Thanks to visit codestin.com
Credit goes to www.scribd.com

0% found this document useful (0 votes)
282 views358 pages

CS702 Handout

The document provides an overview of an advanced algorithms course, including the objectives to design and analyze modern algorithms, compare efficiencies, and solve real-world problems. It also outlines several algorithm design techniques like brute force, divide-and-conquer, and dynamic programming.

Uploaded by

nayyar
Copyright
© © All Rights Reserved
We take content rights seriously. If you suspect this is your content, claim it here.
Available Formats
Download as PDF, TXT or read online on Scribd
0% found this document useful (0 votes)
282 views358 pages

CS702 Handout

The document provides an overview of an advanced algorithms course, including the objectives to design and analyze modern algorithms, compare efficiencies, and solve real-world problems. It also outlines several algorithm design techniques like brute force, divide-and-conquer, and dynamic programming.

Uploaded by

nayyar
Copyright
© © All Rights Reserved
We take content rights seriously. If you suspect this is your content, claim it here.
Available Formats
Download as PDF, TXT or read online on Scribd
You are on page 1/ 358

1 CS-702 Advanced Algorithms Analysis and Design

Advanced Algorithms Analysis and Design


…………………………………………………………………………………………………………..

Table of Contents

Chapter 1: Model of Computation


Lecture No 1: Introduction of Algorithms ……….…….…………………………………………03

Chapter 2: Mathematical Tools


Lecture No 2: Fundamentals of Algorithms ………..……………………………………………08
Lecture No 3: Logic and Proving Techniques …..………………………………………………13
Lecture No 4: Mathematical Induction……………………………………………………………19
Lecture No 5: Strong Mathematical Induction……………………………………...……………25

Chapter 3: Recursion
Lecture No 6: Fibonacci Sequences...………………………..……………………………….…29
Lecture No 7: Recurrence Relations I..…………………………………………………………..39
Lecture No 8: Recurrence Relations II…..…………………………………………………….…49
Lecture No 9: Algorithms Analysis Techniques …………………………………………………55

Chapter 4: Asymptotic Notations


Lecture No 10: Time Complexity of Algorithms..………………………………………………..67
Lecture No 11: Relations over Asymptotic Notations………………………….……………….76

Chapter 5: Brute Force Approach, Divide and Conquer


Lecture No 12: Design of Algorithms using Brute Force Approach…………………………..83
Lecture No 13: Design of Algorithms using Brute Force, Divide & Conquer Approaches….91
Lecture No 14: Design of Algorithms using Divide & Conquer Approaches……….………..95

Chapter 6: Dynamic Programming


Lecture No 15: Chain Matrix Multiplication using Brute Force……………………………….106
Lecture No 16: Chain Matrix Multiplication using Dynamic Programming…………….……113
Lecture No 17: Assembly-Line Scheduling Problem …………………...…………………….119
Lecture No 18: 2-Line Assembly Scheduling Problem……………………………………..…126
Lecture No 19: 0-1 Knapsack Problem using Dynamic Programming………………..…….133
Lecture No 20: Optimal Weight Triangulation I...…..………………………………………….142
Lecture No 21: Optimal Weight Triangulation II…....………………………………………….152
Lecture No 22: Review Lectures 1-21…………………..………………………………………159

Mid-Term 2015 Exam Questions………………………………………………………………166

Lecture No 23: Longest Common Subsequence………………………………………………167


Lecture No 24: Optimal Binary Search Trees…….…………………………………………….177

Dr. Nazir Ahmad Zafar | Virtual University of Pakistan


2 CS-702 Advanced Algorithms Analysis and Design

Chapter 7: Greedy Algorithms


Lecture No 25: Greedy Algorithm………………………………………………………………..181
Lecture No 26: Huffman Coding…………………….……………………………………………190

Chapter 8: Graph Theoretic Algorithms


Lecture No 27: Huffman Coding Problem and Graph Theory…………………………………197
Lecture No 28: Breadth First Search ……………….……………………………………………207
Lecture No 29: Depth First Search…………………………..…………………………………...217
Lecture No 30: White Path Theorem……………………………………………………………..225
Lecture No 31: Backtracking and Branch & Bound Algorithms ………..……………………. 233
Lecture No 32: Minimal Spanning Tree Problem……………………………………………….236
Lecture No 33: Single-Source Shortest Path…..………………………………………………..249
Lecture No 34: Bellman-Ford Algorithm………………………………………………………….258
Lecture No 35: Dijkstra‟s Algorithm ……………………...………………………………………264
Lecture No 36: All Pairs Shortest Paths………………………………………………………….272
Lecture No 37: Floyd-Warshall Algorithm & Johnson‟s Algorithm…….………………………278

Chapter 9: Number Theoretic Algorithms


Lecture No 38: Number Theoretic Algorithms…………………………………………………..290
Lecture No 39: Theorems and Algorithms……………..………………………………………..300
Lecture No 40: Chinese Remainder Theorem………….……………………………………….310

Chapter 10: Further Topics


Lecture No 41: RSA Cryptosystem……………………………………………………………….317
Lecture No 42: String Matching……………..…………………………………………………….322
Lecture No 43: Polynomials and Fast Fourier Transform………………………………………331
Lecture No 44: NP Completeness………………………………………………………………..340
Lecture No 45: Review Lecture…….……………………………………………………………..350

Final-Term 2015 Exam Questions………………………………………………………………358

Presented By:

Dr. Nazir Ahmad Zafar


Virtual University of Pakistan
……………………………………………...

Published by: Safi Khan


www.vumultan.com

Dr. Nazir Ahmad Zafar | Virtual University of Pakistan


3 CS-702 Advanced Algorithms Analysis and Design

Lecture No 1
Introduction of Algorithms
(What, Why and Where)

Major objective of this course is:


• Design and analysis of modern • Motivation thinking new algorithms
algorithms • Advanced designing techniques
• Different variants • Real world problems will be taken as
• Accuracy examples
• Efficiency • To create feelings about usefulness
• Comparing efficiencies of this course

Major objective of this course is:


• Design and analysis of modern • Motivation thinking new algorithms
algorithms • Advanced designing techniques
• Different variants • Real world problems will be taken as
• Accuracy examples
• Efficiency • To create feelings about usefulness
• Comparing efficiencies of this course

Expected Results
On successful completion, students will be able to
• Argue and prove correctness of algorithms
• Derive and solve mathematical models of problems
• Reasoning when an algorithm calls certain approach
• Analyze average and worst-case running times
• Integrating approaches in dynamic and greedy algos.
• Use of graph theory in problems solving
• Advanced topics such as
• Computational geometry, number theory etc.
• Several other algorithms such as
• String matching, NP completeness, approximate algorithms etc.

In this lecture we will cover the following


• What is Algorithm?
• Designing Techniques
• Model of Computation
• Algorithms as a technology
• Algorithms and other technologies
• Importance of algorithms
• Difference in Users and Developers
• Kinds of problems solved by algorithms
• Conclusion

Dr. Nazir Ahmad Zafar | Virtual University of Pakistan


4 CS-702 Advanced Algorithms Analysis and Design

What is Algorithm?
• A computer algorithm is a detailed step-by-step method for solving a problem by using a
computer.
• An algorithm is a sequence of unambiguous instructions for solving a problem in a finite
amount of time.
• An Algorithm is well defined computational procedure that takes some value, or set of
values, as input and produces some value, or set of values as output.
• More generally, an Algorithm is any well defined computational procedure that takes
collection of elements as input and produces a collection of elements as output.

Popular Algorithms, Factors of Dependence

• Most basic and popular algorithms are


– Sorting algorithms
– Searching algorithms

Which algorithm is best?


• Mainly, it depends upon various factors, for example in case of sorting
– The number of items to be sorted
– The extent to which the items are already sorted
– Possible restrictions on the item values
– The kind of storage device to be used etc.

One Problem, Many Algorithms

Problem
• The statement of the problem specifies, in general terms, the desired input/output
relationship.

Algorithm
• The algorithm describes a specific computational procedure for achieving input/output
relationship.

Example
• One might need to sort a sequence of numbers into non-decreasing order.

Algorithms
• Various algorithms e.g. merge sort, quick sort, heap sorts etc.

Dr. Nazir Ahmad Zafar | Virtual University of Pakistan


5 CS-702 Advanced Algorithms Analysis and Design

Important Designing Techniques


• Brute Force
– Straightforward, naive approach
– Mostly expensive
• Divide-and-Conquer
– Divide into smaller sub-problems
• Iterative Improvement
– Improve one change at a time
• Decrease-and-Conquer
– Decrease instance size
• Transform-and-Conquer
– Modify problem first and then solve it
• Space and Time Tradeoffs
– Use more space now to save time later

Some of the Important Designing Techniques


• Greedy Approach
– Locally optimal decisions, can not change once made.
– Efficient
– Easy to implement
– The solution is expected to be optimal
– Every problem may not have greedy solution
• Dynamic programming
– Decompose into sub-problems like divide and conquer
– Sub-problems are dependant
– Record results of smaller sub-problems
– Re-use it for further occurrence
– Mostly reduces complexity exponential to polynomial

Problem Solving Phases


• Analysis
– How does system work?
– Breaking a system down to known components
– How components (processes) relate to each other
– Breaking a process down to known functions
• Synthesis
– Building tools
– Building functions with supporting tools
– Composing functions to form a process
– How components should be put together?
– Final solution

Dr. Nazir Ahmad Zafar | Virtual University of Pakistan


6 CS-702 Advanced Algorithms Analysis and Design

Problem Solving Process


• Problem • Analysis
• Strategy – Correctness
• Algorithm – Time & Space
– Input – Optimality
– Output • Implementation
– Steps • Verification

Model of Computation (Assumptions)


• Design assumption
– Level of abstraction which meets our requirements
– Neither more nor less e.g. [0, 1] infinite continuous interval
• Analysis independent of the variations in
– Machine
– Operating system
– Programming languages
– Compiler etc.
• Low-level details will not be considered
• Our model will be an abstraction of a standard generic single-processor machine, called
a random access machine or RAM.
• A RAM is assumed to be an idealized machine
– Infinitely large random-access memory
– Instructions execute sequentially
• Every instruction is in fact a basic operation on two values in the machines memory
which takes unit time.
• These might be characters or integers.
• Example of basic operations include
– Assigning a value to a variable
– Arithmetic operation (+, - , × , /) on integers
– Performing any comparison e.g. a < b
– Boolean operations
– Accessing an element of an array.
• In theoretical analysis, computational complexity
– Estimated in asymptotic sense, i.e.
– Estimating for large inputs
• Big O, Omega, Theta etc. notations are used to compute the complexity
• Asymptotic notations are used because different implementations of algorithm may differ
in efficiency
• Efficiencies of two given algorithm are related
– By a constant multiplicative factor
– Called hidden constant.

Dr. Nazir Ahmad Zafar | Virtual University of Pakistan


7 CS-702 Advanced Algorithms Analysis and Design

Drawbacks in Model of Computation


First poor assumption
• We assumed that each basic operation takes constant time, i.e. model allows
– Adding
– Multiplying
– Comparing etc.
• two number of any length in constant time
• Addition of two numbers takes a unit time!
– Not good because numbers may be arbitrarily
• Addition and multiplication both take unit time!
– Again very bad assumption

Model of Computation not so Bad


Finally what about Our Model?
• But with all these weaknesses, our model is not so bad because we have to give the
– Comparison not the absolute analysis of any algorithm.
– We have to deal with large inputs not with the small size
• Model seems to work well describing computational power of modern nonparallel
machines
Can we do Exact Measure of Efficiency ?
• Exact, not asymptotic, measure of efficiency can be sometimes computed but it usually
requires certain assumptions concerning implementation

Summary: Computational Model


• Analysis will be performed with respect to this computational model for comparison of
algorithms
• We will give asymptotic analysis not detailed comparison i.e. for large inputs
• We will use generic uniprocessor random-access machine (RAM) in analysis
– All memory equally expensive to access
– No concurrent operations
– All reasonable instructions take unit time, except, of course, function calls
Conclusion
• What, Why and Where Algorithms?
• Designing Techniques
• Problem solving Phases and Procedure
• Model of computations
– Major assumptions at design and analysis level
– Merits and demerits, justification of assumptions taken
• We proved that algorithm is a technology
• Compared algorithmic technology with others
• Discussed importance of algorithms
– In almost all areas of computer science and engineering
– Algorithms make difference in users and developers

Dr. Nazir Ahmad Zafar | Virtual University of Pakistan


8 CS-702 Advanced Algorithms Analysis and Design

Lecture No 2
Mathematical Tools for Design and Analysis of Algorithms
(Fundamentals of Algorithms)
• Introduction to Algorithms
• Designing Techniques
• Algorithm is a Technology
• Model of Computation
• Even we have supercomputers, it requires algorithm
• Algorithms makes difference in users and modeler
• Some of the applications areas of algorithms
– Management and manipulation of data
– Electronic commerce
– Manufacturing and other commercial settings
– Shortest paths etc.

A Sequence of Mathematical Tools


• Sets • Relation
• Sequences • Functions
• Order pairs • Operators over above structures
• Cross Product • Conclusion
• A set is well defined collection of objects, which are
– unordered
– distinct
– same type
– with common properties
Notation:
• Elements of set are listed between a pair of curly braces
S1 = {R, R, R, B, G} = {R, B, G} = {B, G, R}

Empty Set
• S3 = { } = , has not elements, called empty set
• Three ways to represent a set
• Descriptive Form
• Tabular form
• Set Builder Form (Set Comprehension)
Example
• Descriptive Form S = set of all prime numbers
• Tabular form {2, 3, 5, . . .}
• Set Builder Form {x : N| ( i  {2, 3, . . ., x-1}   (i / x))  x}

Set Comprehension
Some More Examples
{x : s | p  x} = {x : s | p} = all x in s that satisfy p
1. {x : Z | x2 = x  x} = {0, 1}
2. {x : N | x  0 mod 2  x} = {0, 2, 4, . . . }
3. {x : N | x  1 mod 2  x} = {1, 3, 5, . . . }
4. {x : Z | x ≥ 0  x ≤ 6  x} = {0, 1, 2, 3, 4, 5, 6}
5. {x : Z | x ≥ 0  x ≤ 6  x2} = {0, 1, 4, . . ., 25, 36}
6. {x : N | x  1 mod 2  x3} = {1, 27, 125, . . . }

Dr. Nazir Ahmad Zafar | Virtual University of Pakistan


9 CS-702 Advanced Algorithms Analysis and Design

All collections are not sets


• The prime numbers Primes == {2, 3, 5, 7, . . . }
• The four oceans of the world Oceans == {Atlantic, Arctic, Indian, Pacific}
• The passwords that may be generated using eight lower-case letters, when repetition is
allowed
• Hard working students in MSCS class session 2007-09 at Virtual University
• Intelligent students in your class
• Kind teachers at VU

Operators over Sets


Membership Operator
• If an element e is a member of set S then it is denoted as e  S and read e is in S. Let S
is sub-collection of X
X = a set
SX
Now
 : X x P X Bool
 (x, S) = = 1 if x is in S
0 if x is not in S
Subset:
If each element of A is also in B, then A is said to be a subset of B, A  B and B is superset of
A, B  A.
Let X = a universal set, A  X, B  X, Now
 : X x X  Bool
 (A, B) = = 1, if  x : X, x  A  x  B
0 if  x : X, x  A  x  B
Intersection
 : X x X  X
 (A, B) = = {x : X | x  A and x  B  x}
Union
 : X x X  X
 (A, B) = = {x : X | x  A or x  B  x}
Set Difference
\ : X x X  X
\ (A, B) = = {x : X | x  A but x  B  x}

Cardinality and Power Set of a given Set


• A set, S, is finite if there is an integer n such that the elements of S can be placed in a
one-to-one correspondence with {1, 2, 3, …, n}, and we say that cardinality is n. We
write as: |S| = n

Power Set
• How many distinct subsets does a finite set on n elements have? There are 2n subsets.
• How many distinct subsets of cardinality k does a finite set of n elements have?
There are n n!
C (n, k ) Ck    
n

 k  (n  k )!k!

Dr. Nazir Ahmad Zafar | Virtual University of Pakistan


10 CS-702 Advanced Algorithms Analysis and Design

Partitioning of a set
A partition of a set A is a set of non-empty subsets of A such that every element x in A exactly
belong to one of these subsets.
Equivalently, set P of subsets of A, is a partition of A
1. If no element of P is empty
2. The union of the elements of P is equal to A. We say the elements of P cover A.
3. The intersection of any two elements of P is empty. That means the elements of P are
pair wise disjoints

Mathematical Way of Defining Partitioning


A partition P of a set A is a collection {A1, A2, . . ., An} such that following are satisfied
1.  Ai  P, Ai  ,
2. Ai  Aj = ,  i, j  {1, 2, . . ., n} and i  j
3. A = A1  A2  . . . An
Example: Partitioning of Z Modulo 4
{x : Z | x  0 mod 4} = {. . .-8, -4, 0, 4, 8, . . . } = [0]
{x : Z | x  1 mod 4} = {. . .-7, -3, 1, 5, 9, . . . } = [1]
{x : Z | x  2 mod 4} = {. . .-6, -2, 2, 6, 10, . . . } = [ 2]
{x : Z | x  3 mod 4} = {. . .-5, -1, 3, 7, 11, . . . } = [3]
{x : Z | x  4 mod 4} = {. . .,-8, -4, 0, 4, 8, . . . } = [4]

Sequence
• It is sometimes necessary to record the order in which objects are arranged, e.g.,
• Data may be indexed by an ordered collection of keys
• Messages may be stored in order of arrival
• Tasks may be performed in order of importance.
• Names can be sorted in order of alphabets etc.
Definition
• A group of elements in a specified order is called a sequence.
• A sequence can have repeated elements.

Sequence
Notation: Sequence is defined by listing elements in order, enclosed in parentheses. e.g.
S = (a, b, c), T = (b, c, a), U = (a, a, b, c)
Sequence is a set
S = {(1, a), (2, b), (3, c)} = {(3, c), (2, b), (1, a)}
Permutation: If all elements of a finite sequence are distinct, that sequence is said to be a
permutation of the finite set consisting of the same elements.
No. of Permutations: If a set has n elements, then there are n! distinct permutations over it.

Operators over Sequences


• Operators are for manipulations
Concatenation
• (a, b, c ) ( d, a ) = ( a, b, c, d, a )
Other operators
• Extraction of information: ( a, b, c, d, a )(2) = b
• Filter Operator: {a, d} ( a, b, c, d, a ) = (a, d, a)
Note:
• We can think how resulting theory of sequences falls within our existing theory of sets
• And how operators in set theory can be used in case of sequences

Dr. Nazir Ahmad Zafar | Virtual University of Pakistan


11 CS-702 Advanced Algorithms Analysis and Design

Tuples and Cross Product


• A tuple is a finite sequence.
• Ordered pair (x, y), triple (x, y, z), quintuple
• A k-tuple is a tuple of k elements.

Construction to ordered pairs


• The cross product of two sets, say A and B, is A  B = {(x, y) | x  A, y  B}
| A  B | = |A| |B|
• Some times, A and B are of same set, e.g., Z  Z, where Z denotes set of Integers

Binary Relations
Definition: If X and Y are two non-empty sets, then
X Y = {(x, y) | x X and y  Y}

Example: If X = {a, b}, Y = {0,1} Then


X Y = {(a, 0), (a, 1), (b, 0), (b, 1)}

Definition: A subset of X Y is a relation over X Y

Example: Compute all relations over X Y, where


X = {a, b}, Y = {0,1}
R1 = , R2 = {(a, 0)}, R3 = {(a, 1)}
R4 = {(b, 0)}, R5 = {(b, 1)}, R6 = {(a, 0), (b, 0)}, . . .
There will be 24 = 16 number of relations

Definition: X Y == (X Y)
Example: If X = {a, b}, Y = {0,1} Then
X Y = {(a, 0), (a, 1), (b, 0), (b, 1)} and
X Y = {R1, R2, R3, R4, R5, R6, R7, R8, R9, R10, R11, R12, R13, R14, R15, R16}

Lemma 1: if #X = m, #Y = n then # (X Y) = 2m x n
Algorithm: All binary relations, cardinality of it

Equivalence Relation
A relation R  X  X, is
• Reflexive: (x, x)  R,  x  X
• Symmetric: (x, y)  R  (y, x)  R,  x, y  X
• Transitive: (x, y)  R  (y, z)  R  (x, z)  R
• Equivalence: If reflexive, symmetric and transitive

Applications: Order Pairs in Terms of String


Definition
• A relation R over X, Y, Z is some subset of X x Y x Z and so on
Example 1
• If  = {0, 1}, then construct set of all strings of length 2 and 3
• Set of length 2 =  x  = {0,1} x {0,1} = {(0,0), (0,1), (1,0), (1,1)} = {00, 01, 10, 11}
• Set of length 3 =  x  x  = {0, 1} x {0, 1} x {0,1}
= {(0,0,0), (0,0,1), (0,1,0), (0,1,1), (1,0,0), (1,0,1), (1,1,0), (1,1,1)}
= {000, 010, 100, 110, 001, 011, 101, 111}

Dr. Nazir Ahmad Zafar | Virtual University of Pakistan


12 CS-702 Advanced Algorithms Analysis and Design

Example 2
• If  = {0, 1}, then construct set of all strings of length ≤ 3
• Construction = {}     x    x  x 

Similarly we can construct collection of all sets of length n

Partial Function
Definition: a partial function is a relation that
maps each element of X to at most one
element of
Y. X Y denotes the set of all partial
functions.

Function
Definition: if each element of X is related to
unique element of Y then partial function is
a total function denoted by X Y.

Is Algorithm a Function?
Not good algorithms

Conclusion
• We started with sets and built other structures e.g.
• Sequences, Relations, Functions, etc.
• We discussed operators over above structures
• All these tools are fundaments of mathematics
• Sets play key role in algorithms design and analysis
• Finally proving correctness of algorithms, we required logic.
• Our next lecture will be on proving techniques

Dr. Nazir Ahmad Zafar | Virtual University of Pakistan


13 CS-702 Advanced Algorithms Analysis and Design

Lecture No 3
Logic and Proving Techniques

Today Covered
Tools used for proving algorithms
• Propositional Logic
• Predicate Logic
• Proofs using
• Truth Tables • Contradiction
• Logical Equivalences • Rule of Inference
• Counter Example
• Probability as Analysis Tool
• Series and Summation etc.

Propositional and Predicate Logic

Logical Connectives
• Proposition: Simplest statements also called atomic formula
• Propositions may be connected based on atomic formula.
• Logical connectives, in descending order of operator precedence

Negation, Conjunction and Disjunction


Negation
Conjunction
• The conjunction p  q is true only if p and q both are true otherwise false
• The conjunction follows the commutative property, i.e. p  q = q  p
Disjunction
• The disjunction p  q is false if both p and q are false otherwise true
• The disjunction follows the commutative property as well, i.e. p  q = q  p

Implication
• The p is antecedent and q is consequent
• The antecedent is stronger than consequent.
• Commutative property does not hold, i.e. (p  q)  (q  p)

Dr. Nazir Ahmad Zafar | Virtual University of Pakistan


14 CS-702 Advanced Algorithms Analysis and Design

Bi-implication
The equivalence p  q means p  q & q  p
Commutative property does hold, i.e.
(p  q) = (q  p)

Predicates and Quantifiers


Predicate: P(x)  x < 5
Example:  x : N | x2 = x  x < 2
For all quantifier
•  x, P(x) is true  P(x) is true for all x.
Existential Quantifier
•  x, P(x) is true  P(x) is true for some value of x.
Logical Equivalences
•  x, P(x) is logically equivalent to  ( x, P(x))
•  x, P(x) is logically equivalent to ( x, P(x))
•  x, (P(x)  Q(x)) means x, P(x)  Q(x)

Proving Techniques
Proof using Truth Table: (p  q  r)  (p  (q  r))

Dr. Nazir Ahmad Zafar | Virtual University of Pakistan


15 CS-702 Advanced Algorithms Analysis and Design

De Morgan’s Laws

Proof using Counter Example, Contraposition


Counter Example
To prove  x (A(x)  B(x)) is false, we show some object x for which A(x) is true and
B(x) is false.
Proof
 ( x (A(x)  B(x))) 
 x, (A(x)  B(x))) 
 x, (A(x)  B(x)) 
 x, A(x)  B(x))

Contraposition
• To prove A  B, we show ( B)  ( A)
• x is divisible by 4  x is divisible by 2 
• x is not divisible by 2  x is not divisible by 4 

Dr. Nazir Ahmad Zafar | Virtual University of Pakistan


16 CS-702 Advanced Algorithms Analysis and Design

Proof by Contradiction
Contradiction
• To prove A  B,

Steps in Proof
• We assume A and to prove that B
• On contrary suppose that  B and
• Then prove B, it will be contradiction

Further analysis
• A  B  (A  B)  B Contradiction
• A  B  (A  B) is false
• Assuming (A  B) is true,
and discover a contradiction (such as A  A),
then conclude (A  B) is false, and so A  B.

Problem: Proof by Contradiction


Prove:
[B  (B  C)]  C, by contradiction

Proof:
Suppose [B  (B  C)], to prove C
On contrary, assume C
C  [B  (B  C)] must be true
 C  [B  ( B  C)]
 C  [(B   B)  (B  C)]
 C  [f  (B  C)]
 C  B  C = C  C  B = f  B = f
 False, Contradiction  C

Rules of Inference
• A rule of inference is a general pattern that allows us to draw some new conclusion from
a set of given statements. If we know P then we can conclude Q.
Modus ponens
If {B  (B  C)} then {C}, example in last slide
Proof:
Suppose B  (B  C) then
B
BC

Rules of Inference
Syllogism
If {A  B  B  C} then {A  C}
Proof
• Suppose A  B  B  C, To prove A  C
• B
• C

Dr. Nazir Ahmad Zafar | Virtual University of Pakistan


17 CS-702 Advanced Algorithms Analysis and Design

Rule of cases
If {B  C  B  C} then {C}
B, true, implies C true
 B, true, implies C true

Two Valued Boolean Logic

1. Boolean values = B = {0, 1}, there are two binary operations:


• + = or = 
• · = and = 
2. Closure properties:
•  x, y  B, x + y  B
•  x, y  B, x . y  B
3. Identity element:
• x+0=0+x=x
• x·1=1.x= x
4. Commutative:
• x+y=y+x
• x·y=y·x
5. Distributive:
• x · (y + z) = (x · y) + (x · z)
• x + (y · z) = (x + y) · (x + z)
6. Complement:
•  x  B,  x‟  B such that
x + x‟ = 1, x · x‟ = 0

Tautologies and Truth Table


Tautology:
• Any statement which is always true is called a tautology

Example
• Show [B  (B  C)]  C is a tautology:

Proof
B C (B  C) (B  (B  C)) (B  (B  C))  C
0 0 1 0 1
0 1 1 0 1
1 0 0 0 1
1 1 1 1 1
• For every assignment for B and C, the statement is True, hence the above statement is
a tautology.

Probability as Analysis Tool


Elementary events
• Suppose that in a given situation an event, or an experiment, may have any one, and
only one, of k outcomes, s1, s2, …, sk. Assume that all these outcomes are mutually
exclusive.

Dr. Nazir Ahmad Zafar | Virtual University of Pakistan


18 CS-702 Advanced Algorithms Analysis and Design

Universe
The set of all elementary events is called the universe of discourse and is denoted
U = {s1, s2, …, sk}.

Probability of an outcome si
• Associate a real number Pr(si), such that
0  Pr(si)  1 for 1  i  k;
Pr(s1) + Pr(s2) + … + Pr(sk) = 1

Event
• Let S  U. Then S is called an event, and

Sure event Impossible event


• U = {s1, s2, …, sk}, if S = U • S = , Pr() = 0

Arithmetic and Geometric Series

Conclusion
• Propositional Logic
• Predicate Logic
• We have discussed various techniques of proving
• Truth Tables
• Logical Equivalence
• Counter Example
• Contraposition
• Contradiction
• Rule of Inference
• Probability can be used for average cost analysis
• Series and summation are very helpful in simplification

Dr. Nazir Ahmad Zafar | Virtual University of Pakistan


19 CS-702 Advanced Algorithms Analysis and Design

Lecture No 4
Mathematical Induction
Proving, Validation & Verification

Today Covered
In this lecture, we will cover the following
• What is Mathematical Induction? • Strong Mathematical Induction
• Why is Mathematical Induction Valid • Proving Problems using Strong
? Induction
• Proving problems using Induction • Conclusion
• Proving hard problems using
Induction

What is Mathematical Induction?


