Data Mining and Analytics: AIM411

Introduction to Data Mining

1
Outline

Attributes and Objects

Types of Data

Data Quality

Similarity and Distance

Data Preprocessing
What is Data?

Collection of data objects Attributes

and their attributes
An attribute is a property Tid Refund Marital Taxable
or characteristic of an Status Income Cheat

object 1 Yes Single 125K No

– Examples: eye color of a 2 No Married 100K No
person, temperature, etc.
3 No Single 70K No

Objects
– Attribute is also known as
variable, field, characteristic, 4 Yes Married 120K No
dimension, or feature 5 No Divorced 95K Yes

A collection of attributes 6 No Married 60K No

describe an object 7 Yes Divorced 220K No
– Object is also known as 8 No Single 85K Yes
record, point, case, sample, 9 No Married 75K No
entity, or instance
10 No Single 90K Yes
10
Attribute Values

Attribute values are numbers or symbols

assigned to an attribute for a particular object

Distinction between attributes and attribute values

– Same attribute can be mapped to different attribute
values
◆ Example: height can be measured in feet or meters

– Different attributes can be mapped to the same set of

values
◆ Example: Attribute values for ID and age are integers
– But properties of attribute can be different than the
properties of the values used to represent the
attribute
 Measurement of Length
The way you measure an attribute may not match the
attributes properties.
5 A 1

B
7 2

C
This scale This scale
8 3
preserves preserves
only the the ordering
ordering D and
property of additivity
length. 10 4 properties of
length.
E

15 5
Types of Attributes

There are different types of attributes

– Nominal
◆ Examples: ID numbers, eye color, zip codes
– Ordinal
◆ Examples: rankings (e.g., taste of potato chips on a
scale from 1-10), grades, height {tall, medium, short}
– Interval
◆ Examples: calendar dates, temperatures in Celsius or
Fahrenheit.
– Ratio
◆ Examples: temperature in Kelvin, length, counts,
elapsed time (e.g., time to run a race)
Properties of Attribute Values

The type of an attribute depends on which of the

following properties/operations it possesses:
– Distinctness: = 
– Order: < >
– Differences are + -
meaningful :
– Ratios are * /
meaningful
– Nominal attribute: distinctness
– Ordinal attribute: distinctness & order
– Interval attribute: distinctness, order & meaningful
differences
– Ratio attribute: all 4 properties/operations
Difference Between Ratio and Interval

Is it physically meaningful to say that a

temperature of 10 ° is twice that of 5° on
– the Celsius scale?
– the Fahrenheit scale?
– the Kelvin scale?

Consider measuring the height above average

– If Bill’s height is three inches above average and
Bob’s height is six inches above average, then would
we say that Bob is twice as tall as Bill?
– Is this situation analogous to that of temperature?
 Attribute Description Examples Operations
Type
Nominal Nominal attribute zip codes, employee mode, entropy,
values only ID numbers, eye contingency
distinguish. (=, ) color, sex: {male, correlation, 2
Categorical
Qualitative

female} test

Ordinal Ordinal attribute hardness of minerals, median,

values also order {good, better, best}, percentiles, rank
objects. grades, street correlation, run
(<, >) numbers tests, sign tests
Interval For interval calendar dates, mean, standard
attributes, temperature in deviation,
differences between Celsius or Fahrenheit Pearson's
Quantitative
Numeric

values are correlation, t and

meaningful. (+, - ) F tests
Ratio For ratio variables, temperature in Kelvin, geometric mean,
both differences and monetary quantities, harmonic mean,
ratios are counts, age, mass, percent variation
meaningful. (*, /) length, current

This categorization of attributes is due to S. S. Stevens

 Attribute Transformation Comments
Type
Nominal Any permutation of values If all employee ID numbers
were reassigned, would it
make any difference?
Categorical
Qualitative

Ordinal An order preserving change of An attribute encompassing

values, i.e., the notion of good, better best
new_value = f(old_value) can be represented equally
where f is a monotonic function well by the values {1, 2, 3} or
by { 0.5, 1, 10}.

Interval new_value = a * old_value + b Thus, the Fahrenheit and

where a and b are constants Celsius temperature scales
Quantitative
Numeric

differ in terms of where their

zero value is and the size of a
unit (degree).
Ratio new_value = a * old_value Length can be measured in
meters or feet.

