidean Distance
n
dist k
( p qk ) 2
k 1
Where n is the number of dimensions (attributes) and pk and
qk are, respectively, the k-th attributes (components) or data
objects p and q.
Standardization is necessary, if scales differ.
41
Euclidean Distance
3
point x y
2 p1 p1 0 2
p3 p4 p2 2 0
1
p2
p3 3 1
0 p4 5 1
0 1 2 3 4 5 6
p1 p2 p3 p4
p1 0 2.828 3.162 5.099
p2 2.828 0 1.414 3.162
p3 3.162 1.414 0 2
p4 5.099 3.162 2 0
Distance Matrix
42
Minkowski Distance
Minkowski Distance is a generalization of Euclidean
Distance
1
n
dist ( | pk qk r r
|)
k 1
Where r is a parameter, n is the number of dimensions
(attributes) and pk and qk are, respectively, the k-th attributes
(components) or data objects p and q.
43
Minkowski Distance:
Examples
r = 1. City block (Manhattan, taxicab, L1 norm)
distance.
A common example of this is the Hamming distance, which is
just the number of bits that are different between two binary
vectors
r = 2. Euclidean distance
r . “supremum” (Lmax norm, L norm) distance.
This is the maximum difference between any component of
the vectors
Do not confuse r with n, i.e., all these distances are
defined for all numbers of dimensions.
44
Minkowski Distance
L1 p1 p2 p3 p4
p1 0 4 4 6
p2 4 0 2 4
p3 4 2 0 2
p4 6 4 2 0
point x y
p1 0 2 L2 p1 p2 p3 p4
p2 2 0 p1 0 2.828 3.162 5.099
p3 3 1 p2 2.828 0 1.414 3.162
p4 5 1 p3 3.162 1.414 0 2
p4 5.099 3.162 2 0
L p1 p2 p3 p4
p1 0 2 3 5
p2 2 0 1 3
p3 3 1 0 2
p4 5 3 2 0
Distance Matrix
45
Mahalanobis Distance
1
mahalanobis( p, q) ( p q) ( p q) T
is the covariance matrix of
the input data X
1 n
j ,k
n 1 i 1
( X ij X j )( X ik X k )
For red points, the Euclidean distance is 14.7, Mahalanobis distance is 6.
46
Mahalanobis Distance
Covariance Matrix:
0 .3 0 .2
C 0 . 2 0 . 3
B A: (0.5, 0.5)
B: (0, 1)
A C: (1.5, 1.5)
Mahal(A,B) = 5
Mahal(A,C) = 4
47
Common Properties of a
Distance
Distances, such as the Euclidean distance, have some
well known properties.
d(p, q) 0 for all p and q and d(p, q) = 0 only if
p = q. (Positive definiteness)
d(p, q) = d(q, p) for all p and q. (Symmetry)
d(p, r) d(p, q) + d(q, r) for all points p, q, and r.
(Triangle Inequality)
where d(p, q) is the distance (dissimilarity) between
points (data objects), p and q.
A distance that satisfies these properties is a metric
48
Common Properties of a
Similarity
Similarities, also have some well known properties.
s(p, q) = 1 (or maximum similarity) only if p = q.
s(p, q) = s(q, p) for all p and q. (Symmetry)
where s(p, q) is the similarity between points (data
objects), p and q.
49