• Mathematical induction is a powerful, yet straight-forward method of proving statements
whose domain is a subset of the set of integers.
• Usually, a statement that is proven by induction is based on the set of natural numbers.
• This statement can often be thought of as a function of a number n, where n = 1, 2, 3,. . .
• Proof by induction involves three main steps
Proving the base of induction
Forming the induction hypothesis
Proving that the induction hypothesis holds true for all numbers in the domain.

Let P(n) be the predicate defined for any positive integers n, and let n0 be a fixed integer.
Suppose the following two statements are true
1. P(n0) is true.
2. For any positive integers k, k  n0, if P(k) is true then P(k+1)is true.

If both of the above statements are true then the statement:


 n  N, such that n  n0, P(n) is also true

Steps in Proving by Induction


Claim: P(n) is true for all n  Z+, for n  n0
1. Basis
– Show formula is true when n = n0
2. Inductive hypothesis
– Assume formula is true for an arbitrary n = k where, k  Z+ and k  n0
3. To Prove Claim
– Show that formula is then true for k+1
Note: In fact we have to prove
1) P(n0) and 2) P(k)  P(k+1)
Mathematical Way of Expressing Induction
• Basis step.
Show that proposition P(1) is true.
• Inductive step.
Show that for every positive integer n, the implication P(n)  P(n+1) is true.
P(n) for a fixed n is called inductive hypothesis.

Dr. Nazir Ahmad Zafar | Virtual University of Pakistan


20 CS-702 Advanced Algorithms Analysis and Design

Well Ordering and Modus Ponens Principal


Definition (Well-Ordering Principle)
• The Well-ordering Principle is the following statement
“every nonempty set of positive integers contains a least element”
• In a mathematical way we can define this Principle as:
there is a in S such that a  b for all b in S i.e.
 a  S, such that a  b,  b  S
• And we say that set S is well-ordered with respect to .
• Modus Ponens Principal
pq
p
Hence, q

Why Mathematical Induction is Valid?


• Let us suppose that P(1) is true, and that
n (P(n)  P(n+1)) is also true.
• Claim: n P(n) is true
– Assume proposition  n, P(n) is false, i. e, there are some positive integers for
which P(n) is false.
– Let S be the set of those n‟s. By well-ordering property, S has a least element,
suppose, k.
– As 1S, so 1< k, so k-1 is a positive
– Since k-1 < k, hence k-1 S. So P(k-1) is true.
– By modus ponens, P((k-1) + 1) = P(k) is true.
– Contradiction, hence n, P(n)

Another Reason for Validity?


Basis Step
First suppose that we have a proof of P(0).

Inductive Hypothesis
 k > 0, P(k)  P(k + 1)

How it is proved  n > 0?


P(0)  P(1)
P(1)  P(2)
P(2)  P(3)
...
Iterating gives a proof of  n, P(n). This is another way of proving validity of mathematical
Induction.

Proof by Induction

Example 1
• Prove that n2  n + 100 n  11

Solution
Let P(n) * n2  n + 100 n  11
1. P(11) * 112  11 + 100 121  111, true

Dr. Nazir Ahmad Zafar | Virtual University of Pakistan


21 CS-702 Advanced Algorithms Analysis and Design

2. Suppose predicate is true for n = k, i.e.


P(k) * k2  k + 100, true k  11
3. Now it can be proved that
P(k+1) * (k+1)2  (k+1) + 100,
Û k2 + 2k +1  k +1 + 100 k2 + k  100 (by 1 and 2)
Hence P(k)  P(K+1)

Validity of Proof
Example 1
• Prove that n2  n + 100 n  11

Solution
Initially, base case
Solution set = {11}

By, P(k)  P(K+1) * P(11)  P(12), taking k = 11


Solution set = {11, 12}

Similarly, P(12)  P(13), taking k = 12


Solution set = {11, 12, 13}

And, P(13)  P(14), taking k = 13


Solution set = {11, 12, 13, 14}
And so on

Another Easy Example


Example 2
Use Mathematical Induction to prove that sum of the first n odd positive integers is n2.
Proof
• Let P(n) denote the proposition that


• Basis step : P(1) is true , since 1 = 12
• Inductive step : Let P(k) is true for a positive integer k, i.e., 1+3+5+…+(2k-1) = k2
• Note that: 1+3+5+…+(2k-1)+(2k+1) = k2+2k+1= (k+1)2 ∴ P(k+1) true, by induction, P(n)
is true for all n  Z+

Another Proof

Proving Inequalities
Example 3
• Use mathematical Induction to prove that the inequality
n < 2n for all n  Z+
Proof
• Let P(n) be the proposition that n < 2n
• Basis step : P(1) is true since 1 < 21 .

Dr. Nazir Ahmad Zafar | Virtual University of Pakistan


22 CS-702 Advanced Algorithms Analysis and Design

• Inductive step :
• Assume that P(n) is true for a positive integer n = k,
i.e., k < 2k.
• Now consider for P(k+1) :
Since, k + 1 < 2k + 1  2k + 2k = 2.2k = 2k + 1
∴ P(k+1) is true.

It proves that P(n) is true for all n  Z+.

Example 4: Harmonic Numbers


The harmonic numbers Hk, k = 1, 2, 3, …, are

defined by

Use mathematical induction to show that


whenever n is a nonnegative integer.
Proof
Let P(n) be the proposition that
Basis step :
P(0) is true, since,
Inductive step
Assume that P(k) is true for some k,

Example 4: Harmonic Numbers


Now consider

∴P(k+1) is true.
Hence the statement is true for all n  Z . +

Strong Mathematical Induction


• Let P(n) be a predicate defined for integers n, and a and b are fixed integers with a ≤ b.
• Suppose the following statements are true:
1. P(a), P(a + 1), … , P(b) are all true
(basis step)
2. For any integer k > b,
if P(i) is true for all integers i with a ≤ i < k,
then P(k) is true. (inductive step)
• Then P(n) is true for all integers n ≥ a.

Dr. Nazir Ahmad Zafar | Virtual University of Pakistan


23 CS-702 Advanced Algorithms Analysis and Design

Example 1: Divisibility by a Prime

Theorem:
• For any integer n ≥ 2, n is divisible by a prime.
Proof
(by strong mathematical induction):
• Basis step:
The statement is true for n = 2. This is because 2 | 2 and 2 is a prime number.

Inductive step:
Assume the statement is true for all i with 2 ≤ i <k (inductive hypothesis) ;
To show that it is true for k .

Example 1: Divisibility by a Prime


• We know that  i  Z, with 2 ≤ i < k, P(i), i.e. i is divisible by a prime number. (1)
• Now we show P(k), i.e., k is divisible by a prime.
Take two cases:
Case 1: k is prime.
Then k is divisible by itself. And nothing to prove
Case 2: k is composite.
Then k = a·b, where 2 ≤ a <k and 2 ≤ b <k
Based on (1), p|a for some prime p. (2)
Based on Case 2, a|k (3)
By transitivity, p|a and a|k  p|k
Thus, P(n) is true by strong induction.

Example 2: Another Example in Number Theory


If n  Z, n >1, then n can be written as product of primes.

Proof :
Let P(n)  n can be written as the product of primes.
Basis : P(2) is true, since 2 is the first prime number
Inductive : Assume that the statement is true for n = k, i.e.
P(2), P(3), …, P(k) can be written as product of primes.

Prove that: true for n = k, i.e. P(k + 1) is product of primes.


Case 1 : k + 1 is prime, then nothing to prove
Case 2 : k + 1 is composite, then
k + 1 = xy, where 2  x  y < k+1

Inductive hypothesis, a and b are product of primes.


Hence P(k+1) can be written as product of primes.

Any Amount Limited Coins: More Steps in Basis


Statement
Show that any amount in cents ≥ 8 cents can be obtained using 3 cents and 5 cents coins only.
Proof
We have to prove that, amount = 3.m + 5.n, m  0, n  0
Basis Step
This time check for a five particular values:

Dr. Nazir Ahmad Zafar | Virtual University of Pakistan


24 CS-702 Advanced Algorithms Analysis and Design

8 = 1.3 + 1.5
9 = 3.3
10 = 2.5
11 = 2.3 + 1.5
12 = 4.3
Now we generalize it?

Any Amount Limited Coins : More Steps in Basis


Let P(n) be the statement that:
“n cents can be obtained using 3 and 5 cents”.

Inductive Hypothesis
We want to show that
P(k) is true  P(k+1),  k ≥ 8
There are two cases now

Case 1
P(k) is true and k cents contain at least one 5 coin.

Case 2
P(k) true, k cents do not contain any coin of 5 cent.

Case 1
• P(k) is true and k cents contain at least one 5 coin.
• Since P(k) is true k8
Hence k can be expressed as
k = 3.m + 5.n m  0 and n  1
k + 1= 3.m + 5.n + 1
k + 1= 3.m + 5.(n - 1) + 1 + 5
k + 1= 3.(m + 2) + 5.(n - 1), m  2 and n  0
Hence the statement is true for n = k + 1
Case 2
• P(k) is true and k cents do not contain any coin of 5 cent. for k  8
Hence k can be expressed as
k = 3.m m3
k + 1= 3.(m – 3) + 9 + 1
k + 1= 3.(m – 3) + 2.5
k + 1= 3.m‟ + 5.n m‟  0 and n = 2
• Hence the statement is true for n = k + 1
• Hence P(k + 1) is true

Dr. Nazir Ahmad Zafar | Virtual University of Pakistan


25 CS-702 Advanced Algorithms Analysis and Design

Lecture No 5
Strong Mathematical Induction
(Proving, Validation and Verification, etc.)

Today Covered
• Generalization of Demargon‟s Laws
• Strong Mathematical Induction
• Converting problems to be proved using strong mathematical induction
• Proving Problems using Strong Induction
• Fibonacci Problem and its Sequence
• Construction of Mathematical Model
• Explicit Formula Computing Fibonacci Numbers
• Recursive Algorithms
• Conclusion

Proof: Generalized Demargon’s Law by Induction

 
n n
Prove  A j 
j 1 A
j 1
j when n2, i.e., A1  A2  ...  An  A1  A2  ...  An

Proof
 
Basis step: Since, A1  A2  A1  A2 true for n = 2
Induction step: Assume the result is true n = k and then prove for n = k+1.
k 1 k
 A j   A j  Ak 1
j 1 j 1

k
  A j  Ak 1
j 1
k
  A j  Ak 1 (by induction hypothesis)
j 1
k 1
  Aj
j 1

Postage Ticket: Again More Steps in Basis


Prove that postage ticket of amount  12 cents can be formed using only 4 cent and 5 cent
stamps.
Proof
Let P(n)  n cents can be formed using only 4 and 5 cent
P(n)  n = 4s + 5t s  0, and t  0  n  12
Basis : P(12) is true, since 12 = 4  3;
P(13) is true, since 13 = 4  2 + 5  1;
P(14) is true, since 14 = 4  1 + 5  2;
P(15) is true, since 15 = 5  3;
Inductive : Assume P(12), P(13), …, P(k) are true.
Now prove for P(k + 1) (k-3  12)
Suppose k-3 = 4  s + 5  t.
Then k +1 = 4  (s + 1) + 5  t. true for n = k + 1.
By Strong Induction, P(n) is true if n  Z and n 12.

Dr. Nazir Ahmad Zafar | Virtual University of Pakistan


26 CS-702 Advanced Algorithms Analysis and Design

Proving a Property of a Sequence


Proposition:
Suppose a0, a1, a2, … is defined as follows:
a0 = 1, a1 = 2, a2 = 3,
ak = ak-1 + ak-2 + ak-3 for all integers k ≥ 3.
Then an ≤ 2n for all integers n≥0. P(n)
Proof (by strong induction)
Basis step:
The statement is true
for n = 0: a0 = 1 ≤ 1 = 20 P(0)
for n = 1: a1 = 2 ≤ 2 = 21 P(1)
for n = 2: a2 = 3 ≤ 4 = 22 P(2)

Inductive step:
For any k > 2, assume P(i) is true for all i with 0 ≤ i < k, i.e., ai ≤ 2i for all 0 ≤ i < k
(1)
Show that
P(k) is true: ak ≤ 2k (2)
Now consider
ak = ak-1 + ak-2 + ak-3
≤ 2k-1 + 2k-2 + 2k-3 based on (1)
≤ 20 + 21 + … + 2k-3 + 2k-2 + 2k-1
= 2k - 1 ≤ 2k
Thus, P(n) is true by strong mathematical induction.
Hence it proves the result

Existence of Binary Integer Representation


Theorem
Given any positive integer n, there exists a unique representation of n in the form:
n = cr.2r + cr-1.2r-1 + . . . + c1.21 + c0
• Where r is non-negative integer
• cr.= 1, and cj = 0 or 1,  j = 0, 1, 2, . . . , r-1
Proof (by strong induction)
Let P(n) be the statement that n can be written in the form
n = cr.2r + cr-1.2r-1 + . . . + c1.21 + c0
Basis step:
If n = 1, then n = cr.2r = c0, where r = 0, and c0 = 1
Hence the statement is true for n = 1, i.e. P(1) is true

Inductive Hypothesis:
Let us suppose that statement is true for all i, 1 ≤ i < k,
i = ck.2k + ck-1.2k-1 + . . . + c1.21 + c0
• cr.= 1, and cj = 0 or 1,  j = 0, 1, 2, . . . , r-1
Show that
Now we prove that statement is true for k

Case 1
Suppose k is even, k/2 is an integer and k/2 < k, hence
k/2 = cr.2r + cr-1.2r-1 + . . . + c1.21 + c0

Dr. Nazir Ahmad Zafar | Virtual University of Pakistan


27 CS-702 Advanced Algorithms Analysis and Design

1
Let f0  x   , and fn 1  f0 fn , n  0.
2 x
where r is non-negative integer and
cr.= 1, and cj = 0 or 1,  j = 0, 1, 2, . . . , r-1
k = 2.cr.2r + 2.cr-1.2r-1 + . . . + 2.c1.21 + 2.c0
k = cr.2r+1 + cr-1.2r + . . . + c1.22 + c0.21, true
which is the required form
Case 2
Let k ≥ 3, is odd, (k-1)/2 is an integer and 1 ≤ (k-1)/2 < k,
(k-1)/2 = cr.2r + cr-1.2r-1 + . . . + c1.21 + c0
where r is non-negative integer and
cr.= 1, and cj = 0 or 1,  j = 0, 1, 2, . . . , r-1
Now, k – 1 = cr.2r+1 + cr-1.2r + . . . + c1.22 + c0.21
And, k = cr.2r+1 + cr-1.2r + . . . + c1.22 + c0.21 + 1, true
• Hence by strong mathematical induction, P(n) is true

Uniqueness
Now we prove that n has a unique representation
n = cr.2r + cr-1.2r-1 + . . . + c1.21 + c0
• Where r is non-negative integer
• cr.= 1, and cj = 0 or 1,  j = 0, 1, 2, . . . , r-1
On contrary, suppose that n has two different representations, i.e.
n = cr.2r + cr-1.2r-1 + . . . + c1.21 + c0 (1) and
n = br.2r + br-1.2r-1 + . . . + b1.21 + b0 (2)
Now subtract (2) from (1) we get
0 = (br- cr)2r + (br-1- cr-1).2r-1 + . . . + (b0- c0) 
br = cr, br-1= cr-1, . . ., b1 = c1.and b0 = c0 , proved

More Complicated Example


Problem

• Find an expression for fn and prove it by induction.


Solution
1
Since f 0  and f n 1  f o  f 0 therefore
2 x
1 1 2 x
f1 ( x)  f 0  f 0 (x)  f 0 ( ) 
2 x 2
1 3  2x
2 x
2 x 1 3  2x
And, f 2 ( x)  f 0  f1 (x)  f 0 ( ) 
3  2x 2  x 4  3x
2
3  2x
3  2x
And, f 3 ( x)  f 0  f 2 (x)  f 0 ( )
4  3x
1 4  3x
 
3  2x 5  4x
2
4  3x

Dr. Nazir Ahmad Zafar | Virtual University of Pakistan


28 CS-702 Advanced Algorithms Analysis and Design

n  (n  1) x
f n -1 (x)  f 0 ( )
(n  1)  nx
1 (n  1)  nx
 
n  (n  1) x (n  2)  (n  1) x
2
(n  1)  nx
Now generalized function is
(n  1)  nx
f n ( x) 
(n  2)  (n  1) x
Now we prove this guess by mathematical Induction
Basis case: take n = 0
1
f0  , which is true
2 x
Inductive hypothesis: assume that statement is true n = k
(k  1)  kx
f k ( x) 
(k  2)  (k  1) x
Claim: Now we have to prove that statement is true n = k + 1
(k  1  1)  (k  1) x (k  2)  (k  1) x
f k 1 ( x)  
(k  1  2)  (k  1  1) x (k  3)  (k  2) x
By definition:
(k  1)  kx 1
f k 1 ( x)  f 0 ( )
(k  2)  (k  1) x 2 (k  1)  kx
(k  2)  (k  1) x
(k  2)  (k  1) x
After simplification, f k 1 ( x)  , proved.
(k  3)  (k  2) x

Dr. Nazir Ahmad Zafar | Virtual University of Pakistan


29 CS-702 Advanced Algorithms Analysis and Design

Lecture No 6
Fibonacci Sequences
Natural Models
Today Covered
In this lecture we will cover the following:
• Fibonacci Problem and its Sequence
• Construction of Mathematical Model
• Explicit Formula Computing Fibonacci Numbers
• Recursive Algorithms
• Generalizations of Rabbits Problem and Constructing its Mathematical Models
• Applications of Fibonacci Sequences

Fibonacci Sequence
• By studying Fibonacci numbers and constructing Fibonacci sequence we can imagine
how mathematics is connected to apparently unrelated things in this universe.
• Even though these numbers were introduced in 1202 in Fibonacci‟s book Liber abaci,
but these numbers and sequence are still fascinating and mysterious to people of today.
• Fibonacci, who was born Leonardo da Pisa gave a problem in his book whose solution
was the Fibonacci sequence as we will discuss it today.

Statement:
• Start with a pair of rabbits, one male and one female, born on January 1.
• Assume that all months are of equal length and that rabbits begin to produce two months
after their own birth.
• After reaching age of two months, each pair produces another mixed pair, one male and
one female, and then another mixed pair each month, and no rabbit dies.
How many pairs of rabbits will there be after one year?

Answer: The Fibonacci Sequence! 0, 1, 1, 2, 3, 5, 8, 13, 21, 34, 55, 89, 144, . . .

Construction of Mathematical Model

Dr. Nazir Ahmad Zafar | Virtual University of Pakistan


30 CS-702 Advanced Algorithms Analysis and Design

• Total pairs at level k = Total pairs at level k-1 + Total pairs born at level k (1)

• Since
Total pairs born at level k = Total pairs at level k-2 (2)

• Hence by equation (1) and (2)


Total pairs at level k = Total pairs at level k-1 + Total pairs at level k-2

• Now let us denote


Fk = Total pairs at level k

• Now our recursive mathematical model will become


Fk = Fk-1 + Fk-2

Computing Values using Mathematical Model

Since Fk = Fk-1 + Fk-2 F0 = 0, F1= 1

• F2 = F1 + F0= 1 + 0 = 1
• F3 = F2 + F1= 1 + 1 = 2
• F4 = F3 + F2= 2 + 1 = 3
• F5 = F4 + F3= 3 + 2 = 5
• F6 = F5 + F4= 5 + 3 = 8
• F7 = F6 + F5= 8 + 5 = 13
• F8 = F7 + F6= 13 + 8 = 21
• F9 = F8 + F7= 21 + 13 = 34
• F10 = F9 + F8= 34 + 21 = 55
• F11 = F10 + F9= 55 + 34 = 89
• F12 = F11 + F10= 89 + 55 = 144 . . .

Explicit Formula Computing Fibonacci Numbers

Theorem:
The fibonacci sequence F0,F1, F2,…. Satisfies the recurrence relation

Fk  Fk 1  Fk 2 k  2
with initial condition F0  F1  1
Find the explicit formula for this sequence.

Solution:
The given fibonacci sequence
Fk  Fk 1  Fk 2

Let tk is solution to this, then characteristic equation


t 2  t 1  0

Dr. Nazir Ahmad Zafar | Virtual University of Pakistan


31 CS-702 Advanced Algorithms Analysis and Design

Fibonacci Sequence
1 1 4
t
2
1 5 1 5
t1  , t2 
2 2

For some real C and D fibonacci sequence satisfies the relation


n n
1 5  1 5 
Fn  C    D
  2 
 n0
 2   
n0
0 0
1 5  1 5 
F0  C    D
  2 

 2   
 F0  C  D
 C  D  0 1  F0  0

Now n  1
1 5  1 5 
F1  C    D
  2 

 2   
1 5 1 5
 C   D  1 2   F1  1
2 2

Solving 1 and 2  simultaneously weget


1 1
C ,D  
5 5
Hence
n n
 1  1  5   1  1  5 
Fn     
 5  2   5  2 5 

After simplifying we get


n n
1 1 5  1 1 5 
Fn      
5  2  5  2 
which is called the explicit formula for the Fibonacci sequence recurrence relation.
1 5   
Let       1  5  then
 and 
  2 
 2   
1 n 1 n
Fn    
5 5

Dr. Nazir Ahmad Zafar | Virtual University of Pakistan


32 CS-702 Advanced Algorithms Analysis and Design

Verification of the Explicit Formula

Example: Compute F3
1 5   
Since Fn 
1 n
 
1 n
 where       1  5  then
 and 
  2 
5 5  2   
1  1  3.1 . 5  3.1.5  5 5  1  1  3.1 . 5  3.1.5  5 5 
2 2
Now, F3     
5  8 
 5 
 8 

F3 
1
8. 5

1  3.1. 5  3.1.5  5 5   1
8. 5

1  3.1. 5  3.1.5  5 5
F3 
1
8. 5
 
1  3.1. 5  3.1.5  5 5  1  3.1. 5  3.1.5  5 5  2

Recursive Algorithm Computing Fibonacci Numbers

Fibo-R(n)
if n = 0
then 0 Terminating conditions
if n = 1
then 1
else Fibo-R(n-1) + Fibo-R(n-2) Recursive calls

Running Time of Recursive Fibonacci Algorithm

• Least Cost: To find an asymptotic bound of computational cost of this algorithm, we can
use a simple trick to solve this recurrence containing big oh expressions

• Simply drop the big O from the recurrence, solve the recurrence, and put the O back.
Our recurrence

O(1) if n  2
T ( n)  
T (n  1)  T (n  2) n  2

will be refined to
1 if n  2
T ( n)  
T (n  1)  T (n  2) n  2

Dr. Nazir Ahmad Zafar | Virtual University of Pakistan


33 CS-702 Advanced Algorithms Analysis and Design

Construction of Mathematical Model

Running Time of Recursive Fibonacci Algorithm


• Guess that Fn+1 is the least cost to solve this recurrence. Why this guess?
 n  0, T(n)  Fn+1
then Fn+1 will be minimum cost for this recurrence
• We prove it by mathematical induction
Base Case
There are two base cases
For n = 0, T(0) = 1 and F1 = 1, hence T(0)  F1
For n = 1, T(1) = 1 and F2 = 1, hence T(1)  F2

• Inductive Hypothesis
– Let us suppose that statement is true some k  1 T(k)  Fk+1 , for k =0, 1, 2,. . .
and k  1
• Now we show that statement is true for k + 1
• Now, T(k + 1) = T(k) + T(k -1) By definition on T(n)
T(k + 1) = T(k) + T(k -1)  Fk+1 + Fk = Fk+2 Assumption
T(k + 1)  Fk+2
• Hence the statement is true for k + 1.
• We can now say with certainty that running time of this recursive Fibonacci algorithm is
at least (Fn+1).
• Now we have proved that
T(n)  Fn+1 , n  0 (1)
• We already proved in solution to recursive relation that
1 5   
Fn 
1 n
 
1 n
 where       1  5  (2)
 and 
  
5 5  2   2 

Dr. Nazir Ahmad Zafar | Virtual University of Pakistan


34 CS-702 Advanced Algorithms Analysis and Design

t can be easily verified that Fn  n/5  (3/2)n


From the equations (1) and (2), T(n)  Fn+1  Fn  (3/2)n
Hence we can conclude that running time of our recursive Fibonacci Algorithm is:
T(n) =  (3/2)n

Golden Ratio
• W say that two quantities, x and y, (x < y), are in the golden ratio if the ratio between the
sum, x + y, of these quantities and the larger one, y, is the same as the ratio between
x y y
the larger one, y, and the smaller one x.   1.62
y x
• Mathematicians have studied the golden ratio because of its unique and interesting
properties.

Drawback in Recursive Algorithms


Recursion Tree

Dr. Nazir Ahmad Zafar | Virtual University of Pakistan


35 CS-702 Advanced Algorithms Analysis and Design

Generalization of Rabbits Problem

Statement:
• Start with a pair of rabbits, one male and one female, born on January 1.
• Assume that all months are of equal length and that rabbits begin to produce two months
after their own birth.
• After reaching age of two months, each pair produces two other mixed pairs, two male
and two female, and then two other mixed pair each month, and no rabbit dies.
How many pairs of rabbits will there be after one year?

Answer: Generalization of Fibonacci Sequence! 0, 1, 1, 3, 5, 11, 21, 43, 85, 171, 341, 683, . . .

Construction of Mathematical Model

• Total pairs at level k =


Total pairs at level k-1 + Total pairs born at level k (1)
• Since
Total pairs born at level k =
2 x Total pairs at level k-2 (2)
• By (1) and (2), Total pairs at level k =
Total pairs at level k-1 + 2 x Total pairs at level k-2
• Now let us denote
Fk = Total pairs at level k
• Our recursive mathematical model:
Fk = Fk-1 + 2.Fk-2
• General Model (m pairs production): Fk = Fk-1 + m.Fk-2

Dr. Nazir Ahmad Zafar | Virtual University of Pakistan


36 CS-702 Advanced Algorithms Analysis and Design

Generalization
• Recursive mathematical model
(one pair production)
Fk = Fk-1 + Fk-2
• Recursive mathematical model
(two pairs production)
Fk = Fk-1 + 2.Fk-2
• Recursive mathematical model
(m pairs production)
Fk = Fk-1 + m.Fk-2

Computing Values using Mathematical Model

Since Fk = Fk-1 + 2.Fk-2 F0 = 0, F1 = 1


• F2 = F1 + 2.F0= 1 + 0 = 1
• F3 = F2 + 2.F1= 1 + 2 = 3
• F4 = F3 + 2.F2= 3 + 2 = 5
• F5 = F4 + 2.F3= 5 + 6 = 11
• F6 = F5 + F4= 11 + 10 = 21
• F7 = F6 + F5= 21 + 22 = 43
• F8 = F7 + F6= 43 + 42 = 85
• F9 = F8 + F7= 85 + 86 = 171
• F10 = F9 + F8= 171 + 170 = 341
• F11 = F10 + F9= 341 + 342 = 683
• F12 = F11 + F10= 683 + 682 = 1365 . . .

Another Generalization of Rabbits Problem


Statement:
• Start with a different kind of pair of rabbits, one male and one female, born on January 1.
• Assume all months are of equal length and that rabbits begin to produce three months
after their own birth.
• After reaching age of three months, each pair produces another mixed pairs, one male
and other female, and then another mixed pair each month, and no rabbit dies.
How many pairs of rabbits will there be after one year?

Answer: Generalization of Fibonacci Sequence!


0, 1, 1, 1, 2, 3, 4, 6, 9, 13, 19, 28, 41, 60, . . .

Dr. Nazir Ahmad Zafar | Virtual University of Pakistan


37 CS-702 Advanced Algorithms Analysis and Design

Construction of Mathematical Model

• Total pairs at level k =


Total pairs at level k-1 + Total pairs born at level k (1)
• Since
Total pairs born at level k = Total pairs at level k-3 (2)
• By (1) and (2)
Total pairs at level k =
Total pairs at level k-1 + Total pairs at level k-3
• Now let us denote
Fk = Total pairs at level k
• This time mathematical model: Fk = Fk-1 + Fk-3

Computing Values using Mathematical Model


Since Fk = Fk-1 + Fk-3 F0 = 0, F1= F2= 1
• F3 = F2 + F0= 1 + 0 = 1
• F4 = F3 + F1= 1 + 1 = 2
• F5 = F4 + F2= 2 + 1 = 3
• F6 = F5 + F3= 3 + 1 = 4
• F7 = F6 + F4= 4 + 2 = 6
• F8 = F7 + F5= 6 + 3 = 9
• F9 = F8 + F6= 9 + 4 = 13
• F10 = F9 + F7= 13 + 6 = 19
• F11 = F10 + F8= 19 + 9 = 28
• F12 = F11 + F9= 28 + 13 = 41 . . .