This categorization of attributes is due to S. S. Stevens

Discrete and Continuous Attributes

Discrete Attribute
– Has only a finite or countably infinite set of values
– Examples: zip codes, counts, or the set of words in a
collection of documents
– Often represented as integer variables.
– Note: binary attributes are a special case of discrete
attributes
Continuous Attribute
– Has real numbers as attribute values
– Examples: temperature, height, or weight.
– Practically, real values can only be measured and
represented using a finite number of digits.
– Continuous attributes are typically represented as floating-
point variables.
Asymmetric Attributes

Only presence (a non-zero attribute value) is regarded as

important
◆ Words present in documents
◆ Items present in customer transactions

If we met a friend in the grocery store would we ever say

the following?
“I see our purchases are very similar since we didn’t buy most
of the same things.”
Critiques of the attribute categorization

Incomplete
– Asymmetric binary
– Cyclical
– Multivariate
– Partially ordered
– Partial membership
– Relationships between the data

Real data is approximate and noisy

– This can complicate the recognition of the proper attribute type
– Treating one attribute type as another may be approximately
correct
Key Messages for Attribute Types

The types of operations you choose should be

“meaningful” for the type of data you have
– Distinctness, order, meaningful intervals, and meaningful
ratios are only four (among many possible) properties of
data

– The data type you see – often numbers or strings – may not
capture all the properties or may suggest properties that are
not present

– Analysis may depend on these other properties of the data

◆ Many statistical analyses depend only on the distribution

– In the end, what is meaningful can be specific to domain

Important Characteristics of Data

– Dimensionality (number of attributes)

◆ High dimensional data brings a number of challenges

– Sparsity
◆ Only presence counts

– Resolution
◆ Patterns depend on the scale

– Size
◆ Type of analysis may depend on size of data
Types of data sets
Record
– Data Matrix
– Document Data
– Transaction Data
Graph
– World Wide Web
– Molecular Structures
Ordered
– Spatial Data
– Temporal Data
– Sequential Data
– Genetic Sequence Data
Record Data

Data that consists of a collection of records, each

of which consists of a fixed set of attributes
Tid Refund Marital Taxable
Status Income Cheat

1 Yes Single 125K No

2 No Married 100K No
3 No Single 70K No
4 Yes Married 120K No
5 No Divorced 95K Yes
6 No Married 60K No
7 Yes Divorced 220K No
8 No Single 85K Yes
9 No Married 75K No
10 No Single 90K Yes
10
Data Matrix

If data objects have the same fixed set of numeric

attributes, then the data objects can be thought of as
points in a multi-dimensional space, where each
dimension represents a distinct attribute

Such a data set can be represented by an m by n matrix,

where there are m rows, one for each object, and n
columns, one for each attribute
Projection Projection Distance Load Thickness
of x Load of y load

10.23 5.27 15.22 2.7 1.2

12.65 6.25 16.22 2.2 1.1
Document Data

Each document becomes a ‘term’ vector

– Each term is a component (attribute) of the vector
– The value of each component is the number of times
the corresponding term occurs in the document.

timeout

season
coach

game
score
play
team

win
ball

lost
Document 1 3 0 5 0 2 6 0 2 0 2

Document 2 0 7 0 2 1 0 0 3 0 0

Document 3 0 1 0 0 1 2 2 0 3 0
Transaction Data

A special type of data, where

– Each transaction involves a set of items.
– For example, consider a grocery store. The set of products
purchased by a customer during one shopping trip constitute a
transaction, while the individual products that were purchased
are the items.
– Can represent transaction data as record data

TID Items
1 Bread, Coke, Milk
2 Beer, Bread
3 Beer, Coke, Diaper, Milk
4 Beer, Bread, Diaper, Milk
5 Coke, Diaper, Milk
 Graph Data

Examples: Generic graph, a molecule, and webpages

2
5 1
2
5

Benzene Molecule: C6H6

Ordered Data

Sequences of transactions
Items/Events

An element of
the sequence
Ordered Data

Genomic sequence data

GGTTCCGCCTTCAGCCCCGCGCC
CGCAGGGCCCGCCCCGCGCCGTC
GAGAAGGGCCCGCCTGGCGGGCG
GGGGGAGGCGGGGCCGCCCGAGC
CCAACCGAGTCCGACCAGGTGCC
CCCTCTGCTCGGCCTAGACCTGA
GCTCATTAGGCGGCAGCGGACAG
GCCAAGTAGAACACGCGAAGCGC
TGGGCTGCCTGCTGCGACCAGGG
Ordered Data

Spatio-Temporal Data

Average Monthly
Temperature of
land and ocean
Data Quality

Poor data quality negatively affects many data processing

efforts

Data mining example: a classification model for detecting

people who are loan risks is built using poor data
– Some credit-worthy candidates are denied loans
– More loans are given to individuals that default
Data Quality …

What kinds of data quality problems?