Dr. Nazir Ahmad Zafar | Virtual University of Pakistan


38 CS-702 Advanced Algorithms Analysis and Design

More Generalization
• Recursive mathematical model
(one pair, production after three months)
Fk = Fk-1 + Fk-3
• Recursive mathematical model
(two pairs, production after three months)
Fk = Fk-1 + 2.Fk-3
• Recursive mathematical model
(m pairs, production after three months)
Fk = Fk-1 + m.Fk-3
• Recursive mathematical model
(m pairs, production after n months)
Fk = Fk-1 + m.Fk-n

Applications of Fibonacci Sequences


Fibonacci sequences
• Are used in trend analysis
• By some pseudorandom number generators
• The number of petals is a Fibonacci number.
• Many plants show the Fibonacci numbers in the arrangements of the leaves around the
stems.
• Seen in arrangement of seeds on flower heads
• Consecutive Fibonacci numbers give worst case behavior when used as inputs in
Euclid‟s algorithm.
• As n approaches infinity, the ratio F(n+1)/F(n) approaches the golden ratio:
 =1.6180339887498948482...

Applications of Fibonacci Sequences


Fibonacci sequences
• The Greeks felt that rectangles whose sides are in the golden ratio are most pleasing
• The Fibonacci number F(n+1) gives the number of ways for 2 x 1 dominoes to cover a 2
x n checkerboard.
• Sum of the first n Fibonacci numbers is F(n+2)-1.
• The shallow diagonals of Pascal‟s triangle sum to Fibonacci numbers.
• Except n = 4, if F(n) is prime, then n is prime.
• Equivalently, if n not prime, then F(n) is not prime.
• gcd( F(n), F(m) ) = F( gcd(n, m) )

Dr. Nazir Ahmad Zafar | Virtual University of Pakistan


39 CS-702 Advanced Algorithms Analysis and Design

Lecture No 7
Recurrence Relations
Mathematical Models, Analysis Techniques

Today Covered
• What is Recursion?
• Recursive Mathematical Models
• Solving Recurrence Relations
• First Order Linear Homogenous Recurrence Relations, with Constant Coefficients
• Second Order Linear Homogenous Recurrence Relations, Constant Coefficients
– Characteristics of Second Order Recurrences
– Solution to Second order with distinct roots
– Solution to Second order with repeated roots
• General Homogenous Recurrences
– Characteristics and solution

What is Recursion?
• Sometimes problems are too difficult or too complex to solve because these are too big.
• A problem can be broken down into sub-problems and find a way to solve these sub-
problems
• Then build up to a solution to the entire problem.
• This is the idea behind recursion
• Recursive algorithms break down problem in pieces which you either already know the
answer, or can be solved applying same algorithm to each piece
• And finally combine the results of these sub-problems to find the final solution
• More concisely, a recursive function or definition is defined in terms of itself.
• Recursion is a computer algorithm that calls itself in a steps having a termination
condition.
• The successive repetitions are processed up to the critical step where the condition is
met.
• In recursive algorithms, each repetition is processed from the last one called to the first.
• Recursion is a wonderful technique for dealing with many problems where problems and
sub-problems have same mechanism to solve it.

Merits and Demerits of Recursion


• Recursive solutions are much easier to conceive of and code than their iterative
counterparts.
• Every problem is not solvable using this approach
What kinds of problems are solved with recursion?
• Generally, problems which are defined in terms of themselves are usually good
candidates for recursive techniques.
Example
• Finding factorial of a number is an easiest example one can think using recursion

Dr. Nazir Ahmad Zafar | Virtual University of Pakistan


40 CS-702 Advanced Algorithms Analysis and Design

Recursive Mathematical Model


• Since n! can be computed as: 5! = 5*4*3*2*1.
• If we have a close look at this, we notice that
5! = 5*4!.
• Now if denote F(n) = n! then it can be written as
F(n) = n.F(n-1)
• Assume 0! = 1 i.e. F(0) = 1, and solve till termination
F(n) = n.F(n-1) = n.(n-1).F(n-2) = n.(n-1).(n-2).F(n-3)
...
F(n) = n.(n-1).(n-2). . . 2.1.F(0) = n.(n-1).(n-2). . . 2.1.1
1 if n  0
F ( n)  
n.F (n  1) otherwise

Solving Recurrence
• The indispensable last step when analyzing an algorithm is often to solve a recurrence
equation.
• With little experience recurrence equation can be solved by intelligent guesswork.
• However, there exist a powerful techniques that can be use to solve certain classes of
recurrence almost automatically.
• This is a main topic of this lecture, techniques solving recurrence equations of form:
– First order linear homogenous recurrences
– Second order linear homogenous recurrences
– Higher order recurrences

First Order Linear Homogenous Recurrence Relations with Constant Coefficients


(FOLHRRCC)

Definition and Examples of FOLHRRCC

Definition
ak  A  ak 1  k  1

where A is a real numbers and A  0


ak  2.ak 2 No
ak  2.ak 2 Yes
1
c k  k ck 1 No
2
ak  ak 1 ak 1 No

Dr. Nazir Ahmad Zafar | Virtual University of Pakistan


41 CS-702 Advanced Algorithms Analysis and Design

Solving First Order Recurrences


Solve the recurrence: b k  a.bk 1 if b0 = c
Solution
• bk = a.bk-1
• bk = a.(a. bk-2) = a2. bk-2
• bk = a2.(a. bk-3) = a3. bk-3
...
k k
• bk = a . bk-k = a . b0
• bk = ak.c
• Now the explicit formula is c.ak which is a geometric sequence.
• Hence first order recurrence is nothing but G.S.

Example
• Solve the recurrence: b k  5bk 1 if b0 = 3
Solution
• bk = 5.bk-1
• bk = 5.(5. bk-2) = 52. bk-2
• bk = 52.(5. bk-3) = 53. bk-3
• ...
• bk = 5k. bk-k = 5k. b0 = 5k.3
• Now the solution sequence becomes
• 3.50, 3.51, 3.52, 3.53, 3.54, . . , 3.5k, . . .
• 3, 15, 75, 375, . . .geometric sequence

Second Order Linear Homogenous Recurrence Relations with Constant Coefficients


Definition and Examples of SOLHRRCC
Definition :
ak  A  ak 1  B  ak 2 k  2
where A and B are real numbers with B  0
ak  3ak 1  2ak 2 Yes
b k  bk 1  bk 2  bk 3 No
1 3
ck  ck 1  ck 2 Yes
2 7
Some More Examples
d k  d k21  d k 1  d k 2 No
e k  2ek 2 Yes
f k 2 f k 1  1 No
g k  g k 1  g k -2 Yes
h k  (1)hk 1  (k  1)hk 2 No

Dr. Nazir Ahmad Zafar | Virtual University of Pakistan


42 CS-702 Advanced Algorithms Analysis and Design

Theorem: Let A and B are real numbers. A recurrence of the form


ak  Aak 1  Bak 2
is satisfied by the sequence
1, t , t 2 ,....t n ,....t  0
where t is a non - zero real no, if and only if t satisfies the
equation : t 2  At  B  0
Proof: Let us suppose that the sequence
1, t , t 2 ,..., t n ,..., where, t  0
Satisfies the recurrence relation
ak  Aak 1  Bak 2

It mean each form of sequence is equal to A times the previous form plus B times the form
before it
Hence
t k  At k 1  Bt k 2
since t  0  t k 2  0
Dividing both sides by t k  2
t 2  At  B  0
Conversely suppose that t 2  At  B  0
 t k  At k 1  Bt k 2
Hence 1, t , t 2 , t 3 ..., t n ... satisfies the above recurrence relation

Characteristic Equation
Definition: Given a second order linear homogeneous recurrence relation with constant
coefficients ak  A  ak 1  B  ak 2 k  2
The characteristic equation of the relation is t 2  At  B  0

Example 1: Using characteristic equation, find solution to a recurrence relation


ak  ak 1  2  ak 2 k  2
Find all sequences that satisfy relation and have the form 1, t , t ,..., t ,..., t  0
2 n

Solution: Above recurrence relation is satisfied by a sequence 1, t , t ,..., t ,..., t  0


2 n

if and only if, t 2  t  2  0


 t  2t  1  0  t  2,1
Hence 2 ,2,2 ,2 ,...,2 ,... and  1 ,  1 ,  1 ,  1 ,...
0 2 3 n 0 1 2 3

are both particular solutions for this recurrence relation

Dr. Nazir Ahmad Zafar | Virtual University of Pakistan


43 CS-702 Advanced Algorithms Analysis and Design

Repeated Roots
Theorem: Let A and B be real numbers, and suppose that the characteristic equation
t 2  At  B  0
has a single root r, than the sequences
1, r, r 2 ,..., r n and 0, r,2r 2 ,3r 3 ,..., nr n ...
Both satisfy the recurrence relation
ak  Aak 1  Bak 2
Proof
if t 2  At  B  0
has a single repeated root „r‟ than
t 2  At  B  t  r 
2

 t 2  At  B  t 2  2rt  r 2
 A  2r and B  r 2
We know that rn is a solution. Now we prove that S n  nr n
is also a solution, i.e.
S n satisfies the recurrence ak  Aak 1  Bak 2
i.e., Sk  AS k 1  BS k 2  krk
In fact we have to prove that
A.S k 1  B.S k 2  k .r k
Consider t he left hand side
  
AS k 1  BS k  2  A (k  1)  r k 1  B (k  2)  r k  2 
 2r  (k  1)  r k 1  r 2  (k  2)  r k  2
 2(k  1)  r k  (k  2)r k
 (2k  2  k  2)r k
 k.r k  RHS, hence proved

Example 1: Single root case


Suppose sequence, b0, b1, b2,. . . satisfies recurrence relation
bk  4bk 1  4bk 2 k  2
with initial condition : b 0  1 and b1  3
then find the explicit formula for b0, b1, b2, . . .

Solution:
Characteristic equation t 2  4t  4  0

Dr. Nazir Ahmad Zafar | Virtual University of Pakistan


44 CS-702 Advanced Algorithms Analysis and Design

t  22  0  t  2, is repeated root


2 n and n.2 n are sequences which satisfy the same
recurrence relation, but do not satisfy the initial conditions
Suppose general solution : b n  C.2 n  D.n.2 n
which satisfies the original recurrence , C and D are constants
Since b0  1, b1  3
For n  0, C  D  0  20  1  C  1
For n  1, b1  C  21  D 1 21
3 2 1
 2C  2 D  3  2 1  2 D  3  D  
2 2
1  n
Hence, bn  1  2 n   n  2 n  2 n 1  
2  2
 n
 1  2 n is the required solution for repeated roots.
 2

Checking Explicit Formula


bn = (1 + n/2).2n
First term b0 = (1 + 0/2).20 = 1.1 = 1
Second term b1 = (1 + 1/2).21 = 3/2.2 = 3
Third term b2 = (1 + 2/2).22 = 2.4 = 8
Fourth term b3 = (1 + 3/2).23 = 5/2.8 = 20, and so on

Theorem (Linear Combination is also a Solution)


Theorem: if r0 , r1 , r2 ,... and s0 , s1 , s2 ,... are sequences that satisfy the some second order linear
homogeneous recurrence relation with constant coefficients, and if C and D are any numbers
then the sequence a0 , a1 , a2 ,... defined by the formula an  Crn  Dsn  n  0 also satisfies
the same recurrence relation.

Proof: Since r0 , r1 , r2 ,..., and s0 , s1 , s2 ,...


Satisfy the same second order LHRRWCC
  A and B constants real no. s.t
rk  Ark 1  Brk 2 and sk  Ask 1  Bsk 2
If an  Crn  Dsn n  0
Then we have to prove that ak  Aak 1  Bak 2
Consider R. H. S
Aak 1  Bak 2  AC  rk 1  D  sk 1   BCrk 2  Dsk 2 

Dr. Nazir Ahmad Zafar | Virtual University of Pakistan


45 CS-702 Advanced Algorithms Analysis and Design

 C  Ark 1  Brk 2   D Ask 1  Bsk 2 


 C rk   D(sk )  a k
 ak  Aak 1  Bak 2
It proves that an  Crn  Dsn satisfies same recurrence

Solution as Linear Combination


Find a sequence that satisfies the recurrence relation
ak  ak 1  2  ak 2 k  2
And that also satisfies the initial condition
a0  1 and a1  8
Solution: The characteristics equation of the relation
ak  ak 1  2  ak 2 k  2
t 2  t  2  0  t  2t  1  0
t  1,2
rn  20 ,21 ,22 ,... and sn   1 ,  1 ,  1 ,...
0 1 2

Are both sequence which satisfy above relation but neither one is having
a0  1 and a1  8
Now since an  Crn  Dsn also satisfies the same recurrence relation and
For n  0 we get ao  Cro  Dso  1  C  D (1)
For n  1 we get a1  Cr1  Ds1  8  2C  D (2)
Solving equation (1) and (2) we get, C  3 and D  - 2
Now an  Crn  Dsn  an  3  2n  2 1n
is the required sequence which satisfies the given conditions

General Homogenous Recurrence Relations (Constant Coefficients)


K order: General Homogenous Recurrence
• First order: linear combination of two cons. terms,
• Second order: linear combination of three consecutive terms,
• We extend technique of recurrence equation with resolution of homogeneous linear
recurrence with constant coefficient, that is recurrence of the form
a0 tn + a1 tn-1 + …..+ak tn-k = 0 (1)
where ti are value we are looking for
• In equation (1), values of ti such that (1 < i < k) are need to determine a sequence.
• Equation 1 typically has infinite many solutions, because linear combination is also a
solution.

Dr. Nazir Ahmad Zafar | Virtual University of Pakistan


46 CS-702 Advanced Algorithms Analysis and Design

K = 1: General Homogenous Recurrence


a0 tn + a1 tn-1 + …..+ak tn-k = 0 (1)
If we put k = 1 then above equation becomes
a0 tn + a1 tn-1 = 0
tn = -(a1 / a0 )tn-1
• The resultant equation becomes a recurrence relation which is
– first order
– linear
– homogenous
– with constant coefficients.

K = 2: General Homogenous Recurrence


a0 tn + a1 tn-1 + …..+ak tn-k = 0 (1)
If we put k = 2 then above equation becomes
a0 tn + a1 tn-1 + a2 tn-2 = 0
tn = -(a1 / a0 )tn-1 - (a2/ a0 )tn-2 = c1tn-1 + c0 tn-2

• This time we have a recurrence relation which is


– second order
– linear
– homogenous
– with constant coefficients.

K = 3: General Homogenous Recurrence


a0 tn + a1 tn-1 + …..+ak tn-k = 0 (1)
If we put k = 3 then above equation becomes
a0 tn + a1 tn-1 + a2 tn-2 + a3 tn-3 = 0
tn = -(a1 / a0 )tn-1 - (a2/ a0 )tn-2 - (a3/ a0 )tn-3
• This is a recurrence relation which is
– third order
– linear
– homogenous
– with constant coefficients.
• Similarly we can have fourth order and higher order recurrence relations.

Characteristics of General Recurrence


a0 tn + a1 tn-1 + …..+ak tn-k = 0 (1)
The recurrence is:
• Linear because it does not contain terms of the form tn-i .tn-j ,t2n-i and so on
• Homogeneous because the linear combination of the tn-i equal to zero
• This is Kth order because current term is linear combination of previous k number of
terms
• Constant coefficients because all ai are constants

Dr. Nazir Ahmad Zafar | Virtual University of Pakistan


47 CS-702 Advanced Algorithms Analysis and Design

Example:
• Consider Fibonacci sequence: fn = fn-1 + fn-2
• This recurrence fits Eq. (1) after obvious rewriting. fn - fn-1 - fn-2 = 0

Observation of Homogenous Recurrence


• fn - fn-1 - fn-2 = 0
• The Fibonacci sequence corresponds to a second homogeneous linear recurrence
relation with constant coefficient, where
k = 2,
a0 =1,
a1 = -1
a2 = -1
• Before we even start to look for solutions to Equation 1, it would be interesting to note
that any linear combination of solutions is itself a solution.

Theorem
Statement: Prove that any linear combination of solutions of equation given below is also a
solution.
a0 tn + a1 tn-1 + …..+ak tn-k = 0
Proof: Assume that fn and gn are solutions of above equation and hence satisfy it, i.e.
k k

a f
i 0
i n i  0 and  ai g n i  0
i 0

• If we set tn = c.fn + d.gn for arbitrary constants c and d, we have to prove that tn is also
solution, i.e.,
• a0tn + a1tn-1 +……+ ak tn-k = 0
a0tn + a1tn-1 +……+ ak tn-k =
a0 (cfn + dgn) + a1(cfn-1+ dgn-1) + . . .+ak(cfn-k+dgn-k) =
c( a0fn + a1fn-1 + . . .+ akfn-k ) +d(a0gn + a1gn-1 + . . .+ akgn-k) =
= c.0 + d.0 = 0
• Hence a0tn +a1tn-1 +……+ ak tn-k = 0
Note :
• It is to be noted that this rule can be generalized to linear combinations of any number
of solutions.

More Generalized Results


Statement: If fn, gn and hn are solutions to recurrence below then their linear combination is also
a solution a0 tn + a1 tn-1 + …..+ak tn-k = 0

Proof: As fn , gn and hn are solutions of above, hence


k k k

 ai f ni  0,
i 0
 ai g ni  0, and  ai hni  0
i 0 i 0

• Let tn = c.fn + d.gn + e.hn for arbitrary constants c, d and e, now we prove that tn is also
solution, i.e., a0tn + a1tn-1 +……+ ak tn-k = 0, easy to prove

Dr. Nazir Ahmad Zafar | Virtual University of Pakistan


48 CS-702 Advanced Algorithms Analysis and Design

Conclusion
• Why recurrence?
• Type of recurrences
• Techniques solving recurrences
• Generalized form of recurrence
• Linear combination of solutions itself solution
• Reusability of models when initial conditions are changed but pattern remains same
• It empowers the recursive models to be used in more general phenomena
• Easy implementation

Dr. Nazir Ahmad Zafar | Virtual University of Pakistan


49 CS-702 Advanced Algorithms Analysis and Design

Lecture No 8
Recurrence Relations
(Algorithms Design and Analysis Techniques)

Today Covered
• Solution: General Homogenous Recurrences when
– Roots are distinct
– Roots are repeated
– multiplicity of a root is k
– many roots with different multiplicities
• Non-homogenous Recurrence Relations
• Characteristics of various type of non-homogenous recurrence relations
• Solution to various non-homogenous recurrence relations
• Conclusion

Solution to Generalized Recurrence with Distinct Roots


Statement:
• Find the general solution of the kth order recurrence given below assuming that all roots
are distinct a0 tn + a1 tn-1 + …..+ak tn-k = 0
Solution:
Let Tn = xn, x is a constant as yet unknown.
• If we assume that Tn is a solution of equation a0 tn + a1 tn-1 + …..+ak tn-k = 0
Then, a0xn + a1xn-1 +…….+ akxn-k = 0
• Equation satisfied if x = 0 ,trivial solution, no interest.
• Otherwise, the equation is satisfied if and only if a0 + a1x1 +…….+ akxk = 0
• This equation of degree k in x is called the characteristic equation of above recurrence
and
P(x) = a0 + a1x1 +…….+ akxk is called its characteristic polynomial
• Fundamental theorem of algebra states that polynomial P(x) of degree k has k roots, not
necessarily distinct
• It means that it can be factorized as a product of k terms P(x) = (x-r1) (x-r2) (x-r3). . .(x-rk)
where ri may be complex numbers.
• Moreover, these ri are only solutions of equation P(x) = 0
• Consider any root ri of the characteristic polynomial P(x) = a0 + a1x1 +…….+ akxk
k
  ( x  ri )
i 1
• Since, p(r1) = 0, p(r2) = 0, p(r3) = 0, . . ., p(rk) = 0
• Hence all x = ri , for i  {1, 2, . . .,k} are solutions to above characteristic polynomial.
• Therefore, r1n, r2n, . . ., rkn are solution to our original recurrence relation.
• Since linear combination of solutions is also a solution to recurrence, therefore below is
k
a solution. T (n)  c r
n
i i
i 1
where, c1, c2, . . ., ck are all constants to be determined finding particular solution
• The remarkable fact is that this equation has only solutions of this form provided all r i
are distinct.
• Constants can be determined from k initial conditions by solving system of k linear
equations in k unknowns

Dr. Nazir Ahmad Zafar | Virtual University of Pakistan


50 CS-702 Advanced Algorithms Analysis and Design

Solving Recurrence Problem with Distinct Roots


Problem: Consider the recurrence tn = n if n = 0, 1, 2
tn = 7.tn-2 + 6.tn-3 otherwise
Find the general solution of the recurrence above.

Solution: First we rewrite the recurrence.


tn - 7.tn-2 - 6tn-3 = 0
• The characteristic equation become.
x3 – 7x + 6 = (x + 1) (x + 2)(x - 3)
• The roots are: r1 = -1, r2 = - 2 and r3 = + 3
tn = c1 (-1)n + c2 (-2)n + c3 (3n)
tn = c1 (-1)n + c2 (-2)n + c3 (3n)
The initial conditions give
c1 + c2 + + c3 = 0 for n = 0
- c1 - 2c2 + 3c3 = 1 for n = 1
c1 + 4c2 + 9c3 = 2 for n = 2
Solving these equations, we obtain
c1 = -1/4, c2 = 0 and c3 = 1/4
Therefore, tn = c1 (-1/4)(-1)n + (1/4).(3)n

Solution to Generalized Recurrence with One Repeated Root


Statement:
If the characteristic polynomial P(x) = a0 + a1x1 +…….+ akxk then conclude that
if r is a double root then tn = rn and tn = n rn are both solutions to recurrence.
Solution:
• It can be found as in case of second order linear homogenous recurrence relation.
• Since r is a multiple root. By definition of multiple roots, there exists a polynomial q(x) of
degree k-2 such that the following holds

p(x) = (x –r)2q(x), for every n  k


Consider the kth degree polynomials
un (x) = a0 xn + a1 xn-1 + . . . + ak xn-k and
vn (x) = a0 n xn + a1 (n-1)xn-1 + . . . + ak (n-k)xn -k
• It is to be noted that vn(x) = x.un‟ (x), where un‟ (x) denotes the derivative of un (x) with
respect to x .
• But un (x) can be written as
un (x) = xn-k p(x) = xn-k (x-r)2q(x) = (x-r)2(xn-k q(x))
• Using rule for computing the derivative of a product of functions, we obtain that
derivative of un(x) with respect to x is given by
un (x) = 2 (x-r) xn-k q(x) +(x-r)2(xn-k q(x))‟

therefore un‟ (r) = 0, which implies that vn (r) = r . un‟ (r) = 0 for all n  k.
• It means: a0 n rn + a1 (n-1) rn-1 +. . .+ ak (n-k) rn-k = 0
• Hence, tn = n rn is also solution to the recurrence.
• Now we conclude that if r is a double root then tn = rn and tn = n rn are both solutions to
the recurrence.
• Rest of k-2 are all distinct roots hence general solution
where c1, c2, b1, b2,. . ., and bk-2 are all real constants

Dr. Nazir Ahmad Zafar | Virtual University of Pakistan


51 CS-702 Advanced Algorithms Analysis and Design

Higher Order Homogenous Recurrence with k-multiplicity of a Root


Now if we have to solve recurrence order k, then to solve polynomial, degree k, given below is
sufficient
Statement:
If the characteristic polynomial
P(x) = a0 + a1x1 +…….+ akxk
has r as double root then it can be written as
p(x) = (x –r)2q(x), for every n  k
and solutions are: rn and n rn
has r as triple root then it can be written as
p(x) = (x –r)3q1(x), for every n  k
and solutions are: rn, n.rn and n2.rn

K-Multiplicity of a Root: General Result


r has multiplicity k then it can be written as
p(x) = (x –r)k, for every n  k
and solutions are: rn, n.rn, n2.rn,. . ., nk-1.rn
then general solution is
tn  c1r n  c2 nr n  ...  ck n k 1r n
k
t n   c j n j 1r n
j 1
where b1, b2,. . ., bk are all real constants

Multiplicity of Roots: More General Result


If there are l roots, r1, r2, . . ., rl with multiplicities m1, m2, . . ., ml respectively, of the polynomial:
P(x) = a0 + a1x1 +. . .+ akxk s.t. m1 + m2 + . . .+ ml = k
then the general solution to the recurrence is
t n  c11r1  c12nr1  c13n 2 r1  ...  c1m1 n m1 1r1 
n n n n

c21r2  c22nr2  c23n 2 r2  ...  c2 m2 n m2 1r2 


n n n n

...
cl1rl  cl 2 nrl  cl 3n 2 rl  ...  clml n ml 1rl
n n n n

t n  c11r1  c12nr1  c13n 2 r1  ...  c1m1 n m1 1r1 


n n n n

c21r2  c22nr2  c23n 2 r2  ...  c2 m2 n m2 1r2 


n n n n

...
cl1rl  cl 2 nrl  cl 3n 2 rl  ...  clml n ml 1rl
n n n n

m1 m2 ml
tn   c1 j n j 1r1   c2 j n j 1r2  ...   clj n j 1rl
n n n

j 1 j 1 j 1
l mi
tn   cij n j 1ri
n

i 1 j 1
where all ci, j are constants

Dr. Nazir Ahmad Zafar | Virtual University of Pakistan


52 CS-702 Advanced Algorithms Analysis and Design

Statement: Consider the recurrence


tn = n if n = 0, 1, 2
tn = 5tn-1 - 8tn-2 + 4tn-3 otherwise
Find general solution of the recurrence above.
Solution: First we rewrite the recurrence.
tn - 5tn-1 + 8tn-2 - 4tn-3 = 0
• The characteristic equation become.
x3 – 5x2 + 8x -4 = (x-1) (x-2)2
• The roots are: r1 = 1 of multiplicity m1 = 1 and r2 = 2 of multiplicity m2 = 2, and hence the
general solution is
tn = c1 1n + c2 2n + c3 n 2n
The initial conditions give
c1 + c 2 = 0 for n = 0
c1 + 2c2 + 2c3 = 1 for n = 1
c1 + 4c2 + 8c3 = 2 for n = 2
Solving these equations, we obtain c1 = -2, c2 = 2 and c3 = -1/2
Therefore,
tn = c1 1n + c2 2n + c3 n 2n = -2 + 2.2n – ½.n.2n = 2n+1 – n.2n-1 - 2

Non-homogeneous Recurrence of Higher Order


• Solution of a linear recurrence with constant coefficients becomes more difficult when
the recurrence is not homogeneous
• That is when linear combination is not equal to zero
• In particular, it is no longer true that any linear combination of solutions is a solution.
• Consider the following recurrence a0 tn + a1 tn-1 + . . .+ ak tn-k = bn p(n)
• The left-hand side is the same as before, but on the right-hand side we have bnp(n)
where b is a constant and p(n) is a polynomial in n of degree d.

Generalization: Non-homogeneous Recurrences


• If a recurrence is of the form
• Then the characteristics polynomial is
• Which contains one factor for the left hand side
• And other factor corresponding to the right hand side, where d is degree of polynomial
• Characteristics polynomial can be used to solve the above recurrence.

Problem 1: Non-homogeneous Recurrences


Problem:
Consider the recurrence below. Find its solution tn – 2tn-1 = 3n
Solution:
• Compare the above recurrence with
a0 tn + a1 tn-1 + . . .+ ak tn-k = bn p(n)
• Here: b = 3, p(n) = 1, a polynomial of degree 0.
• Reducing to homogeneous case, we are given
tn – 2tn-1 = 3n (1)
Replace n by n - 1 and multiply by 3, we obtain
tn-1 – 2tn-2 = 3n-1
3tn-1 – 6tn-2 = 3n
From (1) and (2)
tn – 2tn-1 = 3n (1)
+ 3tn-1 – 6tn-2 = 3n (2)

Dr. Nazir Ahmad Zafar | Virtual University of Pakistan


53 CS-702 Advanced Algorithms Analysis and Design

Subtracting 2 from equation 1, we get


tn - 5tn-1 + 6tn-2 = 0
• The characteristic equation is x2 - 5x + 6 = 0
Roots of this equation are: x = 2 and x = 3
• And therefore general solution is tn = c1 2n + c2 3n

It is not always true that an arbitrary choice of c1 and c2 produces a solution to the recurrence
even when initial conditions are not taken into account.
Note:
It is to be noted that solutions:
tn = 2n and
tn = 3n
which are solutions to reduced recurrence, are not solution to original one
What is the reason?