How can we detect problems with the data?
What can we do about these problems?

Examples of data quality problems:

– Noise and outliers
– Wrong data
– Fake data
– Missing values
– Duplicate data
Noise

For objects, noise is an extraneous object

For attributes, noise refers to modification of original values
– Examples: distortion of a person’s voice when talking on a poor phone
and “snow” on television screen
– The figures below show two sine waves of the same magnitude and
different frequencies, the waves combined, and the two sine waves with
random noise
◆ The magnitude and shape of the original signal is distorted
Outliers

Outliers are data objects with characteristics that

are considerably different than most of the other
data objects in the data set
– Case 1: Outliers are
noise that interferes
with data analysis

– Case 2: Outliers are

the goal of our analysis
◆ Credit card fraud
◆ Intrusion detection

Causes?
Missing Values

Reasons for missing values

– Information is not collected
(e.g., people decline to give their age and weight)
– Attributes may not be applicable to all cases
(e.g., annual income is not applicable to children)

Handling missing values

– Eliminate data objects or variables
– Estimate missing values
◆ Example: time series of temperature
◆ Example: census results

– Ignore the missing value during analysis

Duplicate Data

Data set may include data objects that are

duplicates, or almost duplicates of one another
– Major issue when merging data from heterogeneous
sources

Examples:
– Same person with multiple email addresses

Data cleaning
– Process of dealing with duplicate data issues

When should duplicate data not be removed?

Similarity and Dissimilarity Measures

Similarity measure
– Numerical measure of how alike two data objects are.
– Is higher when objects are more alike.
– Often falls in the range [0,1]
Dissimilarity measure
– Numerical measure of how different two data objects
are
– Lower when objects are more alike
– Minimum dissimilarity is often 0
– Upper limit varies
Proximity refers to a similarity or dissimilarity
 Similarity/Dissimilarity for Simple Attributes

The following table shows the similarity and dissimilarity

between two objects, x and y, with respect to a single, simple
attribute.
Euclidean Distance

Euclidean Distance

where n is the number of dimensions (attributes) and

xk and yk are, respectively, the kth attributes
(components) or data objects x and y.

Standardization is necessary, if scales differ.

Euclidean Distance

3
point x y
2 p1
p1 0 2
p3 p4
1
p2 2 0
p2 p3 3 1
0 p4 5 1
0 1 2 3 4 5 6

p1 p2 p3 p4
p1 0 2.828 3.162 5.099
p2 2.828 0 1.414 3.162
p3 3.162 1.414 0 2
p4 5.099 3.162 2 0
Distance Matrix
Minkowski Distance

Minkowski Distance is a generalization of Euclidean

Distance

Where r is a parameter, n is the number of dimensions

(attributes) and xk and yk are, respectively, the kth
attributes (components) or data objects x and y.
Minkowski Distance: Examples

r = 1. City block (Manhattan, taxicab, L1 norm) distance.

– A common example of this for binary vectors is the
Hamming distance, which is just the number of bits that are
different between two binary vectors

r = 2. Euclidean distance

r → . “supremum” (Lmax norm, L norm) distance.

– This is the maximum difference between any component of
the vectors

Do not confuse r with n, i.e., all these distances are

defined for all numbers of dimensions.
Minkowski Distance

L1 p1 p2 p3 p4
p1 0 4 4 6
p2 4 0 2 4
p3 4 2 0 2
p4 6 4 2 0
point x y
p1 0 2 L2 p1 p2 p3 p4
p2 2 0 p1 0 2.828 3.162 5.099
p3 3 1 p2 2.828 0 1.414 3.162
p4 5 1 p3 3.162 1.414 0 2
p4 5.099 3.162 2 0

L p1 p2 p3 p4
p1 0 2 3 5
p2 2 0 1 3
p3 3 1 0 2
p4 5 3 2 0

Distance Matrix
 Mahalanobis Distance

𝐦𝐚𝐡𝐚𝐥𝐚𝐧𝐨𝐛𝐢𝐬 𝐱, 𝐲 = ((𝐱 − 𝐲)𝑇 Ʃ−1 (𝐱 − 𝐲))-0.5

 is the covariance matrix

For red points, the Euclidean distance is 14.7, Mahalanobis distance is 6.