Problem 2: Non-homogeneous Recurrences


Find general solution of the following recurrence. tn - 2tn-1 = (n + 5) 3n n  1
Solution:
The manipulation needed to transform this into a homogeneous recurrence is slightly
more complicated than with first example.
tn - 2tn-1 = (n + 5) 3n n  1 (1)
replace n by n-1, n-2, we get
tn-1 - 2tn-2 = (n + 4) 3n-1 n  2 (2)
tn-2 - 2tn-3 = (n + 3) 3 n  3
n-2
(3)
Above equations can be written as
tn - 2tn-1 = 9(n + 5) 3n-2 n  1 (4)
tn-1 - 2tn-2 = 3(n + 4) 3 n  2
n-2
(5)
tn-2 - 2tn-3 = (n + 3) 3n-2 n  3 (6)
• Our objective is to eliminate the right hand side of the above equations to make it
homogenous.
• Multiply (5) by -6, and (6) by 9 we get
tn - 2tn-1 = 9(n + 5) 3n-2
- 6tn-1 + 12tn-2 = -18(n + 4) 3n-2
+ 9tn-2 - 18tn-3 = 9(n + 3) 3n-2
After simplification, the above equations can be written as
tn - 2tn-1 = (9n + 45) 3n-2
- 6tn-1 + 12tn-2 = (-18n – 72) 3n-2
+ 9tn-2 - 18tn-3 = (9n + 27) 3n-2

Adding these equation, we get homogenous equation, which can be solved easily
tn - 8tn-1 + 21tn-2 - 18tn-3 = 0
tn – 8tn-1 + 21tn-2 - 18tn-3 = 0
The characteristics equation of the above homogenous equation is:
x3 – 8x2 +21x -18 = 0
( x-2) (x-3)2 = 0
and hence, x = 2, 3, 3
• General solution is: tn = c1 2n + c2 3n + c3 n 3n
• For n = 0, 1, 2
We can find values of c1, c2, c3 and then
tn = (t0 - 9) 2n + (n + 3)3n+1

Dr. Nazir Ahmad Zafar | Virtual University of Pakistan


54 CS-702 Advanced Algorithms Analysis and Design

Tower of Hanoi: Problem 3


Tower of Hanoi is a mathematical game or puzzle. It consists of three towers, a number of disks
of different sizes which can slide onto any tower. The puzzle starts with disks stacked in order of
size on one tower, smallest at top, making a conical shape.
Objective is to move entire stack to another tower, obeying following rules:
• Only one disk may be moved at a time.
• Each move consists of taking upper disk from one of towers and sliding it onto another
tower
• You can put on top of other disks already present
No disk may be placed on top of a smaller disk.

More Generalized Non-homogeneous Recurrences


• If a recurrence is of the form a0 t n  a1t n1  . . .  ak t nk  b1 p1 (n)  b2 p2 (n)  ...
n n

k 1 d 1 d 1
Then the characteristics polynomial is (a0 x  a1 x  . . .  ak )( x  b1 1 )( x  b2 2 )...,
k

• Which contains one factor for the left hand side
• And other factor corresponding to the each term on right hand side.
• Once the characteristics polynomial is obtained the recurrence can be solved as before.

Problem 6 : Non-homogeneous Recurrences


Consider the recurrence
tn = 2tn-1 + n + 2n otherwise
Solution:
• Compare the recurrence: tn - 2tn-1 = n + 2n with
• Here, b1 = 1, p1(n) = n, b2 = 2, and p2(n) = 1.
• Degree of p1(n) = d1 = 1,
• Degree of p2(n) = d2 = 0.
• The characteristic polynomial: (x-2) (x-1)2 (x-2)
• The roots are, x = 1, 2, both of multiplicity 2.
• All solutions of recurrence therefore have form
tn = c1 1n + c2 n1n + c3 2n + c4 n 2n
n + 2n = (2c2 - c1 ) – c2 n + c4 2n
• For n = 0, 1, 2, 3 c1, c2, c3 and c4 can be solved and hence solution is
tn= n.2n +2n+1 – n -2

Conclusion
• Recursive relations are important because used in divide and conquer, dynamic
programming and in many other e.g. optimization problems
• Analysis of such algorithms is required to compute complexity
• Recursive algorithms may not follow homogenous behavior, it means there must be
some cost in addition to recursive cost
• Solution to homogenous recursive relations is comparatively easy, but not so easy in
case of non-homogenous recursive relations

Dr. Nazir Ahmad Zafar | Virtual University of Pakistan


55 CS-702 Advanced Algorithms Analysis and Design

Lecture 9
Further Techniques Solving Recurrence Relations
Algorithms Analysis Techniques

Review of Previous Lecture


• If a recurrence is of the form a0tn  a1tn1  . . .  ak tnk  b1 p1 (n)  b2 p2 (n)  ...
n n

d1 1

k 1
Then the characteristics polynomial is (a0 x  a1 x  . . .  ak )( x  b1 )
k
( x  b2 ) d 2 1...,
• It has one factor for left hand side for homogenous part, and factor corresponding to
each term on right hand side for non-homogenous part.
• Once the characteristics polynomial is obtained the recurrence can be solved as before.

Today Covered
In this lecture following will be covered
– Assumptions in solving recurrence
– The Substitution Method
– The Recursion Tree Method
– The Master Theorem
– Conclusion

Assumption in Solving Recurrence Relation


• Neglect certain technical details solve recurrences
• Assume integer arguments to functions
– Because running time T (n) is always defined when n is an integer
• Consequently, for convenience, we shall omit statements of boundary conditions of
recurrences and assume that T (n) is constant for small n
• Recurrence for worst-case time of MERGE-SORT
(1) if n  1

T ( n)    n  n
T  2   T  2   (n) otherwise
    
• We do not give any explicit value for small n
• Because changing n, T (1) changes solution to recurrence. Solution typically doesn‟t
change by more than a constant factor, so order of growth is unchanged
• Solve recurrences, often omit floors, ceilings, etc.
• First analyze without these details and later determine whether such assumptions matter
or not.
• Usually it dose not matter but it is important to know when it does and when it does not
(1) if n  1

T ( n)   n
 2.T ( )  (n) otherwise
 2

Methods Solving Recurrence Relation


Substitution Method
• Substitution method has two steps
• Guess the form of the solution
• Use mathematical induction to find constants and show that the solution does
work

Dr. Nazir Ahmad Zafar | Virtual University of Pakistan


56 CS-702 Advanced Algorithms Analysis and Design

• The name Substitution comes from the substitution of guessed answer for the function
when the inductive hypothesis is applied to smaller values.
• Method is powerful, but it can be applied only in cases when it is easy to guess the form
of answer
• The substitution method can be used to establish either upper or lower bounds on a
recurrence.

Some Important Rules used in this Section


Prove that log a b  log b c  log a c
Proof
let us suppose that: log ba  s log bc  t
 a s  b and bt  c
Now bt  c, (a s )t  c
a st  c, log ca  s  t
s  t  log ca , log ba  log bc  log ca proved

Some Important Rules used in this Section


logn4
 nlog4
3
Prove that 3
 nlog4
logn4 3
Proof 3
 log 3 (3log4 )  log 3 (nlog4 )
n 3

 log n4  log 33  log 34  log 3n


 log n4  log 34  log 3n
 log n4  log n4  log ba  log bc  log ca
The Substitution Method
Solve the recurrence relation given below.
1 if n  1

T ( n)   n
3  T ( )  n otherwise
 4
Solution:
n
(1) T (n)  3  T ( )  n
4
replace the value of n by n 4 in (1)
n n n
(2) T ( )  3  T ( 2 ) 
4 4 4
n n n
(3) T ( 2 )  3  T ( 3 )  2 and so on
4 4 4
n n n
(4) T ( k 1 )  3  T ( k )  k 1
4 4 4
n
Now substitutethe value of T ( ) from (2) to (1)
4

Dr. Nazir Ahmad Zafar | Virtual University of Pakistan


57 CS-702 Advanced Algorithms Analysis and Design

 n n
(5) T (n)  33T ( 2 )    n
 4 4
n 3
 32  T ( 2 )  ( )  n  n
4 4
n
substitute the value of T ( 2 ) from (3) to (5) equation, we have
4
 n n 3
T (n)  32 3  T ( 3 )  2   ( )n  n
 4 4  4

After continuing this process


n 3 3 3 3
T (n)  3k  T ( k )  ( ) k 1 n  ( ) k 2      ( )n  ( ) 0 n
4 4 4 4 4
Let us supposethat n can be expressed as n  4k
n  3 3 3 
T (n)  3k  T ( )  n 1  ( )  ( ) 2  ....  ( ) k 1 
n  4 4 4 
 3 
 1  ( )k 
4 ) k 1 1 xk
T (n)  3k  T (1)  n 1 (    2
   
3 
1 x x ... x 1 ( )
 1  1  x
 4 
3k
T (n)  3 1  4n(1  k )
k
T (1)  1
4
3k 3k
T (n)  3k  4n  (1  k )  3k  4n  (1  )
4 n
n3 k
 3k  4n( )
n
 3k  4(n  3k )  1 3k  4n  4  3k
 4  n  3  3k  4n  3  3log4
n

 4k  n, k  log n4
T (n)  4n  3  3log4
n

T (n)  4n  3  nlog4
3

T (n)  4n  3  n  0    1
 T (n)  4n  3  n
Hence T (n)  (n) let   log 34

Dr. Nazir Ahmad Zafar | Virtual University of Pakistan


58 CS-702 Advanced Algorithms Analysis and Design

A Hard Example
Solve the recurrence relation given below
1 if n  1

T ( n)   n where 0  a  b
 aT ( )  n otherwise
 b
Solution :
n n n
T (n)  aT ( )  n  a  a  T ( 2 )  a   n
b b b
n a  n n a
 a 2  T ( 2 )  ( )n  n  a 2 aT ( 3 )  2   ( )n  n
b b  b b  b
n a a
 a 3T ( 3 )  ( ) 2 n  ( )n  n
b b b
Continuing this process we get
n a a a
T (n)  a k T ( k )  ( ) k 1 n  ( ) k 2 n  ....  ( )1 n  n
b b b b
n  a a a 
 a k T ( k )  n 1  ( )  ( ) 2  ....  ( ) k 1 
b  b b b 
Let us supposethat, n  b k

 a a 
T (n)  a k  T (1)  n 1  ( )  ....  ( ) k 1 
 b b 
 a 
1  ( )k 
b b ak
 a k T (1)  n   k
  
a 
a T (1) n ( )(1 )
 1  b  a b k

 b 
b bk  a k b bk  a k
 a k  1  n( )( )  a k
 n ( )( )  n  bk
ba bk ba n
b b b
 ak  ( )(b k  a k )  a k   bk   ak
ba ba ba
b b  a  b b b a b k
  bk  ( )a k   bk  ( )a
ba ba ba ba

b a n
T ( n)  ( )  bk   a logb
ba ba
b a
let   log ba
a
  bk   n logb
ba ba
 a  b  log ba  1  0   1
b a
 T ( n)  n   n  T (n)  (n)
ba ba

Dr. Nazir Ahmad Zafar | Virtual University of Pakistan


59 CS-702 Advanced Algorithms Analysis and Design

More Hard Example using Substitution Method

Solve the recurrence relation given below.


1 if n  1

T ( n)   n
3  T ( )  cn 2 otherwise
 4

Solution:
n
(1) T (n)  3  T ( )  cn 2
4
n n n
(2) T ( )  3  T ( 2 )  c( ) 2
4 4 4
n n n
(3) T ( 2 )  3  T ( 3 )  c( 2 ) 2
4 4 4
n n n
(4) T ( 3 )  3  T ( 4 )  c( 3 ) 2
4 4 4
and so on
n n n
(5) T ( k 1 )  3  T ( k )  c( k 1 ) 2
4 4 4

n
Now substitutethe value of T ( ) from (2) to (1)
4
 n n 
(6) T (n)  33T ( 2 )  c( ) 2   cn 2
 4 4 
n n
 32 T ( 2 )  3c( ) 2  cn 2
4 4
n
substitute the value of T ( 2 ) from (3) to (6), we have
4
 n n  n
T (n)  32 3T ( 3 )  c( 2 ) 2   3c  ( ) 2  cn 2
 4 4  4
n n n
 33 T ( 3 )  32 c( 2 ) 2  3c  ( ) 2  cn 2
4 4 4
n 3 3
 33 T ( 3 )  ( 2 ) 2 cn 2  ( 2 )1 cn 2  cn 2
4 4 4
After continuing this process, we get
n  3 3 3 
T (n)  3k T ( k )  ( 2 ) k 1  ( 2 ) k 2      ( 2 ) 0  cn 2
4  4 4 4 
Let us supposethat n can be expressed as n  4k
 3 3 3 
T (n)  3k T (1)  cn 2 1   ( ) 2      ( ) k 1 
 16 16 16 

Dr. Nazir Ahmad Zafar | Virtual University of Pakistan


60 CS-702 Advanced Algorithms Analysis and Design

 3 
 1  ( )k 
16 ) 16 3k
T (n)  3k 1  cn 2 (  3k  cn 2  (1  k )
3  13 16
 1 
 16 
since 4k  n  (4k ) 2  n 2
 (42 ) k  n 2  16k  n 2
3k 2 16 n  3
2 k
2 16
T (n)  3  cn  (1  k )  3  cn  (
k k
)
13 16 13 n 2
16 16 16
 3k   c  (n 2  3k )  c  n 2  (1  c)3k
13 13 13
16 2 16 logn
T (n)  cn  (1  c)3 4
13 13
16 16
 cn 2  (1  c)n log4
3

13 13
let log 4   where 0    1
3

16 16
T (n)  cn 2  (1  c)n
13 13
Hence T (n)  (n ) 2

Observations
1 if n  1

T ( n)   n
 a  T ( )  cn k otherwise
 b
 en k  fn logb supposeb k1  a
a

b k1
 en k  fn logb
 en k  f .n k1 .logb  en k  f .n k1
b

 (n max( k ,k1 ) )

Recursion Tree Method


• Although substitution method can provide a sufficient proof that a solution to a
recurrence is correct, sometimes difficult to give a good guess.
• Drawing out a recursion tree, is a straight forward way to devise a good guess.
• In recursion tree, nodes represent costs of a sub-problems in the set of recursive
function invocations.
• We sum costs within each level of the tree to obtain a set of per-level costs.
• And then we sum all per-level costs to determine the total cost of all levels of the
recursion.
• Recursion trees are particularly useful when recurrence describes running time of divide
and conquer algos.
• Recursion tree is best one used to generate a good guess, which is then verified by
substitution method
• When using a recursion tree to generate a good guess, we can often tolerate a small

Dr. Nazir Ahmad Zafar | Virtual University of Pakistan


61 CS-702 Advanced Algorithms Analysis and Design

amount of sloppiness since we have to verify it later on.


• If we are careful when drawing out a recursion tree and summing costs, then we can use
a recursion tree as a direct proof of a solution to any recurrence of any problem.
• Here, we will use recursion trees directly to prove theorem that forms the basis of the
master method.

Example: Solve the following recurrence using recurrence tree method



(1) if n  1
T ( n)  
n
3.T ( )  (n 2 ) if otherwise
 4

Solution: The above recurrence can be written in the form



1 if n  1
T ( n)  
n
 3.T ( )  cn 2 if otherwise
 4

Assumption: We assume that n is exact power of 4.

Dr. Nazir Ahmad Zafar | Virtual University of Pakistan


62 CS-702 Advanced Algorithms Analysis and Design

Now the total computation cost would be


= Cost of Childs + Cost of tree excluding childes
= Cost of Child x total number of Childs + Cost of all levels excluding childes level
= total number of Childs + sum of costs at each level excluding childes level.

Dr. Nazir Ahmad Zafar | Virtual University of Pakistan


63 CS-702 Advanced Algorithms Analysis and Design

T (n)  3log4  cost at Levels above child level


n

 3 3 3 
T (n)  (n log3 )  ( 2 ) 0  ( 2 )1      ( 2 ) k 1  cn 2
4

 4 4 4 

Now total computational cost can be calculated as


 3 3 3 
T (n)  (n log3 )  ( 2 ) 0  ( 2 )1      ( 2 ) k 1  cn 2
4

 4 4 4 
Where 4  n  k  log 4 n
k

4  3 3 
T (n)  (n log3 )  ( 2 ) 0  ( 2 )1     cn 2
 4 4 
4 1 4 16
T (n)  (n log3 )  ( )cn 2  (n log3 )  cn 2
3 13
1 ( )
16
Hence T (n)  (n )
2

Master Theorem

Lemma 1: Let a  1, b > 1 be constants, f(n) a non-negative function defined on exact power of
b by recurrence

(1) if n  1
T ( n)   n
a.T ( )  f (n) if n  b i
 b

where i is a positive integer. Then


logb n 1
n
T (n)  (n logb a
) j 0
a j. f (
bj
)

Lemma 2: Let a  1, b > 1 be constants, let f(n) be a non-negative function defined on exact
power of b. A function g(n) defined over exact powers of b by

logb n 1
n
g ( n)  j 0
a j. f (
bj
)

can be bounded asymptotically for exact powers of b as


logb a
), for some constants   0, then g (n)  (nlogb )
a
1. If f (n)  (n
a a
2. If f (n)  (n b ), then g (n)  (n b . lg n)
log log

3. If a.f(n/b) ≤ c.f(n), for some constant c < 1 and for all n  b, then g(n) = (f(n))

Dr. Nazir Ahmad Zafar | Virtual University of Pakistan


64 CS-702 Advanced Algorithms Analysis and Design

Proof:
logb a
Case 1: f (n)  (n )
n n a 
Which implies that f ( j
)  (( j ) logb ) (1)
b b
logb n 1
n
We are given that: g (n)  j 0
a j. f (
bj
) (2)

Substituting value from Equation (1) in Equation (2)


logb n 1
n logb a
g (n)  ( j 0
a j .(
bj
) )

logb n 1 logb 1
a.b j
n
n logb a
• Consider: 
j 0
j
a .( j )
b
n logb a
.  ( logba )
j 0 b
a
• Assume that: logb a
x
b
a
• Taking log on both sides: log b ( logba
)  log b x
b
logba

log b  log b  log b x  log b  log b . log b  log b x


a b a a b

log b  log b  log b x  0  log b x  x  1


a a

logb n 1 logb 1
a.b j logb 1
n n
n logb a
j 0
j
a .( j )
b
n logb a
.  ( logba )  n
j 0
logb a
.  (b ) j
j 0
b
a
 nlogb .((b )0  (b )1  ...  (b )logb 1 )
n

It is a geometric series with first term 1, common ratio b and number of terms as logbn. Hence
g(n),
 . logb n
(b ) logb  1  .logb b
n

logb a logb a b 1 logb a n 1


n ( 
)  n ( 
)  n ( 
)
b 1 b 1 b 1
a  n  1 a a  a
 n logb (  )  c.n logb  c.n logb  (n logb ) Hence proved
b 1
log a
Case 2: f (n)  (n b )
n n a
Which implies that: f ( j )  (( j ) logb ) (3)
b b
logb n 1
n
We are given that: g (n)   a . f ( j )
j
(4)
j 0 b
Substituting value from Equation (3) in Equation (4)
logb n 1 logb 1 n
n logb a a
g (n)  ( 
j 0
a .( j ) )  (n .  ( logba ) j )
j

b
logb a

j 0 b

Dr. Nazir Ahmad Zafar | Virtual University of Pakistan


65 CS-702 Advanced Algorithms Analysis and Design

a
We have already proved that logb a
1
b
logb n 1

1)  (n
a
logb a a
g (n)  (n logb . . (1  1  ...  1 )  (nlogb . log b )
n
case is proved
j 0

logb n number of terms

Case 3:
n n c
Given that: a. f ( )  c. f (n)  f ( )  . f ( n)
b b a
n c n c n c
f ( 2 )  . f ( )  ( ) 2 . f ( n)  f ( 2 )  ( ) 2 . f ( n)
b a b a b a
n c n c n c
f ( 3 )  ( ) 2 . f ( )  ( ) 3 . f ( n)  f ( 3 )  ( ) 3 . f ( n )
b a b a b a
n c j
In general: f ( j )  ( ) . f (n)
b a
n
Equivalently: a j . f ( j )  c j . f (n)
b
logb n 1
n
We are given that: g (n)   j 0
a j. f (
bj
) (5)

n
We have proved that: a j . f ( j
)  c j . f ( n) (6)
b
From equation (5) and (6)
logb n 1 logb 1 n

n
g ( n)   a . f ( j )   c j . f ( n )   c j . f ( n )
j

j 0 b j 0 j 0

1
g (n)  f (n)( )  ( f (n)) (7)
1 c

Since f(n) appears in definition of g(n) and all terms of g(n) are non-negative, we can conclude
easily that
g (n)  ( f (n)) (8)
We have already proved, equation (7), that
g (n)  ( f (n)) (9)
From Equations (8) and (9) g (n)  ( f (n))

Hence it proves the lemma

Lemma 3:
Let a  1, b > 1 be constants, let f(n) be a non-negative function defined on exact power of b.
Define T(n) on exact powers of b by the recurrence

(1) if n  1
T ( n)   n
a.T ( )  f (n) if n  b i
 b

Dr. Nazir Ahmad Zafar | Virtual University of Pakistan


66 CS-702 Advanced Algorithms Analysis and Design

where is a positive integer. Then T(n) can be bounded asymptotically for exact powers of b as
logb a
), for some constants   0, then T (n)  (nlogb )
a
1. If f (n)  (n
logb a a
2. If f (n)  (n ), then T (n)  (nlogb . lg n)
a
3. If f (n)  (n b ) for some  > 0, and a.f(n/b) ≤ c.f(n) for some constant c < 1and
log

sufficiently large n, then T(n) = (f(n))


Proof: Case 1

(1) if n  1
Given that T (n)  
n
a.T ( )  f (n) if n  b i
 b
logb n 1
n
By Lemma 4.2: T (n)  (n
logb a
) j 0
a j. f (
bj
)

logb a a
By Lemma 4.3: T (n)  (n )  (nlogb )
Hence for case 1 it is proved
Case 2

(1) if n  1
Again given that T (n)  
n
a.T ( )  f (n) if n  b i
 b
logb n 1
n
By Lemma 4.2: T (n)  (n
logb a
) j 0
a j. f (
bj
)

logb a logb a
By Lemma 4.3: T (n)  (n )  (n . lg n)
Hence for case 2 it is also proved
Case 3
logb n 1
n
By Lemma 4.2: T (n)  (n
logb a
) j 0
a j. f (
bj
)

logb a
By Lemma 4.3: T (n)  (n )  ( f (n))
a
Since f (n)  (n b )
log

Hence T (n)  ( f (n))


This proves the Lemma 3

Conclusion
• First Order homogenous linear recurrence is in fact a geometric sequence
• We studied characteristics of second and higher order linear homogenous recurrence
relations with constant coefficients
• Then non-homogenous recurrence relations with constant coefficients
• Different methods to solve such recurrences
• As most of the algorithms are recursive therefore to give analysis of such algorithms, we
have discussed this powerful technique.

Dr. Nazir Ahmad Zafar | Virtual University of Pakistan


67 CS-702 Advanced Algorithms Analysis and Design

Lecture No. 10
Time Complexity of Algorithms
(Asymptotic Notations)

Today Covered
• Major Factors in Algorithms Design
• Complexity Analysis
• Growth of Functions
• Asymptotic Notations
• Usefulness of Notations
• Reflexivity, Symmetry, Transitivity Relations over , , O,  and o
• Relation between ,  and O
• Various Examples Explaining each concept

What is Complexity?
• The level in difficulty in solving mathematically posed problems as measured by
– The time
(time complexity)
– number of steps or arithmetic operations
(computational complexity)
– memory space required
– (space complexity)

Major Factors in Algorithms Design


1. Correctness
An algorithm is said to be correct if
• For every input, it halts with correct output.
• An incorrect algorithm might not halt at all OR
• It might halt with an answer other than desired one.
• Correct algorithm solves a computational problem
2. Algorithm Efficiency
Measuring efficiency of an algorithm,
• do its analysis i.e. growth rate.
• Compare efficiencies of different algorithms for the same problem.

Algorithms Growth Rate


Algorithm Growth Rates
• It measures algorithm efficiency

What means by efficient?


 If running time is bounded by polynomial in the input

Notations for Asymptotic performance


• How running time increases with input size
• O, Omega, Theta, etc. for asymptotic running time
• These notations defined in terms of functions whose domains are natural numbers
• convenient for worst case running time
• Algorithms, asymptotically efficient best choice

Dr. Nazir Ahmad Zafar | Virtual University of Pakistan


68 CS-702 Advanced Algorithms Analysis and Design

Complexity Analysis
• Algorithm analysis means predicting resources such as
– computational time
– memory
– computer hardware etc
• Worst case analysis
– Provides an upper bound on running time
– An absolute guarantee
• Average case analysis
– Provides the expected running time
– Very useful, but treat with care: what is “average”?
• Random (equally likely) inputs
• Real-life inputs

Worst-case Analysis
Let us suppose that
• Dn = set of inputs of size n for the problem
• I = an element of Dn.
• t(I) = number of basic operations performed on I
• Define a function W by
W(n) = max{t(I) | I  Dn}
called the worst-case complexity of the algorithm
• W(n) is the maximum number of basic operations performed by the algorithm on any
input of size n.
• Please note that the input, I, for which an algorithm behaves worst depends on the
particular algorithm.

Average Complexity
• Let Pr(I) be the probability that input I occurs.
• Then the average behavior of the algorithm is defined as
A(n) = Pr(I) t(I), summation over all I  Dn
• We determine t(I) by analyzing the algorithm, but Pr(I) cannot be computed analytically.
• Average cost =
A(n) = Pr(succ)Asucc(n) + Pr(fail)Afail(n)
• An element I in Dn may be thought as a set or equivalence class that affect the behavior
of the algorithm
Worst Analysis computing average cost
• Take all possible inputs, compute their cost, take average

Asymptotic Notations Properties


• Categorize algorithms based on asymptotic growth rate e.g. linear, quadratic,
polynomial, exponential
• Ignore small constant and small inputs
• Estimate upper bound and lower bound on growth rate of time complexity function
• Describe running time of algorithm as n grows to .
• Describes behavior of function within the limit.
Limitations
• not always useful for analysis on fixed-size inputs.
• All results are for sufficiently large inputs.

Dr. Nazir Ahmad Zafar | Virtual University of Pakistan


69 CS-702 Advanced Algorithms Analysis and Design

Asymptotic Notations
Asymptotic Notations , O, , o, 
 We use  to mean “order exactly”,
 O to mean “order at most”,
  to mean “order at least”,
 o to mean “tight upper bound”,
•  to mean “tight lower bound”,
Define a set of functions: which is in practice used to compare two function sizes.

Big-Oh Notation (O)


If f, g: N  R+, then we can define Big-Oh as
For a given function g n   0, denoted by  g n  the set of functions,
g n    f n  : there exist positive constants c and no such that
0  f n   cg n , for all n n o 
f n   g n  means function g n  is an asymptotically
upper bound for f n .
We may write f(n) = O(g(n)) OR f(n)  O(g(n))
Intuitively:
Set of all functions whose rate of growth is
the same as or lower than that of g(n).

f(n)  O(g(n))
 c > 0,  n0  0 and n  n0, 0  f(n)  c.g(n)
g(n) is an asymptotic upper bound for f(n).

Example 1: Prove that 2n2  O(n3)


Proof:
Assume that f(n) = 2n2 , and g(n) = n3
f(n)  O(g(n)) ?
Now we have to find the existence of c and n0
f(n) ≤ c.g(n) 2n2 ≤ c.n3 2 ≤ c.n
if we take, c = 1 and n0= 2 OR
c = 2 and n0= 1 then
2n2 ≤ c.n3
Hence f(n)  O(g(n)), c = 1 and n0= 2

Dr. Nazir Ahmad Zafar | Virtual University of Pakistan


70 CS-702 Advanced Algorithms Analysis and Design

Example 2: Prove that n2  O(n2)


Proof:
Assume that f(n) = n2 , and g(n) = n2
Now we have to show that f(n)  O(g(n))
Since
f(n) ≤ c.g(n) n2 ≤ c.n2 1 ≤ c, take, c = 1, n0= 1
Then
n2 ≤ c.n2 for c = 1 and n  1
Hence, 2n2  O(n2), where c = 1 and n0= 1

Example 3: Prove that 1000.n2 + 1000.n  O(n2)


Proof:
Assume that f(n) = 1000.n2 + 1000.n, and g(n) = n2
We have to find existence of c and n0 such that
0 ≤ f(n) ≤ c.g(n) n  n0
1000.n2 + 1000.n ≤ c.n2 = 1001.n2, for c = 1001
1000.n2 + 1000.n ≤ 1001.n2
Û 1000.n ≤ n2 n2  1000.n n2 - 1000.n  0
Û n (n-1000)  0, this true for n  1000
f(n) ≤ c.g(n) n  n0 and c = 1001
Hence f(n)  O(g(n)) for c = 1001 and n0 = 1000

Example 4: Prove that n3 O(n2)


Proof:
On contrary we assume that there exist some positive constants c and n0 such that
0 ≤ n3 ≤ c.n2 n  n0
3 2
0 ≤ n ≤ c.n n≤c
Since c is any fixed number and n is any arbitrary constant, therefore n ≤ c is not possible in
general. Hence our supposition is wrong and n3 ≤ c.n2,
n  n0 is not true for any combination of c and n0. And hence, n3 O(n2)
Some More Examples
1. n2 + n3 = O(n4)
2. n2 / log(n) = O(n . log n)
3. 5n + log(n) = O(n)
4. nlog n = O(n100)
5. 3n = O(2n . n100)
6. n! = O(3n)
7. n +1 = O(n)
8. 2n+1 = O(2n)
9. (n+1)! = O(n!)
10. 1 + c + c2 +…+ cn = O(cn) for c > 1
11. 1 + c + c2 +…+ cn = O(1) for c < 1

Dr. Nazir Ahmad Zafar | Virtual University of Pakistan


71 CS-702 Advanced Algorithms Analysis and Design

Big-Omega Notation ()


If f, g: N  R+, then we can define Big-Omega as
For a given function g n  denote by g n  the set of functions,
g n    f n  : there exist positive constants c and no such that
0  cg n   f n  for all n n o 
f n   g n , means that function g n  is an asymptotically
lower bound for f n .
We may write f(n) = (g(n)) OR f(n)  (g(n))

Intuitively:
Set of all functions whose rate of growth is the same as or higher than that of g(n).

f(n)  (g(n))
 c > 0,  n0  0 , n  n0, f(n)  c.g(n)
g(n) is an asymptotically lower bound for f(n).

Example 1: Prove that 5.n2  (n)


Proof:
Assume that f(n) = 5.n2 , and g(n) = n
f(n)  (g(n)) ?
We have to find the existence of c and n0 s.t.
c.g(n) ≤ f(n) n  n0
c.n ≤ 5.n2 c ≤ 5.n
if we take, c = 5 and n0= 1 then
c.n ≤ 5.n2 n  n0
And hence f(n)  (g(n)), for c = 5 and n0= 1

Example 2: Prove that 5.n + 10  (n)


Proof:
Assume that f(n) = 5.n + 10, and g(n) = n
f(n)  (g(n)) ?

Dr. Nazir Ahmad Zafar | Virtual University of Pakistan


72 CS-702 Advanced Algorithms Analysis and Design

We have to find the existence of c and n0 s.t.


c.g(n) ≤ f(n) n  n0
c.n ≤ 5.n + 10 c.n ≤ 5.n + 10.n c ≤ 15.n
if we take, c = 15 and n0= 1 then
c.n ≤ 5.n + 10 n  n0
And hence f(n)  (g(n)), for c = 15 and n0= 1

Example 3: Prove that 100.n + 5  (n2)


Proof:
Let f(n) = 100.n + 5, and g(n) = n2
Assume that f(n)  (g(n)) ?
Now if f(n)  (g(n)) then there exist c and n0 s.t.
c.g(n) ≤ f(n) n  n0
2
c.n ≤ 100.n + 5
c.n ≤ 100 + 5/n
n ≤ 100/c, for a very large n, which is not possible
And hence f(n) (g(n))

Theta Notation ()


If f, g: N  R+, then we can define Big-Theta as
given function g n  denoted by g n  the set of functions,
g n    f n  : there exist positive constants c1 , c2 and no such that
0  c1 g n   f n   c2 g n  for all n n o 
f n   g n  means function f n  is equal to g n  to within a constant
factor, and g n  is an asymptotically tight bound for f n .
We may write f(n) = (g(n)) OR f(n)  (g(n))

Intuitively: Set of all functions that have same rate of growth as g(n).

f(n)  (g(n))
 c1> 0, c2> 0,  n0  0,  n  n0, c2.g(n)  f(n)  c1.g(n)
We say that g(n) is an asymptotically tight bound for f(n).

Dr. Nazir Ahmad Zafar | Virtual University of Pakistan


73 CS-702 Advanced Algorithms Analysis and Design

Example 1: Prove that ½.n2 – ½.n = (n2)


Proof
Assume that f(n) = ½.n2 – ½.n, and g(n) = n2
f(n)  (g(n))?
We have to find the existence of c1, c2 and n0 s.t.
c1.g(n) ≤ f(n) ≤ c2.g(n) n  n0
Since, ½ n2 - ½ n ≤ ½ n2 n ≥ 0 if c2= ½ and
½ n - ½ n ≥ ½ n2 - ½ n . ½ n ( n ≥ 2 ) = ¼ n2, c1= ¼
2

Hence ½ n2 - ½ n ≤ ½ n2 ≤ ½ n2 - ½ n
c1.g(n) ≤ f(n) ≤ c2.g(n) n ≥ 2, c1= ¼, c2 = ½
Hence f(n)  (g(n))  ½.n2 – ½.n = (n2)

Example 2: Prove that a.n2 + b.n + c = (n2) where a, b, c are constants and a > 0
Proof
If we take c1 = ¼.a, c2 = 7/4. a and

Then it can be easily verified that


0 ≤ c1.g(n) ≤ f(n) ≤ c2.g(n),n ≥ n0, c1= ¼.a, c2 = 7/4.a
Hence f(n)  (g(n))  a.n2 + b.n + c = (n2)
Hence any polynomial of degree 2 is of order (n2)

Example 3: Prove that 2.n2 + 3.n + 6 (n3)


Proof: Let f(n) = 2.n2 + 3.n + 6, and g(n) = n3
we have to show that f(n) (g(n))
On contrary assume that f(n)  (g(n)) i.e.
there exist some positive constants c1, c2 and n0 such that: c1.g(n) ≤ f(n) ≤ c2.g(n)
c1.g(n) ≤ f(n) ≤ c2.g(n) c1.n3 ≤ 2.n2 + 3.n + 6 ≤ c2. n3
c1.n ≤ 2 + 3/n + 6/n2 ≤ c2. n 
c1.n ≤ 2 ≤ c2. n, for large n 
n ≤ 2/c1 ≤ c2/c1.n which is not possible
Hence f(n) (g(n))  2.n2 + 3.n + 6 (n3)

Little-Oh Notation
o-notation is used to denote a upper bound that is not asymptotically tight.
r a given function g n   0, denoted by og n  the set of functions,
 f n  : for any positive constants c, there exists a constant no
og n   
such that 0  f n   cg n  for all n n o 
f(n) becomes insignificant relative to g(n) as n approaches infinity
   
e.g., 2n  o n 2 but 2n2  o n2 ..
g(n) is an upper bound for f(n), not asymptotically tight
f n 
lim 0
n  g n 

Dr. Nazir Ahmad Zafar | Virtual University of Pakistan


74 CS-702 Advanced Algorithms Analysis and Design

Example 1: Prove that 2n2  o(n3)


Proof:
Assume that f(n) = 2n2 , and g(n) = n3
f(n)  o(g(n)) ?

Now we have to find the existence n0 for any c


f(n) < c.g(n) this is true
2n2 < c.n3 2 < c.n
This is true for any c, because for any arbitrary c we can choose n0 such that the above
inequality holds. Hence f(n)  o(g(n))

Example 2: Prove that n2  o(n2)


Proof:
Assume that f(n) = n2 , and g(n) = n2
Now we have to show that f(n)  o(g(n))
Since
f(n) < c.g(n) n2 < c.n2 1 ≤ c,

In our definition of small o, it was required to prove for any c but here there is a
constraint over c . Hence, n2  o(n2), where c = 1 and n0= 1

Example 3: Prove that 1000.n2 + 1000.n  o(n2)


Proof:
Assume that f(n) = 1000.n2 + 1000.n, and g(n) = n2
we have to show that f(n)  o(g(n)) i.e.
We assume that for any c there exist n0 such that
0 ≤ f(n) < c.g(n) n  n0
1000.n2 + 1000.n < c.n2
If we take c = 2001, then,1000.n2 + 1000.n < 2001.n2
1000.n < 1001.n2 which is not true
Hence f(n)  o(g(n)) for c = 2001

Little-Omega Notation
Little- notation is used to denote a lower bound that is not asymptotically tight.
For a given function g n , denote by  g n  the set of all functions.
 g n    f n  : for any positive constants c, there exists a constant no such that
0  cg n   f n  for all n n o 
f n 
f(n) becomes arbitrarily large relative to g(n) as n approaches infinity lim 
n  g n 

  n 2 ..
2 2
  n  but
n n
e.g.,
2 2
Example 1: Prove that 5.n2  (n)
Proof:
Assume that f(n) = 5.n2 , and g(n) = n
f(n)  (g(n)) ?
We have to prove that for any c there exists n0 s.t., c.g(n) < f(n) n  n0
c.n < 5.n2 c < 5.n

Dr. Nazir Ahmad Zafar | Virtual University of Pakistan


75 CS-702 Advanced Algorithms Analysis and Design

This is true for any c, because for any arbitrary c e.g. c = 1000000, we can choose n0
= 1000000/5 = 200000 and the above inequality does hold.
And hence f(n)  (g(n)),

Example 2: Prove that 5.n + 10  (n)


Proof:
Assume that f(n) = 5.n + 10, and g(n) = n
f(n)  (g(n)) ?
We have to find the existence n0 for any c, s.t.
c.g(n) < f(n) n  n0
c.n < 5.n + 10, if we take c = 16 then
16.n < 5.n + 10  11.n < 10 is not true for any positive integer.
Hence f(n)  (g(n))

Example 3: Prove that 100.n  (n2)


Proof:
Let f(n) = 100.n, and g(n) = n2
Assume that f(n)  (g(n))
Now if f(n)  (g(n)) then there n0 for any c s.t.
c.g(n) < f(n) n  n0 this is true
c.n2 < 100.n c.n < 100
If we take c = 100, n < 1, not possible
Hence f(n) (g(n)) i.e. 100.n  (n2)

Usefulness of Notations
• It is not always possible to determine behaviour of an algorithm using Θ-notation.
• For example, given a problem with n inputs, we may have an algorithm to solve it in a.n2
time when n is even and c.n time when n is odd. OR
• We may prove that an algorithm never uses more than e.n2 time and never less than f.n
time.
• In either case we can neither claim (n) nor (n2) to be the order of the time usage of
the algorithm.
• Big O and  notation will allow us to give at least partial information

Dr. Nazir Ahmad Zafar | Virtual University of Pakistan


76 CS-702 Advanced Algorithms Analysis and Design

Lecture 11
Relations over Asymptotic Notations

Overview of Previous Lecture

Although Estimation but Useful


• It is not always possible to determine behaviour of an algorithm using Θ-notation.
• For example, given a problem with n inputs, we may have an algorithm to solve it in a.n2
time when n is even and c.n time when n is odd. OR
• We may prove that an algorithm never uses more than e.n2 time and never less than f.n
time.
• In either case we can neither claim (n) nor (n2) to be the order of the time usage of
the algorithm.
• Big O and  notation will allow us to give at least partial information

Reflexive Relation
Definition:
• Let X be a non-empty set and R is a relation over X then R is said to be reflexive if
(a, a)  R,  a  X,
Example 1:
• Let G be a graph. Let us define a relation R over G as if node x is connected to y then (x,
y)  G. Reflexivity is satisfied over G if for every node there is a self loop.
Example 2:
• Let P be a set of all persons, and S be a relation over P such that if (x, y)  S then x has
same birthday as y.
• Of course this relation is reflexive because
(x, x)  S,  a  P,

Reflexivity Relations over , , O


Example 1
Since, 0  f(n)  cf(n)  n  n0 = 1, if c = 1
Hence f(n) = O(f(n))

Example 2
Since, 0  cf(n)  f(n)  n  n0 = 1, if c = 1
Hence f(n) = (f(n))

Example 3
Since, 0  c1f(n)  f(n)  c2f(n)  n  n0 = 1,if c1= c2 = 1
Hence f(n) = (f(n))
Note: All the relations, Q, W, O, are reflexive

Dr. Nazir Ahmad Zafar | Virtual University of Pakistan


77 CS-702 Advanced Algorithms Analysis and Design

Little o and  are not Reflexivity Relations


Example
As we can not prove that f(n) < f(n), for any n, and for all c > 0
Therefore
1. f(n)  o(f(n)) and
2. f(n)  (f(n))
Note : Hence small o and small omega are not reflexive relations

Symmetry
Definition:
• Let X be a non-empty set and R is a relation over X then R is said to be symmetric if
 a, b  X, (a, b)  R  (b, a)  R
Example 1: • Let P be a set of all persons, and B
• Let P be a set of persons, and S be be a relation over P such that if (x, y)
a relation over P such that if (x, y)   B then x is brother of y.
S then x has the same sign as y. • This relation is not symmetric
• This relation is symmetric because because
(x, y)  S  (y, x)  S (Anwer, Sadia)  B  (Saida,
Brother)  B
Example 2:
Symmetry over 
Property : prove that
f(n) = (g(n))  g(n) = (f(n))
Proof
• Since f(n) = (g(n)) i.e. f(n)  (g(n)) 
 constants c1, c2 > 0 and n0  N such that
0  c1g(n)  f(n)  c2g(n)  n  n0 (1)
(1)  0  c1g(n)  f(n)  c2g(n)  0  f(n)  c2g(n)
 0  (1/c2)f(n)  g(n) (2)
(1)  0  c1g(n)  f(n)  c2g(n)  0  c1g(n)  f(n)
 0  g(n)  (1/c1)f(n) (3)
From (2),(3): 0  (1/c2)f(n)  g(n)  0  g(n)  (1/c1)f(n)
 0  (1/c2)f(n)  g(n)  (1/c1)f(n)
Suppose that 1/c2 = c3, and 1/c1 = c4,
Now the above equation implies that
0  c3f(n)  g(n)  c4f(n),  n  n0
 g(n) = (f(n)),  n  n0
Hence it proves that, f(n) = (g(n))  g(n) = (f(n))
Exercise: prove that big O, big omega , little , and little o, do not satisfy the symmetry
property.

Dr. Nazir Ahmad Zafar | Virtual University of Pakistan


78 CS-702 Advanced Algorithms Analysis and Design

Transitivity
Definition:
• Let X be a non-empty set and R is a relation over X then R is said to be transitive if
 a, b, c  X, (a, b)  R  (b, c)  R  (a, c)  R

Example 1: Example 2:
• Let P be a set of all persons, and B • Let P be a set of all persons, and F
be a relation over P such that if (x, y) be a relation over P such that if (x, y)
 B then x is brother of y.  F then x is father of y.
• This relation is transitive this is • Of course this relation is not a
because transitive because if (x, y)  F  (y,
(x, y)  B  (y, z)  B  (x, z)  B z)  F  (x, z)  F

Transitivity Relation over Q, W, O, o and 


Prove the following
1. f(n) = (g(n)) & g(n) = (h(n))  f(n) = (h(n))
2. f(n) = O(g(n)) & g(n) = O(h(n))  f(n) = O(h(n))
3. f(n) = (g(n)) & g(n) = (h(n))  f(n) = (h(n))
4. f(n) = o (g(n)) & g(n) = o (h(n))  f(n) = o (h(n))
5. f(n) = (g(n)) & g(n) = (h(n))  f(n) = (h(n))

Note
It is to be noted that all these algorithms complexity measuring notations are in fact
relations which satisfy the transitive property.

Transitivity Relation over Q


Property 1
f(n) = (g(n)) & g(n) = (h(n))  f(n) = (h(n))
Proof
• Since f(n) = (g(n)) i.e. f(n)  (g(n)) 
 constants c1, c2 > 0 and n01  N such that
0  c1g(n)  f(n)  c2g(n)  n  n01 (1)
2. Now since g(n) = (h(n)) i.e. g(n)  (h(n)) 
 constants c3, c4 > 0 and n02  N such that
0  c3h(n)  g(n)  c4h(n)  n  n02 (2)
3. Now let us suppose that n0 = max (n01, n02)
4. Now we have to show that f(n) = (h(n)) i.e. we have to prove that
 constants c5, c6 > 0 and n0  N such that
0  c5h(n)  f(n)  c6h(n) ?
(2)  0  c3h(n)  g(n)  c4h(n)
 0  c3h(n)  g(n) (3)

Dr. Nazir Ahmad Zafar | Virtual University of Pakistan


79 CS-702 Advanced Algorithms Analysis and Design

(1)  0  c1g(n)  f(n)  c2g(n)


 0  c1g(n)  f(n)
 0  g(n)  (1/c1)f(n) (4)
From (3) and (4), 0  c3h(n)  g(n)  (1/c1)f(n)
 0  c1c3h(n)  f(n) (5)
(1)  0  c1g(n)  f(n)  c2g(n)
 0  f(n)  c2g(n)  0  (1/c2)f(n)  g(n) (6)
(2)  0  c3h(n)  g(n)  c4h(n)
 0  g(n)  c4h(n) (7)
From (6) and (7), 0  (1/c2)f(n)  g(n)  (c4)h(n)
 0  (1/c2)f(n)  (c4)h(n)
 0  f(n)  c2c4h(n) (8)
From (5), (8), 0  c1c3h(n)  f(n)  0  f(n)  c2c4h(n)
0  c1c3h(n)  f(n)  c2c4h(n)
0  c5h(n)  f(n)  c6h(n)
And hence f(n) = (h(n))  n  n0

Transitivity Relation over Big O

Property 2
f(n) = O(g(n)) & g(n) = O(h(n))  f(n) = O(h(n))
Proof
• Since f(n) = O(g(n)) i.e. f(n)  O(g(n)) 
 constants c1 > 0 and n01  N such that
0  f(n)  c1g(n)  n  n01 (1)
2. Now since g(n) = O(h(n)) i.e. g(n)  O(h(n)) 
 constants c2 > 0 and n02  N such that
0  g(n)  c2h(n)  n  n02 (2)
3. Now let us suppose that n0 = max (n01, n02)
Now we have to two equations
0  f(n)  c1g(n)  n  n01 (1)
0  g(n)  c2h(n)  n  n02 (2)
(2)  0  c1g(n)  c1c2h(n)  n  n02 (3)

From (1) and (3)


0  f(n)  c1g(n)  c1c2h(n)
Now suppose that c3= c1c2
0  f(n)  c1c2h(n)
And hence f(n) = O(h(n))  n  n0

Dr. Nazir Ahmad Zafar | Virtual University of Pakistan


80 CS-702 Advanced Algorithms Analysis and Design

Transitivity Relation over Big 


Property 3
f(n) = (g(n)) & g(n) = (h(n))  f(n) = (h(n))
Proof
• Since f(n) = (g(n)) 
 constants c1 > 0 and n01  N such that
0  c1g(n)  f(n)  n  n01 (1)
2. Now since g(n) = (h(n)) 
 constants c2 > 0 and n02  N such that
0  c2h(n)  g(n)  n  n02 (2)
3. Suppose that n0 = max (n01, n02)
4. We have to show that f(n) = (h(n)) i.e. we have to prove that
 constants c3 > 0 and n0  N such that
0  c3h(n)  f(n)  n  n0 ?
(2)  0  c2h(n)  g(n)
(1)  0  c1g(n)  f(n)
 0  g(n)  (1/c1)f(n) (3)
From (2) and (3), 0  c2h(n)  g(n)  (1/c1)f(n)
 0  c1c2h(n)  f(n) hence f(n) = (h(n)),  n  n0

Transitivity Relation over little o


Property 4
f(n) = o(g(n)) & g(n) = o(h(n))  f(n) = o(h(n))
Proof
• Since f(n) = o(g(n)) i.e. f(n)  o(g(n)) 
 constants c1 > 0 and n01  N such that
0  f(n) < c1g(n)  n  n01 (1)
2. Now since g(n) = o(h(n)) i.e. g(n)  o(h(n)) 
 constants c2 > 0 and n02  N such that
0  g(n) < c2h(n)  n  n02 (2)
3. Now let us suppose that n0 = max (n01, n02)
Now we have to two equations
0  f(n) < c1g(n)  n  n01 (1)
0  g(n) < c2h(n)  n  n01 (2)
(2)  0  c1g(n) < c1c2h(n)  n  n02 (3)
From (1) and (3)
0  f(n)  c1g(n) < c1c2h(n)
Now suppose that c3= c1c2
0  f(n) < c1c2h(n)
And hence f(n) = o(h(n))  n  n01

Dr. Nazir Ahmad Zafar | Virtual University of Pakistan


81 CS-702 Advanced Algorithms Analysis and Design

Transitivity Relation over little 


Property 5
f(n) = (g(n)) & g(n) = (h(n))  f(n) = (h(n))
Proof
• Since f(n) = (g(n)) 
 constants c1 > 0 and n01  N such that
0  c1g(n) < f(n)  n  n01 (1)
2. Now since g(n) = (h(n)) 
 constants c2 > 0 and n02  N such that
0  c2h(n) < g(n)  n  n02 (2)
3. Suppose that n0 = max (n01, n02)
4. We have to show that f(n) = (h(n)) i.e. we have to prove that
 constants c3 > 0 and n0  N such that
0  c3h(n)  f(n)  n  n0 ?
(2)  0  c2h(n) < g(n)
(1)  0  c1g(n) < f(n)
 0  g(n) < (1/c1)f(n) (3)
From (2) and (3), 0  c2h(n)  g(n) < (1/c1)f(n)
 0  c1c2h(n) < f(n) hence f(n) = (h(n)),  n  n0

Transpose Symmetry
Property 1
Prove that f(n) = O(g(n))  g(n) = (f(n))
Proof
Since f(n) = O(g(n)) 
 constants c > 0 and n0  N such that
0  f(n)  cg(n)  n  n0
Dividing both side by c
0  (1/c)f(n)  g(n)  n  n0
Put 1/c = c‟
0  c‟f(n)  g(n)  n  n0
Hence, g(n) = (f(n))

Property 2
Prove that f(n) = o(g(n))  g(n) = f(n))
Proof
Since f(n) = o(g(n)) 
 constants c > 0 and n0  N such that
0  f(n) < cg(n)  n  n0
Dividing both side by c
0  (1/c)f(n) < g(n)  n  n0
Put 1/c = c‟

Dr. Nazir Ahmad Zafar | Virtual University of Pakistan


82 CS-702 Advanced Algorithms Analysis and Design

0  c‟f(n) < g(n)  n  n0


Hence, g(n) = (f(n))

Relation between Q, W, O
Trichotmy property over real numbers
• For any two real numbers a and b, exactly one of the following must hold: a < b,a = b, or
a > b.
The asymptotic comparision of two functions f and g and the comparision of two real numbers a
and b.
Trichotmy property over Q, W and O
1. f (n) = O(g(n))  a≤ b
2. f (n) =  (g(n))  a b
3. f (n) =  (g(n))  a=b
4. f (n) = o (g(n))  a<b
5. f (n) = (g(n))  a>b

Some Other Standard Notations


Monotonicity
• monotonically increasing if m  n  f(m)  f(n).
• monotonically decreasing if m  n  f(m)  f(n).
• strictly increasing if m < n  f(m) < f(n).
• strictly decreasing if m < n  f(m) > f(n).
Polynomials
• Given a positive integer d, a polynomial in n of degree d is a function of the form given
below, ai are coefficient of polynomial.
d
pn    ai n i
i 0

Standard Logarithms Notations


Exponent a  b logb a
• x = logba is the exponent for a = bx.
log c (ab)  log c a  log c b
Natural log
• ln a = logea log b a n  nlog b a
Binary log log c a
log b a 
• lg a = log2a log c b
Square of log
log b (1/a)  log b a
• lg2a = (lg a)2
1
Log of Log log b a 
• lg lg a = lg (lg a) log a b
a logb c  c logb a

Dr. Nazir Ahmad Zafar | Virtual University of Pakistan


83 CS-702 Advanced Algorithms Analysis and Design

Lecture 12
Design of Algorithms using Brute Force Approach

Today Covered
Brute Force Approach,
• Checking primality
• Sorting sequence of numbers
• Knapsack problem
• Closest pair in 2-D, 3-D and n-D
• Finding maximal points in n-D

Primality Testing
(given number is n binary digits)

First Algorithm for Testing Primality


Brute Force Approach
Prime (n)
for i  2 to n-1
if n  0 mod i then
“number is composite”
else
“number is prime”
• The computational cost is (n)
• The computational cost in terms of binary operation is (2n)

Refined Algorithm for Testing Primality


Prime (n)
for i  2 to n/2
if n  0 mod i then
“number is composite”
else
“number is prime”
• The computational cost is (n/2)
• The computational cost in terms of binary operation is (2n-1), not much improvement

Algorithm for Testing Primality


• We are not interested, how many operations are required to test if the number n is prime
• In fact, we are interested, how many operations are required to test if a number with n
digits is prime.
• RSA-128 encryption uses prime numbers which are 128 bits long. Where 2128 is:
340282366920938463463374607431768211456
• Therefore, to prime test a number with n binary digits by brute force, we need to check
2n numbers.

Dr. Nazir Ahmad Zafar | Virtual University of Pakistan


84 CS-702 Advanced Algorithms Analysis and Design

• Thus brute-force prime testing requires exponential time with the n number of digits.
• Which is not accepted in this case

Lemma
Statement
• If n  N, n > 1 is not prime then n is divisible by some prime number p ≤ square root of
n.
Proof
• Since n is not prime hence it can be factored as
n = x.y where 1 <x ≤ y <n
• x or y is a prime, if not it can be further factored out.
• Also suppose without loss of generality that x ≤ y
• Now our claim is that x ≤ sq(n)
• This is because otherwise x.y > n, a contradiction
• We only require to check till sqr(n) for primality test.

Refined Algorithm for Testing Primality

Prime (n)
for i  2 to sqr(n)
if n  0 mod i then
“number is composite”
else
“number is prime”

• The computational cost is (sqr(n)), much faster


• The computational cost in terms of binary operation is (2squareroot(n)), still exponential
• Computation cost can be decreased using number theoretic concepts, which will be
discussed later on.

Sorting Sequence of Numbers

An Example of Algorithm
• Input : A sequence of n numbers (distinct)  a1 , a2 ,..., an 
• Output : A permutation,  a1, a2 ,..., an  of the input sequence such that a1  a2  ...  an

Dr. Nazir Ahmad Zafar | Virtual University of Pakistan


85 CS-702 Advanced Algorithms Analysis and Design

Sorting Algorithm: Brute Force Approach


Sort the array [2, 4, 1, 3] in increasing order
s1 = [4,3,2,1], s2 = [4,3,1,2], s3 = [4,1,2,3]
s4 = [4,2,3,1], s5 = [4,1,3,2], s6 = [4,2,1,3]
s7 = [3,4,2,1], s8 = [3,4,1,2], s9 = [3,1,2,4]

s10 = [3,2,4,1], s11 = [3,1,4,2], s12 = [3,2,1,4]


s13 = [2,3,4,1], s14 = [2,3,1,4], s15 = [2,1,4,3]
s16 = [2,4,3,1], s17 = [2,1,3,4], s18 = [2,4,1,3]
s19 = [1,3,2,4], s20 = [1,3,1,4], s21 = [1,4,2,3]
s22 = [1,2,3,4], s23 = [1,4,3,2], s24 = [1,2,4,3]

There are 4! = 24 number of permutations.