Mahalanobis Distance

Covariance
Matrix:
 0.3 0.2
= 
C
 0.2 0.3
B A: (0.5, 0.5)
B: (0, 1)
A
C: (1.5, 1.5)

Mahal(A,B) = 5
Mahal(A,C) = 4
Common Properties of a Distance

Distances, such as the Euclidean distance,

have some well known properties.
1. d(x, y)  0 for all x and y and d(x, y) = 0 if and only
if x = y.
2. d(x, y) = d(y, x) for all x and y. (Symmetry)
3. d(x, z)  d(x, y) + d(y, z) for all points x, y, and z.
(Triangle Inequality)

where d(x, y) is the distance (dissimilarity) between

points (data objects), x and y.

A distance that satisfies these properties is a

metric
Common Properties of a Similarity

Similarities, also have some well known

properties.

1. s(x, y) = 1 (or maximum similarity) only if x = y.

(does not always hold, e.g., cosine)
2. s(x, y) = s(y, x) for all x and y. (Symmetry)

where s(x, y) is the similarity between points (data

objects), x and y.
Similarity Between Binary Vectors
Common situation is that objects, x and y, have only
binary attributes

Compute similarities using the following quantities

f01 = the number of attributes where x was 0 and y was 1
f10 = the number of attributes where x was 1 and y was 0
f00 = the number of attributes where x was 0 and y was 0
f11 = the number of attributes where x was 1 and y was 1

Simple Matching and Jaccard Coefficients

SMC = number of matches / number of attributes
= (f11 + f00) / (f01 + f10 + f11 + f00)

J = number of 11 matches / number of non-zero attributes

= (f11) / (f01 + f10 + f11)
SMC versus Jaccard: Example

x= 1000000000
y= 0000001001

f01 = 2 (the number of attributes where x was 0 and y was 1)

f10 = 1 (the number of attributes where x was 1 and y was 0)
f00 = 7 (the number of attributes where x was 0 and y was 0)
f11 = 0 (the number of attributes where x was 1 and y was 1)

SMC = (f11 + f00) / (f01 + f10 + f11 + f00)

= (0+7) / (2+1+0+7) = 0.7

J = (f11) / (f01 + f10 + f11) = 0 / (2 + 1 + 0) = 0

Cosine Similarity

If d1 and d2 are two document vectors, then

cos( d1, d2 ) = <d1,d2> / ||d1|| ||d2|| ,
where <d1,d2> indicates inner product or vector dot
product of vectors, d1 and d2, and || d || is the length of
vector d.

Example:
d1 = 3 2 0 5 0 0 0 2 0 0
d2 = 1 0 0 0 0 0 0 1 0 2
<d1, d2> = 3*1 + 2*0 + 0*0 + 5*0 + 0*0 + 0*0 + 0*0 + 2*1 + 0*0 + 0*2 = 5
| d1 || = (3*3+2*2+0*0+5*5+0*0+0*0+0*0+2*2+0*0+0*0)0.5 = (42) 0.5 = 6.481
|| d2 || = (1*1+0*0+0*0+0*0+0*0+0*0+0*0+1*1+0*0+2*2) 0.5 = (6) 0.5 = 2.449
cos(d1, d2 ) = 0.3150
Correlation measures the linear relationship
between objects
Visually Evaluating Correlation

Scatter plots
showing the
similarity from
–1 to 1.
 Drawback of Correlation

x = (-3, -2, -1, 0, 1, 2, 3)

y = (9, 4, 1, 0, 1, 4, 9)

yi = xi2

mean(x) = 0, mean(y) = 4
std(x) = 2.16, std(y) = 3.74

corr = (-3)(5)+(-2)(0)+(-1)(-3)+(0)(-4)+(1)(-3)+(2)(0)+3(5) / ( 6 * 2.16 * 3.74 )