For n number of elements there will be n! number of permutations. Hence cost of order n! for
sorting.

Generating Permutations

Permute (i) \\initial call Permute(1)


if i == N
output A[N]
else
for j = i to N do
swap(A[i], A[j])
permute(i+1)
swap(A[i], A[j])

• There are 4! = 24 number of permutations.


• For n number of elements there will be n! number of permutations. Hence cost of order
n! for sorting.

Theorem
• Prove, by mathematical induction, that computational cost of generating permutations is
n!.
Proof
• If n = 1, then the statement is true, because 1! =1
• If there are k elements in set then no. of permutation = k!
• If we add one more element in any of the permutations, there will be k+1 number of
ways to add it, resulting k+1 no. of permutations.
• Now total no. of permutations = k!(k+1) = (k+1)!
• Hence true for all n.

Dr. Nazir Ahmad Zafar | Virtual University of Pakistan


86 CS-702 Advanced Algorithms Analysis and Design

0-1 Knapsack Problem Statement


The knapsack problem arises whenever there is resource allocation with no financial constraints
Problem Statement
• You are in Japan on an official visit and want to make shopping from a store (Best
Denki)
• You have a list of required items
• You have also a bag (knapsack), of fixed capacity, and only you can fill this bag with the
selected items
• Every item has a value (cost) and weight,
• And your objective is to seek most valuable set of items which you can buy not
exceeding bag limit.

0-1 Knapsack Example


Input
• Given n items each
– weight wi
– value vi
• Knapsack of capacity W
Output: Find most valuable items that fit into the knapsack

Example:
item weight value knapsack capacity W = 16
1 2 20
2 5 30
3 10 50
4 5 10

Subset Total weight Total value


1.  0 0 # W V
2. {1} 2 20 1 2 20
3. {2} 5 30 2 5 30
4. {3} 10 50 3 10 50
5. {4} 5 10 4 5 10
6. {1,2} 7 50
7. {1,3} 12 70
8. {1,4} 7 30
9. {2,3} 15 80
10. {2,4} 10 40
11. {3,4} 15 60
12. {1,2,3} 17 not feasible
13. {1,2,4} 12 60
14. {1,3,4} 17 not feasible
15. {2,3,4} 20 not feasible
16. {1,2,3,4} 22 not feasible

Dr. Nazir Ahmad Zafar | Virtual University of Pakistan


87 CS-702 Advanced Algorithms Analysis and Design

0-1 Knapsack Algorithm

1 Knapsack-BF (n, V, W, C) Compute all subsets, s, of S = {1, 2, 3, 4}


2 forall s  S
3 weight = Compute sum of weights of these items
4 if weight > C, not feasible
5 new solution = Compute sum of values of these items
6 solution = solution  {new solution}
7 Return maximum of solution

0-1 Knapsack Algorithm Analysis

Approach
• In brute force algorithm, we go through all combinations and find the one with maximum
value and with total weight less or equal to W = 16

Complexity
• Cost of computing subsets O(2n) for n elements
• Cost of computing weight = O(2n)
• Cost of computing values = O(2n)
• Total cost in worst case: O(2n)

The Closest Pair Problem (Finding Closest Pair )

Problem: The closest pair problem is defined as follows:


• Given a set of n points, determine the two points that are closest to each other in terms
of distance. Furthermore, if there are more than one pair of points with the closest
distance, all such pairs should be identified.
Input:
is a set of n points
Output
• is a pair of points closest to each other,
• there can be more then one such pairs

Closest Pair Problem in 2-D


• A point in 2-D is an ordered pair of values (x, y).
• The Euclidean distance between two points
Pi = (xi, yi) and Pj = (xj, yj) is
d(pi, pj) = sqr((xi − xj)2 + (yi − yj)2)
• The closest-pair problem is finding the two closest points in a set of n points.
• The brute force algorithm checks every pair of points.
• Assumption: We can avoid computing square roots by using squared distance.
– This assumption will not loose correctness of the problem.

Dr. Nazir Ahmad Zafar | Virtual University of Pakistan


88 CS-702 Advanced Algorithms Analysis and Design

Brute Force Approach: Finding Closest Pair in 2-D


ClosestPairBF(P)
1. mind  ∞
2. for i  1 to n
3. do
4. for j  1 to n
5. if i  j Time Complexity
6. do n n

7. d  ((xi − xj) + (yi − yj) )


2 2  
i 1 j1
c
8. if d < minn then
mind  d
n


9.
 cn
10. mini  i i 1
11. minj  j
12. return mind, p(mini, minj)  cn 2
 ( n 2 )
Improved Version: Finding Closest Pair in 2-D

ClosestPairBF(P) Complexity
1. mind  ∞ n 1 n

2. for i  1 to n − 1   c
3. do i 1 j i 1

4. for j  i + 1 to n n 1

5. do   c(n  i )
i 1
6. d  ((xi − xj)2 + (yi − yj)2) n 1 n 1
7. if d < minn then  c ( n   i )
8. mind  d i 1 i 1
9. mini  i (n  1)n
10. minj  j  cn (n  1)  c
11. return mind, p(mini, minj) 2
 ( n 2 )

Finding Maximal in n-dimension


Maximal Points

• Dominated Point in 2-D


A point p is said to be dominated by q if
p.x ≤ q.x and p.y ≤ q.y
• Dominated Point in n-D
A point p is said to be dominated by q if
p.xi ≤ q.xi  i = 1,. . ., n
• Maximal Point
A point is said to be maximal if it is not dominated by any other point.

Dr. Nazir Ahmad Zafar | Virtual University of Pakistan


89 CS-702 Advanced Algorithms Analysis and Design

Example: Maximal Points in 2-Dimension

Example: Buying a Car


Suppose we want to buy a car which is
– Fastest and
– Cheapest
• Fast cars are expensive. We want cheapest.
• We can‟t decide which one is more important
– Speed or
– Price.
• Of course fast and cheap dominates slow and expensive car.
• So, given a collection of cars, we want the car which is not dominated by any other.
Formal Problem: Problem can be modeled as:
• For each car C, we define C (x, y) where
x = speed of car and
y = price of car
• This problem can not be solved using maximal point algorithm.
Redefine Problem:
• For each car C‟, we define C‟ (x‟, y‟) where
x‟ = speed of car and
y‟ = negation of car price
• This problem is reduced to designing maximal point algorithm

Problem Statement
Problem Statement:
Given a set of m points, P = {p1, p2, . . . , pm}, in n- dimension. Our objective is to
compute a set of maximal points i.e. set of points which are not dominated by any one in the
given list.

Dr. Nazir Ahmad Zafar | Virtual University of Pakistan


90 CS-702 Advanced Algorithms Analysis and Design

Mathematical Description:
Maximal Points =
{ p  P |  i  {1,. . . , n} & p.xi ≥ q.xj, , q  {p1, p2, . . . , pm}

Brute Force Algorithm in n-dimension MAXIMAL-PINTS (int m, int n, Point P[1. . .


MAXIMAL-POINTS (int m, Point P[1. . . m]) m])
0. A = ; 1. sort P in increasing order by first
1. for i 1 to m \\ m used for number component
of points 2. stack s;
2. do maximal  true 3. for i 1 to m \\ m used for number
3. for j  1 to m of points
4. do 4. do
5. if (i  j) & 5. while (s.noEmpty() &
6. for k  1 to n \\ n stands for 6. for j  2 to n \\ n stands for
dimension dimension
7. do 7. do
8. P[i].x[k]  P[j].x[k] 8. s.top().x[j]  P[i].x[j])
9. then maximal  false; break 9. do s.pop();
10. if maximal 10. s.push(P[i]);
11. output the contents of stack s;
11. then A = A  P[i]

Plane Sweep Algorithm in n-dimension

Conclusion
• Brute Force approach is discussed, design of some algorithms is also discussed.
• Algorithms computing maximal points is generalization of sorting algorithms
• Maximal points are useful in Computer Sciences and Mathematics in which at least one
component of every point is dominated over all points.
• In fact we put elements in a certain order
• For Brute Force, formally, the output of any sorting algorithm must satisfy the following
two conditions:
– Output is in decreasing/increasing order and
– Output is a permutation, or reordering, of input.

Dr. Nazir Ahmad Zafar | Virtual University of Pakistan


91 CS-702 Advanced Algorithms Analysis and Design

Lecture No. 13
Designing Algorithms using
Brute Force & Divide & Conquer Approaches
Today Covered
Brute Force
• Finding closest pair in 2-D
• Improved version finding closest pair in 2-D
• Generalization in 3-D and then n-D
• Finding maximal points in n-D
Divide and Conquer
• A General Divide and Conquer approach
• Merge Sort algorithm
• Finding Maxima in 1-D, and 2-D
• Finding Closest Pair in 2-D

Finding Closest Pair in 2-D


Problem
The closest pair problem is defined as follows:
• Given a set of n points, determine the two points that are closest to each other in terms
of distance. Furthermore, if there are more than one pair of points with the closest
distance, all such pairs should be identified.
Input :
is a set of n points
Output
• is a pair of points closest to each other,
• there can be more then one such pairs

Definition: Closest Pair


Distance
• In mathematics, particular in geometry, distance on a given set M is a function d: M ×
M → R, where R denotes the set of real numbers, that satisfies the following conditions:
1. d(x, y) ≥ 0,
2. d(x, y) = 0 if and only if x = y.
3. Symmetric i.e. d(x, y) = d(y, x).
4. Triangle inequality: d(x, z) ≤ d(x, y) + d(y, z)
Closest Pair Problem in 2-D
• A point in 2-D is an ordered pair of values (x, y).
• The Euclidean distance between two points
Pi = (xi, yi) and Pj = (xj, yj) is
d(pi, pj) = sqr((xi − xj)2 + (yi − yj)2)
• The closest-pair problem is finding the two closest points in a set of n points.
• The brute force algorithm checks every pair of points.
• Assumption: We can avoid computing square roots by using squared distance.
– This assumption will not loose correctness of the problem.

Dr. Nazir Ahmad Zafar | Virtual University of Pakistan


92 CS-702 Advanced Algorithms Analysis and Design

Brute Force Approach: Finding Closest Pair in 2-D


mind  ∞ Time Complexity
for i  1 to n n n
do 
i 1 j1

c
for j  1 to n
n
if i  j
do
 cn
i 1

d  ((xi − xj) + (yi − yj) )
2 2
 cn 2
if d < mind then
mind  d  ( n 2 )
mini  i
minj  j
return mind, p(mini, minj)

Improved Version:
Finding Closest Pair in 2-D
ClosestPairBF(P)
mind  ∞ Time Complexity
for i  1 to n − 1 n 1 n
c
do i 1 ji 1

for j  i + 1 to n n 1
  c(n  i )
do i 1

d  ((xi − xj)2 + (yi − yj)2) n 1 n 1


 c( n   i )
if d < mind then i 1 i 1

mind  d (n  1)n
 cn(n  1)  c
mini  i 2
minj  j 2
n n
 c(n 2  n   )
return mind, p(mini, minj) 2 2
2
n n
 c (  )  ( n 2 )
2 2
Finding Closest Pair in n-D
ClosestPairBF(P) return mind, p(mini), p(minj)
mind  ∞
for i  1 to n − 1 Time Complexity
n 1
do n
   cn
for j  i + 1 to n i 1 j i 1
n 1
do
  cn(n  i )
d  ((xi1 − xj1)2 + (xi2 − xj2)2 + . . .+(xin − xjn)2) i 1
n 1 n 1
if d < minn then
 c( n 2   in)
mind  d i 1 i 1

mini  i  ( n ) 3

minj  j

Dr. Nazir Ahmad Zafar | Virtual University of Pakistan


93 CS-702 Advanced Algorithms Analysis and Design

Maximal Points
Maximal Points in 2-D
A point p is said to be dominated by q if
p.x ≤ q.x and p.y ≤ q.y
A point p is said to be maximal if
p.x > q.x OR p.y > q.y
Maximal Points in n-D
A point p is said to be dominated by q if
p.xi ≤ q.xi  i = 1,. . ., n
A point p is said to be maximal if
 i = 1,. . ., n, p.xi > q.xi
A point is said to be maximal if it is not
dominated by any other point.

Example: Maximal Points in 2-Dimension

Problem Statement:

Given a set of m points, P = {p1, p2, . . . , pm}, in n- dimension. Our objective is to compute a set
of maximal points i.e. set of points which are not dominated by any one in the given list.

Mathematical Description:

Maximal Points = { p  P |  q  {p1, . . . , pm}, q  p,  i  {1,. . . , n} & p.xi ≥ q.xj}

Brute Force Algorithm in n-dimension


MAXIMAL-POINTS (int n, Point P[1. . . m])
0 A = ;
1 for i 1 to m \\ m used for number of points
2 do maximal  true
3 for j  1 to m
4 do
5 if (i  j) &
6 for k  1 to n \\ n stands for dimension
7 do
8 P[i].x[k]  P[j].x[k]
9 then maximal  false; break
10 if maximal
11 then A = A  P[i]

Dr. Nazir Ahmad Zafar | Virtual University of Pakistan


94 CS-702 Advanced Algorithms Analysis and Design

Conclusion:
• Designing Algorithms using Brute Force approach is discussed
• For Brute Force, formally, the output of any sorting algorithm must satisfy the following
two conditions:
– Output is in decreasing/increasing order and
– Output is a permutation, or reordering, of input.
• Algorithms computing maximal points can be considered as generalization of sorting
algorithms
• Maximal points are useful in Computer Sciences and Mathematics in which at least one
component of every point is dominated over all points.
• In fact we put elements in a certain order

Dr. Nazir Ahmad Zafar | Virtual University of Pakistan


95 CS-702 Advanced Algorithms Analysis and Design

Lecture No. 14
Designing Algorithms using
Divide & Conquer Approach
Today Covered
Divide and Conquer?
• A General Divide and Conquer Approach
• Merge Sort algorithm
• Finding Maxima in 1-D, and 2-D
• Finding Closest Pair in 2-D

A General Divide and Conquer Algorithm


Step 1:
• If the problem size is small, solve this problem directly
• Otherwise, split the original problem into 2 or more sub-problems with almost equal
sizes.
Step 2:
• Recursively solve these sub-problems by applying this algorithm.
Step 3:
• Merge the solutions of the sub- problems into a solution of the original problem.

Time Complexity of General Algorithms


• Time complexity:
2T  n 2   S  n   M  n  nc
T  n  
 b nc
– where S(n) is time for splitting
– M(n) is time for merging
– b and c are constants
Example
• Binary search
• Quick sort
• Merge sort

Merge-sort
Merge-sort is based on divide-and-conquer approach and can be described by the following
three steps:
Divide Step:
• If given array A has zero or one element, return S.
• Otherwise, divide A into two arrays, A1 and A2,
• Each containing about half of the elements of A.
Recursion Step:
• Recursively sort array A1, A2
Conquer Step:

Dr. Nazir Ahmad Zafar | Virtual University of Pakistan


96 CS-702 Advanced Algorithms Analysis and Design

• Combine the elements back in A by merging the sorted arrays A1 and A2 into a sorted
sequence.

Visualization of Merge-sort as Binary Tree


• We can visualize Merge-sort by means of binary tree where each node of the tree
represents a recursive call
• Each external node represents individual elements of given array A.
• Such a tree is called Merge-sort tree.
• The heart of the Merge-sort algorithm is conquer step, which merge two sorted
sequences into a single sorted sequence
• The merge algorithm is explained in the next

Sorting Example: Divide and Conquer Rule


• Sort the array [14, 10, 4, 8, 2, 12, 6, 0] in the ascending order
Solution:
• Divide

• Recursion and Conquer

Dr. Nazir Ahmad Zafar | Virtual University of Pakistan


97 CS-702 Advanced Algorithms Analysis and Design

Merge-sort Algorithm

Merge-sort(A, f, l)
1. if f < l
2. then m = (f + l)/2
3. Merge-sort(A, f, m)
4. Merge-sort(A, m + 1, l)
5. Merge(A, f, m, l)

Merge(A, f, m, l)
1. T[f..l] \\declare temporary array of same size
2. i  f; k  f; j  m + 1 \\initialize integers i, j, and k
3. while (i  m) and (j  l)
4. do if (A[i]  A[j]) \\comparison of elements
5. then T[k++]  A[i++]
6. else T[k++]  A[j++]
7. while (i  m)
8. do T[k++]  A[i++] \\copy from A to T
9. while (j  l)
10. do T[k++]  A[j++] \\copy from A to T
11. for i  p to r
12. do A[i]  T[i] \\copy from T to A

Analysis of Merge-sort Algorithm


• Let T(n) be the time taken by this algorithm to sort an array of n elements dividing A into
sub-arrays A1 and A2.
• It is easy to see that the Merge (A1, A2, A) takes the linear time. Consequently,

T(n) = T(n/2) + T(n/2) + θ(n)


T(n) = 2T (n/2) + θ(n)

• The above recurrence relation is non-homogenous and can be solved by any of the
methods
– Defining characteristics polynomial
– Substitution
– recursion tree or
– master method

Dr. Nazir Ahmad Zafar | Virtual University of Pakistan


98 CS-702 Advanced Algorithms Analysis and Design

Analysis: Substitution Method Analysis of Merge-sort Algorithm


n n n
T (n)  2.T ( )  n T (n)  2.T ( )  (n)  22.T ( 2 )  n  n
2 2 2
n n n
T ( )  2.T ( 2 )  n
2 2 2 T (n)  22.T ( )nn
n n n 22
T ( 2 )  2.T ( 3 )  2 n
2 2 2 T (n)  23.T ( 3 )  n  n  n
n n n 2
T ( 3 )  2.T ( 4 )  3 . . . ...
2 2 2 n
n n n T (n)  2k.T ( k )  n  n  . . .  n
T ( k 1 )  2.T ( k )  k 1 2 k times
2 2 2
n
T (n)  2k.T ( k )  k.n
2
Let us suppose that: n  2k  log 2 n  k

Hence, T (n)  n.T (1)  n.log 2 n  n  n.log 2 n

T (n)  (n.log 2 n)

Searching: Finding Maxima in 1-D


A Simple Example in 1-D:
Finding the maximum of a set S of n numbers

Dr. Nazir Ahmad Zafar | Virtual University of Pakistan


99 CS-702 Advanced Algorithms Analysis and Design

Time Complexity
2T  n 2   1 n  2
T  n  
 1 n2
• Assume n = 2k, then
T(n) = 2T(n/2) + 1 = 2(2T(n/4) + 1) + 1
= 22T(n/22) + 2 + 1
= 22(2T(n/23) + 1) + 2 + 1
= 23T(n/23) + 22 + 21 + 1
:
= 2 T(n/2k-1)+2k-2 +…+ 22 + 21 + 1
k-1

= 2k-1T(2) + 2k-2 +…+ 22 + 21 + 1


= 2k-1 + 2k-2 +…+ 4 + 2 + 1 = 2k - 1 = n – 1 = (n)

Finding Maxima in 2-D using Divide and Conquer


How to Find Maxima in 2-D

{P1, P2} both maximal in SL and {P3} only maxima in


SR
Merging SL and SR

After Merging Maximal in SLand SR we get {P2, P3} only maximal

Dr. Nazir Ahmad Zafar | Virtual University of Pakistan


100 CS-702 Advanced Algorithms Analysis and Design

Divide and Conquer for Maxima Finding Problem

The maximal points of SL and SR P3 is not maximal point of SL

2-D Maxima Finding Problem

Algorithm: Maxima Finding Problem


Input: A set S of 2-dimensional points.
Output: The maximal set of S.
Maxima(P[1..n])
1. Sort the points in ascending order w. r .t. X axis
2. If |S| = 1, then return it, else
find a line perpendicular to X-axis which separates S into SL and SR, each of which
consisting of n/2 points.
3. Recursively find the maxima‟s SL and SR
4. Project the maxima‟s of SL and SR onto L and sort these points according to their y-
values.
5. Conduct a linear scan on the projections and discard each of maxima of SL if its y-value
is less than the y-value of some maxima‟s of SR .

Dr. Nazir Ahmad Zafar | Virtual University of Pakistan


101 CS-702 Advanced Algorithms Analysis and Design

Time Complexity:
 2T(n/2) + O(n) + O(n) ,n2
T(n) =  1 ,n<2

Assume n = 2k, then
T(n) = 2T(n/2) + n + n
= 2(2T(n/4) + n/2 + n/2) + n + n
= 22T(n/22) + n + n + n + n
= 22T(n/22) + 4n
= 22(2T(n/23) + n/4 + n/4) + 4n
= 23T(n/23) + n + n + 6n

T(n) = 23T(n/23) + n + n + 6n
.
.
T(n) = 2kT(n/2k) + 2kn
= 2kT(2k/2k) + 2kn Since n = 2k
Hence
T(n) = 2k + 2kn
T(n) = 2k + 2kn n = 2k  k = log(n)
T(n) = n + 2n.logn = (n.logn)

Necessary Dividing Problem into two Parts?


Maximal Points: Dividing Problem into four Parts

Maximal points in S11 = {P1}


Maximal points in S12 = {P3, P4}
Maximal points in S21 = {P5, P6}
Maximal points in S22 = {P7, P8}

Dr. Nazir Ahmad Zafar | Virtual University of Pakistan


102 CS-702 Advanced Algorithms Analysis and Design

Merging S12, S12


A1 = {P3, P4}
Merging S21, S22
A2 = {P7, P8}
Merging A1, A2
A = {P3, P7, P8}

Merging S12, S12


A1 = {P3, P4}
Merging S21, S22
A2 = {P7, P8}
Merging A1, A2
A = {P3, P7, P8}

Closest Pair in 2-D using Divide and Conquer


Problem
The closest pair problem is defined as follows:
• Given a set of n points
• Determine the two points that are closest to each other in terms of distance.
• Furthermore, if there are more than one pair of points with the closest distances, all such
pairs should be identified.
• First we sort the points on x-coordinate basis, and divide into left and right parts

p1 p2 ... pn/2 and pn/2+1 ... Pn


• Solve recursively the left and right
sub-problems
• Let d = min {di, dr},
• How do we combine
two solutions to
sub-problems?

Dr. Nazir Ahmad Zafar | Virtual University of Pakistan


103 CS-702 Advanced Algorithms Analysis and Design

• How do we combine two solutions?


– Let d = min {di, dr}, where d is distance of closest pair where both points are
either in left or in right
– Something is missing. We have to check where one point is from left and the
other from the right.
– Such closest-pair can only be in a strip of width 2d around the dividing line,
otherwise the points would be more than d units apart.

• Combining solutions:
– Finding the closest pair in a strip of width 2d, knowing that no one in any two
given pairs is closer than d
• Combining solutions:
• For a given point p from one partition, where can there be a point q from the
other partition, that can form the closest pair with p?
• How many points can there be in this square?
– At most 4

• Algorithm for checking the strip:


– Sort all the points in the strip on the y-coordinate
– For each point p only 7 points ahead of it in the order have to be checked to see
if any of them is closer to p than d

1. Partition the strip into squares of length


d/2 as shown in the picture.
2. Each square contains at most 1 point by
definition of d.
3. If there are at least 2 squares between
points then they cannot be the closest
points.
4. There are at most 8 squares to check.

Dr. Nazir Ahmad Zafar | Virtual University of Pakistan


104 CS-702 Advanced Algorithms Analysis and Design

Closest-Pair(P, l, r)
01 if r – l < 3 then return ClosestPairBF(P)
02 q ¬ é(l+r)/2ù
03 dl ¬ Closest-Pair(P, l, q-1)
04 dr ¬ Closest-Pair(P, q, r)
05 d ¬ min(dl, dr)
06 for i ¬ l to r do
07 if P[q].x - d £ P[i].x £ P[q].x + d then
08 append P[i] to S
09 Sort S on y-coordinate
10 for j ¬ 1 to size_of(S)-1 do
11 Check if any of d(S[j],S[j]+1), ...,
d(S[j],S[j]+7) is smaller than d, if so set
d to the smallest of them
12 return d

Running Time
• Running time of a divide-and-conquer algorithm can be described by a recurrence
– Divide = O(1)
– Combine = O(n lg n)
– This gives the recurrence given below
– Total running time: O(n log2 n)

n n3

T ( n)   n
 2T ( )  n log n otherwise
2

Improved Version: Divide and Conquer Approach


• Sort all the points by x and y coordinate once
• Before recursive calls, partition the sorted lists into two sorted sublists for the left and
right halves, it will take simple time O(n)
• When combining, run through the y-sorted list once and select all points that are in a 2d
strip around partition line, again time O(n)
• New recurrence:

Dr. Nazir Ahmad Zafar | Virtual University of Pakistan


105 CS-702 Advanced Algorithms Analysis and Design

n n3

T ( n)   n
 2T ( )n otherwise
2

Conclusion
• Brute Force approach is discussed, design of some algorithms is also discussed.
• Algorithms computing maximal points is generalization of sorting algorithms
• Maximal points are useful in Computer Sciences and Mathematics in which at least one
component of every point is dominated over all points.
• In fact we put elements in a certain order
• For Brute Force, formally, the output of any sorting algorithm must satisfy the following
two conditions:
– Output is in decreasing/increasing order and
– Output is a permutation, or reordering, of input.

Dr. Nazir Ahmad Zafar | Virtual University of Pakistan


106 CS-702 Advanced Algorithms Analysis and Design

Lecture No. 15
Dynamic Programming for Solving Optimization Problems
(Chain Matrix Multiplication Problem)
Today Covered
• Optimizations problem?
• Steps in Development of Dynamic Algorithms
• Why dynamic in optimization problem?
• Introduction to Catalan numbers
• Chain-Matrix Multiplication
• Problem Analysis
– Brute Force approach
– Time Complexity
• Conclusion

Optimization Problems
• If a problem has only one correct solution, then optimization is not required
• For example, there is only one sorted sequence containing a given set of numbers.
• Optimization problems have many solutions.
• We want to compute an optimal solution e. g. with minimal cost and maximal gain.
• There could be many solutions having optimal value
• Dynamic programming is very effective technique
• Development of dynamic programming algorithms can be broken into a sequence steps
as in the next.

Steps in Development of Dynamic Algorithms


1. Characterize the structure of an optimal solution
2. Recursively define the value of an optimal solution
3. Compute the value of an optimal solution in a bottom-up fashion
4. Construct an optimal solution from computed information

Note: Steps 1-3 form the basis of a dynamic programming solution to a problem. Step 4 can be
omitted only if the value of an optimal solution is required.

Why Dynamic Programming?


• Dynamic programming, like divide and conquer method, solves problems by combining
the solutions to sub-problems.
• Divide and conquer algorithms:
• partition the problem into independent sub-problem
• Solve the sub-problem recursively and
• Combine their solutions to solve the original problem
• In contrast, dynamic programming is applicable when the sub-problems are not
independent.
• Dynamic programming is typically applied to optimization problems.

Dr. Nazir Ahmad Zafar | Virtual University of Pakistan


107 CS-702 Advanced Algorithms Analysis and Design

Time Complexity in Dynamic Algorithms


• Time complexity:
– If there are polynomial number of sub-problems.
– If each sub-problem can be computed in polynomial time.
– Then the solution of whole problem can be found in polynomial time.
Remark:
Greedy also applies a top-down strategy but usually on one sub-problem so that the
order of computation is clear

Catalan Numbers
Multiplying n Numbers
Objective:
• Find C(n), the number of ways to
compute product x1 . x2 …. xn.

Multiplying n Numbers – small n


Recursive equation:

Where is the last multiplication?


n 1
C ( n)   C (k )  C (n  k )
k 1

Catalan numbers:
1  2n  2 
C ( n)  
n  n  1 
.

Asymptotic value:
4n
C ( n) 
n3/2
C(n)
 4 for n  
C(n-1)

Dr. Nazir Ahmad Zafar | Virtual University of Pakistan


108 CS-702 Advanced Algorithms Analysis and Design

Chain-Matrix Multiplication
Statement: The chain-matrix multiplication problem can be stated as below:
• Given a chain of [A1, A2, . . . , An] of n matrices where for i = 1, 2, . . . , n, matrix Ai has
dimension pi-1 x pi, find the order of multiplication which minimizes the number of scalar
multiplications.
Note:
• Order of A1 is p0 x p1,
• Order of A2 is p1 x p2,
• Order of A3 is p2 x p3, etc.
• Order of A1 x A2 x A3 is p0 x p3,
• Order of A1 x A2 x . . . x An is p0 x pn
Objective is to find order not multiplication
• Given a sequence of matrices, we want to find a most efficient way to multiply these
matrices
• It means that problem is not actually to perform the multiplications, but decide the order
in which these must be multiplied to reduce the cost.
• This problem is an optimization type which can be solved using dynamic programming.
• The problem is not limited to find an efficient way of multiplication of matrices, but can be
used to be applied in various purposes.
• But how to transform the original problem into chain matrix multiplication, this is another
issue, which is common in systems modeling.

Why this problem is of Optimization Category?


• If these matrices are all square and of same size, the multiplication order will not affect
the total cost.
• If matrices are of different sizes but compatible for multiplication, then order can make
big difference.
• Brute Force approach
– The number of possible multiplication orders are exponential in n, and so trying
all possible orders may take a very long time.
• Dynamic Programming
– To find an optimal solution, we will discuss it using dynamic programming to
solve it efficiently.
Assumptions (Only Multiplications Considered)
• We really want is the minimum cost to multiply
• But we know that cost of an algorithm depends on how many number of operations are
performed i.e.
• We must be interested to minimize number of operations, needed to multiply out the
matrices.
• As in matrices multiplication, there will be addition as well multiplication operations in
addition to other
• Since cost of multiplication is dominated over addition therefore we will minimize the
number of multiplication operations in this problem.
• In case of two matrices, there is only one way to multiply them, so the cost fixed.

Dr. Nazir Ahmad Zafar | Virtual University of Pakistan


109 CS-702 Advanced Algorithms Analysis and Design

Brute Force Chain Matrix Multiplication Algorithm


• If we wish to multiply two matrices:
A = a[i, j]p, q and B = b[i, j]q, r
• Now if C = AB then order of C is p x r.
• Since in each entry c[i, j], there are q number of scalar of multiplications
• Total number of scalar multiplications in computing C = Total entries in C x Cost of
computing a single entry = p . r . q
• Hence the computational cost of AB = p . q . r

C  i , j    Ai , k  B  j , k 
a

k 1

Example
• Given a sequence [A1, A2, A3, A4]
• Order of A1 = 10 x 100
• Order of A2 = 100 x 5
• Order of A3 = 5x 50
• Order of A4 = 50x 20

Compute the order of the product A1 . A2 . A3 . A4 in such a way that minimizes the total number
of scalar multiplications.

• There are five ways to parenthesize


this product (A1 · (A2 . (A3 . A4)))
• Cost of computing the matrix product (A1 · ((A2 . A3). A4))
may vary, depending on order of ((A1 · A2). (A3 . A4))
parenthesis. ((A1 · (A2 . A3)). A4)
• All possible ways of parenthesizing (((A1 · A2). A3). A4)

Kinds of problems solved by algorithms

Dr. Nazir Ahmad Zafar | Virtual University of Pakistan


110 CS-702 Advanced Algorithms Analysis and Design

Second Chain: (A1 · ((A2 . A3). A4))

Third Chain : ((A1 · A2). (A3 . A4))

Fourth Chain : ((A1 · (A2 . A3)). A4)

Dr. Nazir Ahmad Zafar | Virtual University of Pakistan


111 CS-702 Advanced Algorithms Analysis and Design

Fifth Chain: (((A1 · A2). A3). A4)

Chain Matrix Cost

((A1 · A2). (A3 . A4))

Generalization of Brute Force Approach


• If there is sequence of n matrices, [A1, A2, . . . , An]
• Ai has dimension pi-1 x pi, where for i = 1, 2, . . . , n
• Find order of multiplication that minimizes number of scalar multiplications using brute
force approach

Dr. Nazir Ahmad Zafar | Virtual University of Pakistan


112 CS-702 Advanced Algorithms Analysis and Design

Recurrence Relation: After kth matrix, create two sub-lists, one with k and other with n - k
matrices i.e. (A1 A2A3A4A5 . . . Ak) (Ak+1Ak+2…An)
• Let P(n) be the number of different ways of parenthesizing n items
 1 n 1

P n   n 1
 k  1P  k  P  n  k  n  2

If n = 2
P(2) = P(1).P(1) = 1.1 = 1
If n = 3
P(3) = P(1).P(2) + P(2).P(1) = 1.1 + 1.1 = 2
(A1 A2A3) = ((A1 . A2). A3) OR (A1 . (A2. A3))
If n = 4
P(4) = P(1).P(3) + P(2).P(2) + P(3).P(1) = 1.2 + 1.1 + 2.1 = 5

 1 n 1

P n   n 1
 k  1P  k  P  n  k  n  2

Why Brute Force Approach not Economical


• This is related to a famous function in combinatorics called the Catalan numbers.
• Catalan numbers are related with the number of different binary trees on n nodes.
• P(n)  (4n/n3/2)
• The dominating term is the exponential 4n thus P(n) will grow large very quickly.
• And hence this approach is not economical.

Conclusion
• Introduction to optimization problem
• Dynamic Programming
• Comparison of Dynamic and Divide and conquer
• Chain matrix multiplication problem is introduced
• Analyzed that chain matrix is an optimization type problem
• Brute force solution is discussed
• Analysis is done and based on its analysis it was found that solution to chain matrix
multiplication problem using brute force approach is not economical for large input

Dr. Nazir Ahmad Zafar | Virtual University of Pakistan


113 CS-702 Advanced Algorithms Analysis and Design

Lecture No. 16
Chain Matrix Multiplication Problem using
Dynamic Programming
Today Covered
• Chain-Matrix Multiplication
• Problem Analysis
– Notations
– Dynamic Algorithm
– Time Complexity
• Generalization and Applications
• Conclusion

Problem Statement: Chain Matrix Multiplication


Statement: The chain-matrix multiplication problem can be stated as below:
• Given a chain of [A1, A2, . . . , An] of n matrices for i = 1, 2, . . . , n, matrix Ai has
dimension pi-1 x pi, find the order of multiplication which minimizes the number of scalar
multiplications.
Note:
• Order of A1 is p0 x p1,
• Order of A2 is p1 x p2,
• Order of A3 is p2 x p3, etc.
• Order of A1 x A2 x A3 is p0 x p3,
• Order of A1 x A2 x . . . x An is p0 x pn

Why Dynamic Programming in this problem?


• Problem is of type optimization
• Sub-problems are dependant
• Optimal structure can be characterized and
• Can be defined recursively
• Solution for base cases exits
• Optimal solution can be constructed
• Hence here is dynamic programming

Dynamic Programming Formulation


• Let Ai..j = Ai . Ai+1 . . . Aj
• Order of Ai = pi-1 x pi, and
• Order of Aj = pj-1 x pj,
• Order of Ai..j = rows in Ai x columns in Aj = pi-1 × pj
• At the highest level of parenthesisation,
Ai..j = Ai..k × Ak+1..j i≤k<j
• Let m[i, j] = minimum number of multiplications needed to compute Ai..j, for 1 ≤ i ≤ j ≤ n
• Objective function = finding minimum number of multiplications needed to compute A1..n
i.e. to compute m[1, n]

Dr. Nazir Ahmad Zafar | Virtual University of Pakistan


114 CS-702 Advanced Algorithms Analysis and Design

Mathematical Model
Ai..j = (Ai. Ai+1….. Ak). (Ak+1. Ak+2….. Aj) = Ai..k × Ak+1..j i≤k<j
• Order of Ai..k = pi-1 x pk, and order of Ak+1..j = pk x pj,
• m[i, k] = minimum number of multiplications needed to compute Ai..k
• m[k+1, j] = minimum number of multiplications needed to compute Ak+1..j
Mathematical Model

Example: Dynamic Programming


Problem: Compute optimal multiplication
order for a series of matrices given below
A1 A2 A A4
. . 3 .
10  100 100  5 5  50 50  20
P0 = 10, P1 = 100, P2 = 5 , P3 = 50 , P4 = 20

Main Diagonal
m[i, i ]  0, i  1,..., 4
m[i, j ]  min(m[i, k ]  m[k  1, j]  p i 1. pk . p j )
ik  j

m[1, 1] = 0, m[2, 2] = 0, m[3, 3] = 0, m[4, 4] = 0

Computing m[1, 2], m[2, 3], m[3, 4]


m[i, j ]  (m[i, k ]  m[k  1, j ]  pi 1. pk . p j )
min
i k  j

m[1,2]  min(m[1, k ]  m[k  1,2]  p . p . p )


0 k 2
1 k  2

m[1,2]  min(m[1,1]  m[2,2]  p . p . p )


0 1 2

m[1, 2] = 0 + 0 + 10 . 100 . 5 = 5000


s[1, 2] = k = 1

Computing m[2, 3]
m[i, j ]  (m[i, k ]  m[k  1, j ]  pi 1. pk . p j )
min
i k  j

m[2,3]  min(m[2, k ]  m[k  1,3]  p . p . p )


1 k 3
2 k 3

m[2,3]  min(m[2,2]  m[3,3]  p . p . p3)


1 2

m[2, 3] = 0 + 0 + 100 . 5 . 50 = 25000


s[2, 3] = k = 2

Dr. Nazir Ahmad Zafar | Virtual University of Pakistan


115 CS-702 Advanced Algorithms Analysis and Design

Computing m[3, 4]
m[i, j ]  (m[i, k ]  m[k  1, j ]  pi 1. pk . p j )
min
i k  j

m[3,4]  min(m[3, k ]  m[k  1,4]  p . p . p ) 2 k 4


3 k  4

m[3,4]  min(m[3,3]  m[4,4]  p . p . p ) 2 3 4

m[3, 4] = 0 + 0 + 5 . 50 . 20 = 5000
s[3, 4] = k = 3

Computing m[1, 3], m[2, 4]


m[i, j ]  (m[i, k ]  m[k  1, j ]  pi 1. pk . p j )
min
i k  j

m[1,3]  min(m[1, k ]  m[k  1,3]  p . p . p )0 k 3


1 k 3

m[1,3]  min(m[1,1]  m[2,3]  p . p . p ,


0 1 3

m[1, 2]  m[3,3]  p0 . p2 . p3 ))
m[1, 3] = min(0+25000+10.100.50, 5000+0+10.5.50) = min(75000, 2500) = 2500
s[1, 3] = k = 2

Computing m[2, 4]
m[i, j ]  (m[i, k ]  m[k  1, j ]  pi 1. pk . p j )
min
i k  j

m[2,4]  min(m[2, k ]  m[k  1,4]  p . p . p ) 1 k 4


2 k  4

m[2, 4]  min(m[2, 2]  m[3, 4]  p . p . p ,1 2 4

m[2,3]  m[4, 4]  p1. p3 . p4 ))


m[2, 4] = min(0+5000+100.5.20, 25000+0+100.50.20) = min(15000, 35000) = 15000
s[2, 4] = k = 2

Computing m[1, 4]
m[i, j ]  (m[i, k ]  m[k  1, j ]  pi 1. pk . p j )
min
i k  j

m[1,4]  min(m[1, k ]  m[k  1,4]  p . p . p ) 0 k 4


1 k  4

m[1, 4]  min(m[1,1]  m[2, 4]  p . p . p ,


0 1 4

m[1, 2]  m[3, 4]  p0 . p2 . p4 , m[1,3]  m[4, 4]  p0 . p3 . p4 )


m[1, 4] = min(0+15000+10.100.20, 5000+5000+ 10.5.20, 2500+0+10.50.20)
= min(35000, 11000, 35000) = 11000 s[1, 4] = k = 2

Dr. Nazir Ahmad Zafar | Virtual University of Pakistan


116 CS-702 Advanced Algorithms Analysis and Design

Final Cost Matrix and Its Order of Computation


Final Cost Matrix Order of Computation

Representing Order using Binary Tree


• The above computation shows that the minimum cost for multiplying those four matrices
is 11000.
• The optimal order for multiplication is ((A1 . A2) . (A3 . A4)) For, m(1, 4), k = 2

Chain-Matrix-Order(p)
1. n  length[p] – 1
2. for i  1 to n
3. do m[i, i]  0
4. for l  2 to n,
5. do for i  1 to n-l+1
6. do j  i+l-1
7. m[i, j]  
8. for k  i to j-1
9. do q  m[i, k] + m[k+1, j]
+ pi-1 . pk . pj
10. if q < m[i, j]
11. then m[i, j] = q
12. s[i, j]  k
13. return m and s, “l is chain length”

Dr. Nazir Ahmad Zafar | Virtual University of Pakistan


117 CS-702 Advanced Algorithms Analysis and Design

Computational Cost
n n n n i
T ( n)  n  
i 1 j i 1
( j  i)   ki 1 k 1

n
(n  i )(n  i  1)
T ( n)  n  
i 1 2
n

 (n
1
T ( n)  n  2
 2ni  i 2  n  i )
2 i 1

1 n n n n n
T ( n)  n  ( n 2 
2 i 1
 
i 1
2ni  
i 1
i2    i)
i 1
n
i 1
n n n n n

     i)
1
T ( n)  n  ( n 2  2ni  i2  n
2 i 1 i 1 i 1 i 1 i 1
n n n n n

     i)
1
T ( n)  n  ( n 2 1  2 n i  i2  n 1
2 i 1 i 1 i 1 i 1 i 1

1 n(n  1) n(n  1)(2n  1) n(n  1)


T (n)  n  (n2 .n  2n.   n.n  )
2 2 6 2
1 n(n  1) n(n  1)(2n  1) n(n  1)
T (n)  n  (n2 .n  2n.   n.n  )
2 2 6 2
1 n(n  1)(2n  1) n(n  1)
T (n)  n  (n3  n2 (n  1)   n2  )
2 6 2
1
T (n)  n  (6n3  6n3  6n2  2n3  3n2  n  6n2  3n2  3n)
12
1 1 1
T (n)  (12n  2n3  2n)  (10n  2n3 )  (5n  n3 )
12 12 6

Cost Comparison Brute Force Dynamic Programming


Dynamic Programming
There are three loop
• The most two loop for i, j, satisfy the condition: 1 i j n
• Cost = C2 + n = n(n-1)/2 + n =  (n )
n 2

• The third one most inner loop for k satisfies the condition, i k < j, in worst case, it cost
n and
• Hence total cost =  (n2 . n) =  (n3)
Brute Force Approach
• P(n) = C(n - 1) C(n)  (4n/n3/2)

Generalization: Sequence of Objects


• Although this algorithm applies well to the problem of matrix chain multiplication
• Many researchers have noted that it generalizes well to solving a more abstract problem
• given a linear sequence of objects
• an associative binary operation on those objects hold

Dr. Nazir Ahmad Zafar | Virtual University of Pakistan


118 CS-702 Advanced Algorithms Analysis and Design

• the objective to find a way to compute the cost of performing that operation on
any two given objects
• and finally computing the minimum cost for grouping these objects to apply the
operation over the entire sequence.
• It is obvious that this problem can be solved using chain matrix multiplication, because
there is a one to one correspondence between both problem

Generalization: String Concatenation


• One common special case of chain matrix multiplication problem is string concatenation.
• For example, we are give a list of strings.
• The cost of concatenating two strings of length m and n is for example O(m + n)
• Since we need O(m) time to find the end of the first string and O(n) time to copy
the second string onto the end of it.
• Using this cost function, we can write a dynamic programming algorithm to find
the fastest way to concatenate a sequence of strings
• It is possible to concatenate all in time proportional to sum of their lengths, but
here we are interested to link this problem with chain matrix multiplication

Generalization: Parallel Processors


• Another generalization is to solve the problem when many parallel processors are
available.
• In this case, instead of adding the costs of computing each subsequence, we just take
the maximum, because we can do them both simultaneously.
• This can drastically affect both the minimum cost and the final optimal grouping
• But of course more balanced groupings that keep all the processors busy is more
favorable solution
• There exists some more sophisticated approaches to solve this problem

Conclusion
• Created some notations to describe mathematical model of the chain matrix
multiplication problem
• A recursive model was described
• Based on this model dynamic programming algorithm was designed
• An example was taken for applying model to solve dynamically, constructing optimal
solution based on the given information
• Time complexity was computed for the Algorithm
• Applications of chain matrix problem are discussed

Dr. Nazir Ahmad Zafar | Virtual University of Pakistan


119 CS-702 Advanced Algorithms Analysis and Design

Lecture No. 17
Assembly-Line Scheduling Problem

Today Covered
• Assembly Line Scheduling Problem
• Problem Analysis
– Defining Notations
– Brute Force approach
– Dynamic Solution
• Algorithm using Dynamic Programming
• Time Complexity
• Generalization and Applications
• Conclusion

Assembly-Line Scheduling Problem


• There are two assembly lines each with n stations
• The jth station on line i is denoted by Si, j
• The assembly time at that station is ai,j.
• An auto enters factory, goes into line i taking time ei
• After going through the jth station on a line i, the auto goes on to the (j+1)st station on
either line
• There is no transfer cost if it stays on the same line
• It takes time ti,j to transfer to other line after station Si,j
• After exiting the nth station on a line, it takes time xi for the completed auto to exit the
factory.
• Problem is to determine which stations to choose from lines 1 and 2 to minimize total
time through the factory.

Notations: Assembly-Line Scheduling Problem

Stations Si,j;
2 assembly lines, i = 1,2;
n stations, j = 1,...,n.
ai,j = assembly time at Si,j;
ti,j = transfer time from Si,j (to Si-1,j+1 OR Si+1,j+1);
ei = entry time from line i;
xi = exit time from line i .

Dr. Nazir Ahmad Zafar | Virtual University of Pakistan


120 CS-702 Advanced Algorithms Analysis and Design

Total Computational Time = possible ways to enter in stations at level n x one way Cost
Possible ways to enter in stations at level 1 = 21
Possible ways to enter in stations at level 2 = 22 . . .
Possible ways to enter in stations at level 2 = 2n
Total Computational Time = n.2n

Dynamic Programming Solution


Notations: Finding Objective Function
• Let fi[j] = fastest time from starting point station Si, j
• f1[n] = fastest time from starting point station S1 n
• f2[n] = fastest time from starting point station S2 n
• li[j] = The line number, 1 or 2, whose station j-1 is used in a fastest way through station
Si, j .
• It is to be noted that li[1] is not required to be defined because there is no station before
1
• ti[j-1] = transfer time from line i to station Si-1, j or Si+1, j
• Objective function = f* = min(f1[n] + x1, f2[n] + x2)
• l* = to be the line no. whose nth station is used in a fastest way.

Dr. Nazir Ahmad Zafar | Virtual University of Pakistan


121 CS-702 Advanced Algorithms Analysis and Design

Mathematical Model: Finding Objective Function

f1[1] = e1 + a1,1;
f2[1] = e2 + a2,1.
f1[j] = min (f1[j-1] + a1,j, f2[j-1] + t2,j-1 + a1,j) for j ≥ 2;
f2[j] = min (f2[j-1] + a2,j, f1[j-1] + t1,j-1 + a2,j) for j ≥ 2;

Complete Model: Finding Objective Function


Base Cases
• f1[1] = e1 + a1,1
• f2[1] = e2 + a2,1
Two possible ways of computing f1[j]
• f1[j] = f2[j-1] + t2, j-1 + a1, j OR f1[j] = f1[j-1] + a1, j
For j = 2, 3, . . ., n
f1[j] = min (f1[j-1] + a1, j, f2[j-1] + t2, j-1 + a1, j)
Symmetrically
For j = 2, 3, . . ., n
f2[j] = min (f2[j-1] + a2, j, f1[j-1] + t1, j-1 + a2, j)
Objective function = f* = min(f1[n] + x1, f2[n] + x2)

Example: Computation of f1[2]

• f1[1] = e1 + a1,1 = 2 + 7 = 9
• f2[1] = e2 + a2,1 = 4 + 8 = 12
• f1[j] = min (f1[j-1] + a1, j, f2[j-1] + t2, j-1 + a1, j)
• f2[j] = min (f2[j-1] + a2, j, f1[j-1] + t1, j-1 + a2, j)
• j=2
• f1[2] = min (f1[1] + a1, 2, f2[1] + t2, 1 + a1, 2) = min (9 + 9, 12 + 2 + 9) = min (18, 23) = 18,
l1[2] = 1

Dr. Nazir Ahmad Zafar | Virtual University of Pakistan


122 CS-702 Advanced Algorithms Analysis and Design

Computation of f2[2]

• f1[1] = e1 + a1,1 = 2 + 7 = 9
• f2[1] = e2 + a2,1 = 4 + 8 = 12
• f1[j] = min (f1[j-1] + a1, j, f2[j-1] + t2, j-1 + a1, j)
• f2[j] = min (f2[j-1] + a2, j, f1[j-1] + t1, j-1 + a2, j)
• j=2
• f2[2] = min (f2[1] + a2, 2, f1[1] + t1, 1 + a2, 2) = min (12 + 5, 9 + 2 + 5) = min (17, 16) = 16,
l2[2] = 1

Computation of f1[3]

• f1[j] = min (f1[j-1] + a1, j, f2[j-1] + t2, j-1 + a1, j)


• f2[j] = min (f2[j-1] + a2, j, f1[j-1] + t1, j-1 + a2, j)
• j=3
• f1[3] = min (f1[2] + a1, 3, f2[2] + t2, 2 + a1, 3) = min (18 + 3, 16 + 1 + 3) = min (21, 20) = 20
• l1[3] = 2

Computation of f2[3]

• f1[j] = min (f1[j-1] + a1, j, f2[j-1] + t2, j-1 + a1, j)


• f2[j] = min (f2[j-1] + a2, j, f1[j-1] + t1, j-1 + a2, j)
• j=3
• f2[3] = min (f2[2] + a2, 3, f1[2] + t1, 2 + a2, 3) = min (16 + 6, 18 + 3 + 6) = min (22, 27) = 22,
• l2[3] = 2

Dr. Nazir Ahmad Zafar | Virtual University of Pakistan


123 CS-702 Advanced Algorithms Analysis and Design

Computation of f1[4]

• f1[j] = min (f1[j-1] + a1, j, f2[j-1] + t2, j-1 + a1, j)


• f2[j] = min (f2[j-1] + a2, j, f1[j-1] + t1, j-1 + a2, j)
• j=4
• f1[4] = min (f1[3] + a1, 4, f2[3] + t2, 3 + a1, 4) = min (20 + 4, 22 + 1 + 4) = min (24, 27) = 24,
• l1[4] = 1

Computation of f2[4]

• f1[j] = min (f1[j-1] + a1, j, f2[j-1] + t2, j-1 + a1, j)


• f2[j] = min (f2[j-1] + a2, j, f1[j-1] + t1, j-1 + a2, j)
• j=4
• f2[4] = min (f2[3] + a2, 4, f1[3] + t1, 3 + a2, 4) = min (22 + 4, 20 + 1 + 4) = min (26, 25) = 25,
• l2[4] = 1

Computation of f1[5]

• f1[j] = min (f1[j-1] + a1, j, f2[j-1] + t2, j-1 + a1, j)


• f2[j] = min (f2[j-1] + a2, j, f1[j-1] + t1, j-1 + a2, j)
• j=5
• f1[5] = min (f1[4] + a1, 5, f2[4] + t2, 4 + a1, 5) = min (24 + 8, 25 + 2 + 8) = min (32, 35) = 32,
• l1[5] = 1

Dr. Nazir Ahmad Zafar | Virtual University of Pakistan


124 CS-702 Advanced Algorithms Analysis and Design

Computation of f2[5]

• f1[j] = min (f1[j-1] + a1, j, f2[j-1] + t2, j-1 + a1, j)


• f2[j] = min (f2[j-1] + a2, j, f1[j-1] + t1, j-1 + a2, j)
• j=5
• f2[5] = min (f2[4] + a2, 5, f1[4] + t1, 4 + a2, 5) = min (25 + 5, 24 + 3 + 5) = min (30, 32) = 30,
• l2[5] = 2

Computation of f1[6]

• f1[j] = min (f1[j-1] + a1, j, f2[j-1] + t2, j-1 + a1, j)


• f2[j] = min (f2[j-1] + a2, j, f1[j-1] + t1, j-1 + a2, j)
• j=6
• f1[6] = min (f1[5] + a1, 6, f2[5] + t2, 5 + a1, 6) = min (32 + 4, 30 + 1 + 4) = min (36, 35) = 35,

• l1[6] = 2

Computation of f2[6]

• f1[j] = min (f1[j-1] + a1, j, f2[j-1] + t2, j-1 + a1, j)


• f2[j] = min (f2[j-1] + a2, j, f1[j-1] + t1, j-1 + a2, j)
• j=6
• f2[6] = min (f2[5] + a2, 6, f1[5] + t1, 5 + a2, 6) = min (30 + 7, 32 + 4 + 7) = min (37, 43) = 37,
• l2[6] = 2

Dr. Nazir Ahmad Zafar | Virtual University of Pakistan


125 CS-702 Advanced Algorithms Analysis and Design

Keeping Track Constructing Optimal Solution


f* = min (f1[6] + x1, f2[6] + x2) = min (35 + 3, 37 + 2) = min (38, 39) = 38
l* = 1
l* = 1 => Station S1, 6
l1[6] = 2 => Station S2, 5
l2[5] = 2 => Station S2, 4
l2[4] = 1 => Station S1, 3
l1[3] = 2 => Station S2, 2
l2[2] = 1 => Station S1, 1

Entire Solution Set: Assembly-Line Scheduling

Fastest Way: Assembly-Line Scheduling

l* = 1 => Station S1, 6


l1[6] = 2 => Station S2, 5
l2[5] = 2 => Station S2, 4
l2[4] = 1 => Station S1, 3
l1[3] = 2 => Station S2, 2
l2[2] = 1 => Station S1, 1

Dr. Nazir Ahmad Zafar | Virtual University of Pakistan


126 CS-702 Advanced Algorithms Analysis and Design

Lecture No. 18
2-Line Assembly Scheduling Problem

Today Covered
• 2-Line Assembly Scheduling Algorithm using Dynamic Programming
• Time Complexity
• n-Line Assembly Problem
• Brute Force Analysis
• n-Line Assembly Scheduling Algorithm using Dynamic Programming
• Time Complexity
• Generalization and Applications
• Conclusion

Assembly-Line Scheduling Problem


• There are two assembly lines each with n stations
• The jth station on line i is denoted by Si, j
• The assembly time at that station is ai,j.
• An auto enters factory, goes into line i taking time ei
• After going through the jth station on a line i, the auto goes on to the (j+1)st station on
either line
• There is no transfer cost if it stays on the same line
• It takes time ti,j to transfer to other line after station Si,j
• After exiting the nth station on a line, it takes time xi for the completed auto to exit the
factory.
• Problem is to determine which stations to choose from lines 1 and 2 to minimize total
time through the factory.

Mathematical Model Defining Objective Function


Base Cases
• f1[1] = e1 + a1,1
• f2[1] = e2 + a2,1

Two possible ways of computing f1[j]


• f1[j] = f2[j-1] + t2, j-1 + a1, j OR f1[j] = f1[j-1] + a1, j
For j = 2, 3, . . ., n
f1[j] = min (f1[j-1] + a1, j, f2[j-1] + t2, j-1 + a1, j)

Symmetrically
For j = 2, 3, . . ., n
f2[j] = min (f2[j-1] + a2, j, f1[j-1] + t1, j-1 + a2, j)

Objective function = f* = min(f1[n] + x1, f2[n] + x2)

Dr. Nazir Ahmad Zafar | Virtual University of Pakistan


127 CS-702 Advanced Algorithms Analysis and Design

Dynamic Algorithm
FASTEST-WAY(a, t, e, x, n)
1 ƒ1[1] ≡ e1 + a1,1
2 ƒ2[1] ≡ e2 + a2,1
3 for j ≡ 2 to n
4 do if ƒ1[ j - 1] + a1, j ≤ ƒ2[ j - 1] + t2, j - 1 + a1, j
5 then ƒ1[ j] ≡ ƒ1[ j - 1] + a1, j
6 l1[ j] ≡ 1
7 else ƒ1[ j] ≡ ƒ2[ j - 1] + t2, j - 1 + a1, j
8 l1[ j] ≡ 2
9 if ƒ2[ j - 1] + a2, j ≤ ƒ1[ j - 1] + t1, j - 1 + a 2, j
10 then ƒ2[ j] ≡ ƒ2[ j - 1] + a2, j
11 l2[ j] ≡ 2
12 else ƒ2[ j] ≡ ƒ1[ j - 1] + t1, j - 1 + a2, j
13 l2[ j] ≡ 1
14 if ƒ1[n] + x1 ≤ ƒ2[n] + x2
15 then ƒ* = ƒ1[n] + x1
16 l* = 1
17 else ƒ* = ƒ2[n] + x2
18 l* = 2

Optimal Solution: Constructing The Fastest Way


1. Print-Stations (l, n)
2. i ≡ l*
3. print “line” i “, station” n
4. for j ≡ n downto 2
5. do i ≡ li[j]
6. print “line” i “, station” j - 1

n-Assembly Line Scheduling Problem


• There are n assembly lines each with m stations
• The jth station on line i is denoted by Si, j
• The assembly time at that station is ai,j.
• An auto enters factory, goes into line i taking time ei
• After going through the jth station on a line i, the auto goes on to the (j+1)st station on
either line
• It takes time ti,j to transfer from line i, station j to line i‟ and station j+1
• After exiting the nth station on a line i, it takes time xi for the completed auto to exit the
factory.
• Problem is to determine which stations to choose from lines 1 to n to minimize total time
through the factory.