=0
Correlation vs Cosine vs Euclidean Distance
Compare the three proximity measures according to their behavior under
variable transformation
– scaling: multiplication by a value
– translation: adding a constant
Property Cosine Correlation Euclidean Distance
Invariant to scaling Yes Yes No
(multiplication)
Invariant to translation No Yes No
(addition)

Consider the example

– x = (1, 2, 4, 3, 0, 0, 0), y = (1, 2, 3, 4, 0, 0, 0)
– ys = y * 2 (scaled version of y), yt = y + 5 (translated version)

Measure (x , y) (x , ys) (x , yt)

Cosine 0.9667 0.9667 0.7940

Correlation 0.9429 0.9429 0.9429

Euclidean Distance 1.4142 5.8310 14.2127

Correlation vs cosine vs Euclidean distance

Choice of the right proximity measure depends on the domain

What is the correct choice of proximity measure for the
following situations?
– Comparing documents using the frequencies of words
◆ Documents are considered similar if the word frequencies are similar

– Comparing the temperature in Celsius of two locations

◆ Two locations are considered similar if the temperatures are similar in
magnitude

– Comparing two time series of temperature measured in Celsius

◆ Two time series are considered similar if their “shape” is similar, i.e., they
vary in the same way over time, achieving minimums and maximums at
similar times, etc.
Comparison of Proximity Measures

Domain of application
– Similarity measures tend to be specific to the type of
attribute and data
– Record data, images, graphs, sequences, 3D-protein
structure, etc. tend to have different measures
However, one can talk about various properties that
you would like a proximity measure to have
– Symmetry is a common one
– Tolerance to noise and outliers is another
– Ability to find more types of patterns?
– Many others possible
The measure must be applicable to the data and
produce results that agree with domain knowledge
Information Based Measures

Information theory is a well-developed and

fundamental disciple with broad applications

Some similarity measures are based on

information theory
– Mutual information in various versions
– Maximal Information Coefficient (MIC) and related
measures
– General and can handle non-linear relationships
– Can be complicated and time intensive to compute
Information and Probability

Information relates to possible outcomes of an event

– transmission of a message, flip of a coin, or measurement
of a piece of data

The more certain an outcome, the less information

that it contains and vice-versa
– For example, if a coin has two heads, then an outcome of
heads provides no information
– More quantitatively, the information is related the
probability of an outcome
◆ The smaller the probability of an outcome, the more information it
provides and vice-versa
– Entropy is the commonly used measure
Entropy

For
– a variable (event), X,
– with n possible values (outcomes), x1, x2 …, xn
– each outcome having probability, p1, p2 …, pn
– the entropy of X , H(X), is given by
𝑛

𝐻 𝑋 = − ෍ 𝑝𝑖 log 2 𝑝𝑖
𝑖=1

Entropy is between 0 and log2n and is measured in

bits
– Thus, entropy is a measure of how many bits it takes to
represent an observation of X on average
Entropy Examples

For a coin with probability p of heads and

probability q = 1 – p of tails
𝐻 = −𝑝 log 2 𝑝 − 𝑞 log 2 𝑞
– For p= 0.5, q = 0.5 (fair coin) H = 1
– For p = 1 or q = 1, H = 0

What is the entropy of a fair four-sided die?

Entropy for Sample Data: Example

Hair Color Count p -plog2p

Black 75 0.75 0.3113
Brown 15 0.15 0.4105
Blond 5 0.05 0.2161
Red 0 0.00 0
Other 5 0.05 0.2161
Total 100 1.0 1.1540

Maximum entropy is log25 = 2.3219

Entropy for Sample Data

Suppose we have
– a number of observations (m) of some attribute, X,
e.g., the hair color of students in the class,
– where there are n different possible values
– And the number of observation in the ith category is mi
– Then, for this sample
𝑛
𝑚𝑖 𝑚𝑖
𝐻 𝑋 = − ෍ log 2
𝑚 𝑚
𝑖=1

For continuous data, the calculation is harder

Mutual Information

Information one variable provides about another

Formally, 𝐼 𝑋, 𝑌 = 𝐻 𝑋 + 𝐻 𝑌 − 𝐻(𝑋, 𝑌), where

H(X,Y) is the joint entropy of X and Y,

𝐻 𝑋, 𝑌 = − ෍ ෍ 𝑝𝑖𝑗log 2 𝑝𝑖𝑗
𝑖 𝑗
Where pij is the probability that the ith value of X and the jth value of Y
occur together

For discrete variables, this is easy to compute

Maximum mutual information for discrete variables is

log2(min( nX, nY ), where nX (nY) is the number of values of X (Y)
 Mutual Information Example

Student Count p -plog2p Student Grade Count p -plog2p

Status Status
Undergrad 45 0.45 0.5184
Undergrad A 5 0.05 0.2161
Grad 55 0.55 0.4744
Undergrad B 30 0.30 0.5211
Total 100 1.00 0.9928
Undergrad C 10 0.10 0.3322

Grade Count p -plog2p Grad A 30 0.30 0.5211

A 35 0.35 0.5301 Grad B 20 0.20 0.4644

B 50 0.50 0.5000 Grad C 5 0.05 0.2161
C 15 0.15 0.4105 Total 100 1.00 2.2710
Total 100 1.00 1.4406

Mutual information of Student Status and Grade = 0.9928 + 1.4406 - 2.2710 = 0.1624
Maximal Information Coefficient
Reshef, David N., Yakir A. Reshef, Hilary K. Finucane, Sharon R. Grossman, Gilean McVean, Peter
J. Turnbaugh, Eric S. Lander, Michael Mitzenmacher, and Pardis C. Sabeti. "Detecting novel
associations in large data sets." science 334, no. 6062 (2011): 1518-1524.

Applies mutual information to two continuous

variables
Consider the possible binnings of the variables into
discrete categories
– nX × nY ≤ N0.6 where
◆ nX is the number of values of X
◆ nY is the number of values of Y
◆ N is the number of samples (observations, data objects)
Compute the mutual information
– Normalized by log2(min( nX, nY )
Take the highest value
General Approach for Combining Similarities

Sometimes attributes are of many different types, but an

overall similarity is needed.
1: For the kth attribute, compute a similarity, sk(x, y), in the
range [0, 1].
2: Define an indicator variable, k, for the kth attribute as
follows:
k = 0 if the kth attribute is an asymmetric attribute and
both objects have a value of 0, or if one of the objects
has a missing value for the kth attribute
k = 1 otherwise
3. Compute
Using Weights to Combine Similarities

May not want to treat all attributes the same.

– Use non-negative weights 𝜔𝑘

σ𝑛
𝑘=1 𝜔𝑘 𝛿𝑘 𝑠𝑘 (𝐱,𝐲)
– 𝑠𝑖𝑚𝑖𝑙𝑎𝑟𝑖𝑡𝑦 𝐱, 𝐲 = σ𝑛
𝑘=1 𝜔𝑘 𝛿𝑘

Can also define a weighted form of distance

Data Preprocessing

Aggregation
Sampling
Discretization and Binarization
Attribute Transformation
Dimensionality Reduction
Feature subset selection
Feature creation
Aggregation

Combining two or more attributes (or objects) into a single

attribute (or object)
Purpose
– Data reduction - reduce the number of attributes or objects
– Change of scale
◆ Cities aggregated into regions, states, countries, etc.
◆ Days aggregated into weeks, months, or years
– More “stable” data - aggregated data tends to have less variability
Example: Precipitation in Australia

This example is based on precipitation in

Australia from the period 1982 to 1993.
The next slide shows
– A histogram for the standard deviation of average
monthly precipitation for 3,030 0.5◦ by 0.5◦ grid cells in
Australia, and
– A histogram for the standard deviation of the average
yearly precipitation for the same locations.
The average yearly precipitation has less
variability than the average monthly precipitation.
All precipitation measurements (and their
standard deviations) are in centimeters.
Example: Precipitation in Australia …

Variation of Precipitation in Australia

Standard Deviation of Average Standard Deviation of

Monthly Precipitation Average Yearly Precipitation
Sampling
Sampling is the main technique employed for data
reduction.
– It is often used for both the preliminary investigation of
the data and the final data analysis.

Statisticians often sample because obtaining the

entire set of data of interest is too expensive or
time consuming.

Sampling is typically used in data mining because

processing the entire set of data of interest is too
expensive or time consuming.
Sampling …

The key principle for effective sampling is the

following:

– Using a sample will work almost as well as using the

entire data set, if the sample is representative

– A sample is representative if it has approximately the

same properties (of interest) as the original set of data
Sample Size

8000 points 2000 Points 500 Points

Types of Sampling
Simple Random Sampling
– There is an equal probability of selecting any particular
item
– Sampling without replacement
◆ As each item is selected, it is removed from the
population
– Sampling with replacement
◆ Objects are not removed from the population as they
are selected for the sample.
◆ In sampling with replacement, the same object can
be picked up more than once
Stratified sampling
– Split the data into several partitions; then draw random
samples from each partition
Sample Size
What sample size is necessary to get at least one
object from each of 10 equal-sized groups.
Discretization

Discretization is the process of converting a

continuous attribute into an ordinal attribute
– A potentially infinite number of values are mapped
into a small number of categories
– Discretization is used in both unsupervised and
supervised settings
Unsupervised Discretization

Data consists of four groups of points and two outliers. Data is one-
dimensional, but a random y component is added to reduce overlap.
Unsupervised Discretization

Equal interval width approach used to obtain 4 values.

Unsupervised Discretization

Equal frequency approach used to obtain 4 values.

Unsupervised Discretization

K-means approach to obtain 4 values.

Discretization in Supervised Settings

– Many classification algorithms work best if both the independent

and dependent variables have only a few values
– We give an illustration of the usefulness of discretization using
the following example.
Binarization

Binarization maps a continuous or categorical

attribute into one or more binary variables
Attribute Transformation

An attribute transform is a function that maps the

entire set of values of a given attribute to a new
set of replacement values such that each old
value can be identified with one of the new values
– Simple functions: xk, log(x), ex, |x|
– Normalization
◆ Refers to various techniques to adjust to
differences among attributes in terms of frequency
of occurrence, mean, variance, range
◆ Take out unwanted, common signal, e.g.,
seasonality
– In statistics, standardization refers to subtracting off
the means and dividing by the standard deviation
Example: Sample Time Series of Plant Growth
Minneapolis

Net Primary
Production (NPP)
is a measure of
plant growth used
by ecosystem
scientists.

Correlations between time series

Correlations between time series
Minneapolis Atlanta Sao Paolo
Minneapolis 1.0000 0.7591 -0.7581
Atlanta 0.7591 1.0000 -0.5739
Sao Paolo -0.7581 -0.5739 1.0000
Seasonality Accounts for Much Correlation
Minneapolis
Normalized using
monthly Z Score:
Subtract off monthly
mean and divide by
monthly standard
deviation

Correlations between time series

Correlations between time series
Minneapolis Atlanta Sao Paolo
Minneapolis 1.0000 0.0492 0.0906
Atlanta 0.0492 1.0000 -0.0154
Sao Paolo 0.0906 -0.0154 1.0000
Curse of Dimensionality

When dimensionality
increases, data becomes
increasingly sparse in the
space that it occupies

Definitions of density and

distance between points,
which are critical for
clustering and outlier
detection, become less
meaningful •Randomly generate 500 points
•Compute difference between max and
min distance between any pair of points
Dimensionality Reduction

Purpose:
– Avoid curse of dimensionality
– Reduce amount of time and memory required by data
mining algorithms
– Allow data to be more easily visualized
– May help to eliminate irrelevant features or reduce
noise

Techniques
– Principal Components Analysis (PCA)
– Singular Value Decomposition
– Others: supervised and non-linear techniques
Dimensionality Reduction: PCA

Goal is to find a projection that captures the

largest amount of variation in data
x2

x1
Dimensionality Reduction: PCA
Feature Subset Selection

Another way to reduce dimensionality of data

Redundant features
– Duplicate much or all of the information contained in
one or more other attributes
– Example: purchase price of a product and the amount
of sales tax paid
Irrelevant features
– Contain no information that is useful for the data
mining task at hand
– Example: students' ID is often irrelevant to the task of
predicting students' GPA
Many techniques developed, especially for
classification
Feature Creation

Create new attributes that can capture the

important information in a data set much more
efficiently than the original attributes

Three general methodologies:

– Feature extraction
◆ Example: extracting edges from images
– Feature construction
◆ Example: dividing mass by volume to get density
– Mapping data to new space
◆ Example: Fourier and wavelet analysis
Mapping Data to a New Space

Fourier and wavelet transform

Frequency

Two Sine Waves + Noise Frequency