Dr. Nazir Ahmad Zafar | Virtual University of Pakistan


128 CS-702 Advanced Algorithms Analysis and Design

n-Line: Brute Force Solution

Total Computational Time = possible ways to enter in stations at level n x one way Cost
Possible ways to enter in stations at level 1 = n1
Possible ways to enter in stations at level 2 = n2 . . .
Possible ways to enter in stations at level m = nm
Total Computational Time = (m.mn)

Dynamic Solution
Notations : n-Line Assembly

• Let fi[j] = fastest time from starting point to station Si, j


• f1[m] = fastest time from starting point to station S1 m
• f2[m] = fastest time from starting point to station S2,m
• fn[m] = fastest time from starting point to station Sn,m
• li[j] = The line number, 1 to n, whose station j-1 is used in a fastest way through station
Si‟, j

Dr. Nazir Ahmad Zafar | Virtual University of Pakistan


129 CS-702 Advanced Algorithms Analysis and Design

• ti[j-1] = transfer time from station Si, j-1 to station Si,, j


• a[i, j] = time of assembling at station Si, j
• f* = is minimum time through any way
• l* = the line no. whose mth station is used in a fastest way

Possible Lines to reach Station S(i, j)

Time from Line 1, f[1, j-1] + t[1, j-1] + a[i, j]


Time from Line 2, f[2, j-1] + t[2, j-1] + a[i, j]
Time from Line 3, f[3, j-1] + t[3, j-1] + a[i, j]
...
Time from Line n, f[n, j-1] + t[n, j-1] + a[i, j]

Dr. Nazir Ahmad Zafar | Virtual University of Pakistan


130 CS-702 Advanced Algorithms Analysis and Design

Values of f(i, j) and l* at Station S(i, j)

f[i, j] = min{f[1, j-1] + t[1, j-1] + a[i, j], f[2, j-1] + t[2, j-1] + a[i, j], . . , f[n, j-1] + t[n, j-1] + a[i, j]}
f[1, 1] = e1 + a[1, 1]; f [2, 1] = e2 + a[2, 1], … ,f [n, 1] = en + a[n, 1]
f* = min{f[1, n] +x1, f[2, n] + x2, . . , f[n, m] + xn}
l* = line number of mth station used

n-Line Assembly: Dynamic Algorithm

FASTEST-WAY(a, t, e, x, n, m)
1 for i ≡ 1 to n
2 ƒ[i,1] ≡ e[i] + a[i,1]
3 for j ≡ 2 to m
4 for i ≡ 1 to n
5 ƒ[i, j]  f[1, j-1] + t[1, j-1] + a[i, j]
6 L[1, j] = 1
7 for k  2 to n
8 if f[i,j] > f[k, j-1] + t[2, j-1] + a[i, j]
9 then f[i,j]  f[k, j-1] + t[2, j-1] + a[i, j]
L[i, j] = k
10 end if
11 ƒ*  ƒ[1, m] + x[1]
12 l* = 1
13 for k  2 to n
14 if f* > f[k, m] + x[k]
15 then ƒ*  ƒ[k, m] + x[k]
16 l* = k

Dr. Nazir Ahmad Zafar | Virtual University of Pakistan


131 CS-702 Advanced Algorithms Analysis and Design

Constructing the Fastest Way: n-Line

1. Print-Stations (l*, m)
2. i ≡ l*
3. print “line” i “, station” m
4. for j ≡ m downto 2
5. do i ≡ li[j]
6. print “line” i “, station” j - 1

Generalization: Cyclic Assembly Line Scheduling

Title: Moving policies in cyclic assembly line scheduling


Source: Theoretical Computer Science, Volume 351, Issue (February 2006)

Summary: Assembly line problem occurs in various kinds of production automation. In this
paper, originality lies in the automated manufacturing of PC boards.
• In this case, the assembly line has to process number of identical work pieces in a cyclic
fashion. In contrast to common variant of assembly line scheduling.
• Each station may process parts of several work-pieces at the same time, and parts of a
work-piece may be processed by several stations at the same time.

Application: Multiprocessor Scheduling


• The assembly line problem is well known in the area of multiprocessor scheduling.
• In this problem, we are given a set of tasks to be executed by a system with n identical
processors.
• Each task, Ti, requires a fixed, known time pi to execute.
• Tasks are indivisible, so that at most one processor may be executing a given task at
any time
• They are un-interruptible, i.e., once assigned a task, may not leave it until task is
complete.
• The precedence ordering restrictions between tasks may be represented by a tree or
forest of trees

Generalization: Cyclic Assembly Line Scheduling

Title: Moving policies in cyclic assembly line scheduling


Source: Theoretical Computer Science, Volume 351, Issue (February 2006)

Summary: Assembly line problem occurs in various kinds of production automation. In this
paper, originality lies in the automated manufacturing of PC boards.
• In this case, the assembly line has to process number of identical work pieces in a cyclic
fashion. In contrast to common variant of assembly line scheduling.
• Each station may process parts of several work-pieces at the same time, and parts of a
work-piece may be processed by several stations at the same time.

Dr. Nazir Ahmad Zafar | Virtual University of Pakistan


132 CS-702 Advanced Algorithms Analysis and Design

Application: Multiprocessor Scheduling


• The assembly line problem is well known in the area of multiprocessor scheduling.
• In this problem, we are given a set of tasks to be executed by a system with n identical
processors.
• Each task, Ti, requires a fixed, known time pi to execute.
• Tasks are indivisible, so that at most one processor may be executing a given task at
any time
• They are un-interruptible, i.e., once assigned a task, may not leave it until task is
complete.
• The precedence ordering restrictions between tasks may be represented by a tree or
forest of trees

Conclusion
• Assembly line problem is discussed
• Generalization is made
• Mathematical Model of generalized problem is discribed
• Algorithm is proposed
• Applications are observed in various domains
• Some research issues are identified

Dr. Nazir Ahmad Zafar | Virtual University of Pakistan


133 CS-702 Advanced Algorithms Analysis and Design

Lecture No. 19
0-1 Knapsack Problem using
Dynamic Programming

Today Covered
• 0-1 Knapsack Problem
• Problem Analysis
– Divide and Conquer
– Dynamic Solution
• Algorithm using Dynamic Programming
• Time Complexity
• Generalization, Variations and Applications
• Conclusion

General Knapsack Problem


• Given a set of items, each with a cost and a value, then determine the items to include in
a collection so that the total cost is less than some given cost and the total value is as
large as possible.
• Knapsack problem is of combinatorial optimization
• It derives its name from the maximization problem of choosing possible essentials that
can fit into one bag, of maximum weight, to be carried on a trip.
• A similar problem very often appears in business, complexity theory, cryptography and
applied mathematics.

0-1 Knapsack Problem Statement


The knapsack problem arises whenever there is resource allocation with no financial constraints
Problem Statement
• A thief robbing a store and can carry a maximal weight of W into his knapsack. There
are n items and ith item weight is wi and worth is vi dollars. What items should thief take,
not exceeding the bag capacity, to maximize value?
Assumption:
• the items may not be broken into smaller pieces, so thief may decide either to take an
item or to leave it, but may not take a fraction of an item.

0-1 Knapsack Problem Another Statement


Problem Statement
• You are in Japan on an official visit and want to make shopping from a store (Best
Denki)
• A list of required items is available at the store
• You are given a bag (knapsack), of fixed capacity, and only you can fill this bag with the
selected items from the list.
• Every item has a value (cost) and weight,
• And your objective is to seek most valuable set of items which you can buy not
exceeding bag limit.

Dr. Nazir Ahmad Zafar | Virtual University of Pakistan


134 CS-702 Advanced Algorithms Analysis and Design

0-1 Knapsack Problem: Remarks


Assumption
• Each item must be put entirely in the knapsack or not included at all that is why the
problem is called 0-1 knapsack problem
Remarks
• Because an item cannot be broken up arbitrarily, so it is its 0-1 property that makes the
knapsack problem hard.
• If an item can be broken and allowed to take part of it then algorithm can be solved using
greedy approach optimally

Notations: 0-1 Knapsack Problem Construction


Problem Construction
• You have prepared a list of n objects for which you are interested to buy, The items are
numbered as i1, i2, . . ., in
• Capacity of bag is W
• Each item i has value vi, and weigh wi
• We want to select a set of items among i1, i2, . . ., in which do not exceed (in total weight)
capacity W of the bag
• Total value of selected items must be maximum
• How should we select the items?

Model: 0-1 Knapsack Problem Construction


Formal Construction of Problem
• Given a list: i1, i2, . . ., in, values: v1, v2, . . ., vn and weights: w1, w2, . . ., wn respectively
• Of course W  0, and we wish to find a set S of items such that S  {i1, i2, . . ., in} that
• Maximizes  vi
iS

• subject to  wi  W
iS

Brute Force Solution


• Compute all the subsets of {i1, i2, . . ., in}, there will be 2n number of subsets.
• Find sum of the weights of total items in each set and list only those sets whose sum
does not increase by W (capacity of knapsack)
• Compute sum of values of items in each selected list and find the highest one
• This highest value is the required solution
• The computational cost of Brute Force Approach is exponential and not economical
• Find some other way!

Divide and Conquer Approach


Approach
• Partition the knapsack problem into sub-problems
• Find the solutions of the sub-problems
• Combine these solutions to solve original problem

Dr. Nazir Ahmad Zafar | Virtual University of Pakistan


135 CS-702 Advanced Algorithms Analysis and Design

Comments
• In this case the sub-problems are not independent
• And the sub-problems share sub-sub-problems
• Algorithm repeatedly solves common sub-sub-problems and takes more effort than
required
• Because this is an optimization problem and hence dynamic approach is another
solution if we are able to construct problem dynamically

Steps in Dynamic Programming


Step1 (Structure):
• Characterize the structure of an optimal solution
• Next decompose the problem into sub-problems
• Relate structure of the optimal solution of original problem and solutions of sub-problems

Step 2 (Principal of Optimality)


• Define value of an optimal solution recursively
• Then express solution of the main problem in terms of optimal solutions of sub-
problems.

Step3 (Bottom-up Computation):


• In this step, compute the value of an optimal solution in a bottom-up fashion by using
structure of the table already constructed.

Step 4 (Construction of an Optimal Solution)


• Construct an optimal solution from the computed information based on Steps 1-3.

Note:
• Some time people, combine the steps 3 and 4
• Step 1-3 form basis of dynamic problem
• Step 4 may be omitted if only optimal solution of the problem is required

Mathematical Model: Dynamic Programming

Step1 (Structure):
• Decompose problem into smaller problems
• Construct an array V[0..n, 0..W]
• V[i, w] = maximum value of items selected from {1, 2,. . ., i}, that can fit into a bag with
capacity w, where 1 i n, 1 w W
• V[n, W] = contains maximum value of the items selected from {1,2,…,n} that can fit into
the bag with capacity W storage
• Hence V[n, W] is the required solution for our knapsack problem

Dr. Nazir Ahmad Zafar | Virtual University of Pakistan


136 CS-702 Advanced Algorithms Analysis and Design

Step 2 (Principal of Optimality)


• Recursively define value of an optimal solution in terms of solutions to sub-problems
Base Case: Since
• V[0, w] = 0, 0 w W, no items are available
• V[0, w] = -, w < 0, invalid
• V[i, 0] = 0, 0 i n, no capacity available
Recursion:
V[i, w] = max(V[i-1, w], vi + V[i-1, w - wi])
for 1 i n, 0 w W

Proof of Correctness
Correctness of Model
Prove that: V[i, w] = max(V[i-1, w], vi + V[i-1, w - wi])
for 1 i n, 0 w W
Proof:
To compute V[i, w], we have only two choices for i
1. Do not Select Item i
Items left = {1,2,. . . , i - 1} and
storage limit = w, hence
Max. value, selected from {1,2, …,i} = V[i-1,w], (1)

2. Select Item i (possible if wi w)


• In this way, we gain value vi but use capacity wi
• Items left = {1,2,. . . , i-1}, storage limit = w - wi,
• Max. value, from items {1,2, …,i-1} = V[i-1,w – wi]
• Total value if we select item i = vi + V[i-1,w – wi]
• Finally, the solution will be optimal if we take the maximum of
V[i-1,w] and
vi + V[i-1,w – wi]
• Hence V[i, w] = max(V[i-1,w], vi + V[i-1,w – wi]

Problem: Developing Algorithm for Knapsack

• V[1, 1] = 0,
• V[1, 2] = 0 I 1 2 3 4
• V[1, 3] = 0, vi 10 40 30 50
• V[1, 4] = 0 Wj 5 4 6 3
• V[i, j] = max(V[i-1, j], vi + V[i-1, j – wi]);
• V[1, 5] = max(V[0, 5], v1 + V[0, 5 – w1]); Capacity = 10
= max(V[0, 5], 10 + V[0, 5 - 5])
= max(V[0, 5], 10 + V[0, 0]) Keep(1, 5) = 1
= max(0, 10 + 0) = max(0, 10)
= 10

Dr. Nazir Ahmad Zafar | Virtual University of Pakistan


137 CS-702 Advanced Algorithms Analysis and Design

I 1 2 3 4
vi 10 40 30 50
Wj 5 4 6 3

• V[i, j] = max(V[i-1, j], vi + V[i-1, j – wi]);


• V[1, 6] = max(V[0, 6], v1 + V[0, 6 – w1]);
= max(V[0, 6], 10 + V[0, 6 - 5])
= max(V[0, 6], 10 + V[0, 1])
= max(0, 10 + 0) = max(0, 10) = 10,
Keep(1, 6) = 1

• V[1, 7] = max(V[0, 7], v1 + V[0, 7 – w1]);


= max(V[0, 7], 10 + V[0, 7 - 5])
= max(V[0, 7], 10 + V[0, 2])
= max(0, 10 + 0) = max(0, 10) = 10
Keep(1, 7) = 1

• V[1, 8] = max(V[0, 8], v1 + V[0, 8 – w1]);


= max(V[0, 8], 10 + V[0, 8 - 5])
= max(V[0, 8], 10 + V[0, 3])
= max(0, 10 + 0) = max(0, 10) = 10
Keep(1, 8) = 1

• V[1, 9] = max(V[0, 9], v1 + V[0, 9 – w1]);


= max(V[0, 9], 10 + V[0, 9 - 5])
= max(V[0, 7], 10 + V[0, 4])
= max(0, 10 + 0) = max(0, 10) = 10
Keep(1, 9) = 1

• V[1, 10] = max(V[0, 10], v1 + V[0, 10 – w1]);


= max(V[0, 10], 10 + V[0, 10 - 5])
= max(V[0, 10], 10 + V[0, 5])
= max(0, 10 + 0) = max(0, 10) = 10
Keep(1, 10) = 1;

• V[2, 1] = 0;
• V[2, 2] = 0;
• V[2, 3] = 0;

• V[2, 4] = max(V[1, 4], v2 + V[1, 4 – w2]);


= max(V[1, 4], 40 + V[1, 4 - 4])
= max(V[1, 4], 40 + V[1, 0])
= max(0, 40 + 0) = max(0, 40) = 40
Keep(2, 4) = 1

Dr. Nazir Ahmad Zafar | Virtual University of Pakistan


138 CS-702 Advanced Algorithms Analysis and Design

I 1 2 3 4
vi 10 40 30 50
Wj 5 4 6 3

• V[i, j] = max(V[i-1, j], vi + V[i-1, j – wi]);


• V[2, 5] = max(V[1, 5], v2 + V[1, 5 – w2]);
= max(V[1, 5], 40 + V[1, 5 - 4])
= max(V[1, 5], 40 + V[1, 1])
= max(10, 40 + 0) = max(0, 40) = 40
Keep(2, 5) = 1

• V[2, 6] = max(V[1, 6], v2 + V[1, 6 – w2]);


= max(V[1, 6], 40 + V[1, 6 - 4])
= max(V[1, 6], 40 + V[1, 2])
= max(10, 40 + 0) = max(10, 40) = 40

• V[2, 7] = max(V[1, 7], v2 + V[1, 7 – w2]);


= max(V[1, 7], 40 + V[1, 7 - 4])
= max(V[1, 7], 40 + V[1, 2])
= max(10, 40 + 0) = max(10, 40) = 40

• V[2, 8] = max(V[1, 8], v2 + V[1, 8 – w2]);


= max(V[1, 8], 40 + V[1, 8 - 4])
= max(V[1, 8], 40 + V[1, 4])
= max(10, 40 + 0) = max(10, 40) = 40

• V[2, 9] = max(V[1, 9], v2 + V[1, 9 – w2]);


= max(V[1, 9], 40 + V[1, 9 - 4])
= max(V[1, 9], 40 + V[1, 5])
= max(10, 40 + 10) = max(10, 50) = 50

• V[2, 10] = max(V[1, 10], v2 + V[1, 10 – w2]);


= max(V[1, 10], 40 + V[1, 10 - 4])
= max(V[1, 10], 40 + V[1, 6])
= max(10, 40 + 10) = max(10, 50) = 50
• V[3, 1] = 0;
• V[3, 2] = 0;
• V[3, 3] = 0;
• V[i, j] = max(V[i-1, j], vi + V[i-1, j – wi]);
• V[3, 4] = max(V[2, 4], v3 + V[2, 4 – w3]);
= max(V[2, 4], 30 + V[2, 4 - 6])
= max(V[2, 4], 30 + V[2, -2]) = V[2, 4] = 40

Dr. Nazir Ahmad Zafar | Virtual University of Pakistan


139 CS-702 Advanced Algorithms Analysis and Design

I 1 2 3 4
vi 10 40 30 50
Wj 5 4 6 3

• V[i, j] = max(V[i-1, j], vi + V[i-1, j – wi]);


• V[3, 5] = max(V[2, 5], v3 + V[2, 5 – w2]);
= max(V[2, 5], 30 + V[2, 5 - 6])
= max(V[2, 5], 30 + V[2, -1])
= V[2, 5] = 40

• V[i, j] = max(V[i-1, j], vi + V[i-1, j – wi]);


• V[3, 6] = max(V[2, 6], v3 + V[2, 6 – w3]);
= max(V[2, 6], 30 + V[2, 6 - 6])
= max(V[2, 6], 30 + V[2, 0])
= max(V[2, 6], 30 + V[2, 0])
= max(40, 30) = 40

• V[3, 7] = max(V[2, 7], v3 + V[2, 7 – w3]);


= max(V[2, 7], 30 + V[2, 7 - 6])
= max(V[2, 7], 30 + V[2, 1])
= max(V[2, 7], 30 + V[2, 1])
= max(40, 30) = 40

• V[3, 8] = max(V[2, 8], v3 + V[2, 8 – w3]);


= max(V[2, 8], 30 + V[2, 8 - 6])
= max(V[2, 8], 30 + V[2, 2])
= max(V[2, 8], 30 + V[2, 2])
= max(40, 30 + 0) = 40

• V[3, 9] = max(V[2, 9], v3 + V[2, 9 – w3]);


= max(V[2, 9], 30 + V[2, 9 - 6])
= max(V[2, 9], 30 + V[2, 3])
= max(V[2, 9], 30 + V[2, 3])
= max(50, 30 + 0) = 50

• V[3, 10] = max(V[2, 10], v3 + V[2, 10 – w3]);


= max(V[2, 10], 30 + V[2, 10 - 6])
= max(V[2, 10], 30 + V[2, 4])
= max(V[2, 10], 30 + V[2, 4])
= max(50, 30 + 40) = 70

Dr. Nazir Ahmad Zafar | Virtual University of Pakistan


140 CS-702 Advanced Algorithms Analysis and Design

I 1 2 3 4
vi 10 40 30 50
Wj 5 4 6 3

• V[4, 1] = 0;
• V[4, 2] = 0;
• V[i, j] = max(V[i-1, j], vi + V[i-1, j – wi]);
• V[4, 3] = max(V[3, 3], v4 + V[3, 3 – w4]);
= max(V[3, 3], 50 + V[3, 3 - 3])
= max(V[3, 3], 50 + V[3, 3 - 3])
= max(V[3, 3], 50 + V[3, 0]) = max(0, 50) = 50

• V[4, 4] = max(V[3, 4], v4 + V[3, 4 – w4]);


= max(V[3, 4], 50 + V[3, 4 - 3])
= max(V[3, 4], 50 + V[3, 4 - 3])
= max(V[3, 4], 50 + V[3, 1])
= max(40, 50) = 50

• V[4, 5] = max(V[3, 5], v4 + V[3, 5 – w4]);


= max(V[3, 5], 50 + V[3, 5 - 3])
= max(V[3, 5], 50 + V[3, 5 - 3])
= max(V[3, 5], 50 + V[3, 2])
= max(40, 50) = 50

• V[4, 6] = max(V[3, 6], v4 + V[3, 6 – w4]);


= max(V[3, 6], 50 + V[3, 6 - 3])
= max(V[3, 6], 50 + V[3, 6 - 3])
= max(V[3, 6], 50 + V[3, 3])
= max(40, 50) = 50

• V[4, 7] = max(V[3, 7], v4 + V[3, 7 – w4]);


= max(V[3, 7], 50 + V[3, 7 - 3])
= max(V[3, 7], 50 + V[3, 7 - 3])
= max(V[3, 7], 50 + V[3, 4])
= max(40, 50 + 40) = 90

• V[4, 8] = max(V[3, 8], v4 + V[3, 8 – w4]);


= max(V[3, 8], 50 + V[3, 8 - 3])
= max(V[3, 8], 50 + V[3, 8 - 3])
= max(V[3, 8], 50 + V[3, 5])
= max(40, 50 + 40) = 90

Dr. Nazir Ahmad Zafar | Virtual University of Pakistan


141 CS-702 Advanced Algorithms Analysis and Design

i 1 2 3 4
vi 10 40 30 50
wj 5 4 6 3

• V[i, j] = max(V[i-1, j], vi + V[i-1, j – wi]);


• V[4, 9] = max(V[3, 9], v4 + V[3, 9 – w4]);
= max(V[3, 9], 50 + V[3, 9 - 3])
= max(V[3, 9], 50 + V[3, 9 - 3])
= max(V[3, 9], 50 + V[3, 6])
= max(50, 50 + 40) = 90

• V[4, 10] = max(V[3, 10], v4 + V[3, 10 – w4]);


= max(V[3, 10], 50 + V[3, 10 - 3])
= max(V[3, 10], 50 + V[3, 10 - 3])
= max(V[3, 10], 50 + V[3, 7])
= max(70, 50 + 40) = 90; Keep(4, 10) = 1

Dr. Nazir Ahmad Zafar | Virtual University of Pakistan


142 CS-702 Advanced Algorithms Analysis and Design

Lecture No. 20
0-1 Knapsack Problem’s Algorithm
(using Dynamic Programming) &
Optimal Weight Triangulation

Today Covered
• 0-1 knapsack problem
– Algorithm
– Generalizations and variations of the Problem
• Optimal Weight Triangulation
– Definitions
– Problem Analysis
– Dynamic Solution
– Algorithm using Dynamic Programming
– Time Complexity
• Conclusion

Optimal Value: Entire Solution

Let W = 10 I 1 2 3 4
Final Solution: V[4, 10] = 90 vi 10 40 30 50
Items selected = {2, 4) Wj 5 4 6 3

V[i,w] W=0 1 2 3 4 5 6 7 8 9 10
i=0 0 0 0 0 0 0 0 0 0 0 0
i=1 0 0 0 0 0 10 10 10 10 10 10
i=2 0 0 0 0 40 40 40 40 40 50 50
i=3 0 0 0 0 40 40 40 40 40 50 70
i=4 0 0 0 50 50 50 50 90 90 90 90

Constructing Optimal Solution

• V[i, j] = max(V[i-1, j], vi + V[i-1, j – wi]);

• i=4 V[4, 10] = max(70, 50 + 40) = 90; Keep(4, 10) = 1


• i=3 V[3, 10 - 3] = V[3, 7] = max(40, 30) = 40 Keep(3, 7) = 0
• i=2 V[2, 7] = max(10, 40) = 40 Keep(2, 7) = 1
• i=1 V[1, 7-4] = V[1, 3] = 0 Keep(1, 3) = 0

Dr. Nazir Ahmad Zafar | Virtual University of Pakistan


143 CS-702 Advanced Algorithms Analysis and Design

Algorithm: Dynamic Programming

KnapSack (v, w, n, W)
for (i = 1 to n), V[i, 0] = 0;
for (j = 0 to W), V[0, j] = 0;
for (i = 1 to n)
for (j = 1 to W)
if (w(i) j)
V[i, j] = max(V[i-1, j], vi + V[i-1, j – wi]);
else
V[i, j] = V[i-1, j];
Return V[n, W]
Time Complexity O(n.W)

Output Elements: Knapsack Algorithm


How do we use all values keep[i, w], to determine a subset S of items having the maximum
value?
• If keep[n, w] is 1, then n  S, and we can repeat for keep[n-1, W - wn]
• If keep[n, w] is 0, then n ↗ S and we can repeat for keep[n-1, W]
• Following is a partial program for this output elements
K = W;
for (i = n down to 1)
if keep[i, K] = = 1
output i
K = K – wi

Complete: Dynamic Programming Algorithm


KnapSack(v, w, n, W)
for (w = 0 to W), V[0, w] = 0; for (i = 1 to n), V[i, 0] = 0;
for (i = 1 to n)
for (w = 1 to W)
if ((w(i) w) and (vi + V[i-1,w – wi] > V[i-1,w]))
V[i, w] = (vi + V[i-1,w – wi];
keep[i, w] = 1;
else
V[i, w] = V[i-1,w];
keep[i, w] = 0;
K = W;
for (i = n down to 1)
if keep[i, K] = = 1
output i
K = K – wi
Return V[n, W]

Dr. Nazir Ahmad Zafar | Virtual University of Pakistan


144 CS-702 Advanced Algorithms Analysis and Design

1. Generalizations (xi  {0, 1})


• Common to all versions are a set of n items, with each item 1 ≤ j ≤ n having an
associated profit pj and weight wj.
• The objective is to pick some of the items, with maximal total profit, obeying that
maximum total weight limit W.
• Generally, coefficients are scaled to become integers, and they are almost always
assumed to be positive.
• The knapsack problem in its most basic form:
n n
• Maximize  pi xi subject to  wi xi  W
i 1 i 1

• xi  {0, 1},  1 ≤ i ≤ n

2. Specialization (weight = profit)


• If for each item the profit and weight are identical, we get the subset sum problem
• Often called the decision problem
n n
• Maximize  pi xi subject to  pi xi  W
i 1 i 1

• xi  {0, 1},  1 ≤ i ≤ n

3. Generalizations (more than one objects)


• If each item can be chosen multiple times, we get the bounded knapsack problem.
• Suppose, weight of each item is at least 1 unit, then we can never choose an item more
than W times.
• This is another variation in the basic form
• Now the problem will become
n n
• Maximize  pi xi subject to  wi xi  W
i 1 i 1

• xi  {0, 1, . . ., W},  1 ≤ i ≤ n

4. Generalizations (K Classes)
• If the items are subdivided into k classes denoted Ni
• And exactly one item must be taken from each class
• We get the multiple choice knapsack problem
• In this case our optimized mathematical model is
k
• Maximize   pij xij
i 1 jNi

n
• subject to   wij xij  W where  x ij  1
i 1 jNi jNi

• 1≤i≤k
• xij  {0, 1},  1 ≤ i ≤ k, j  Ni

Dr. Nazir Ahmad Zafar | Virtual University of Pakistan


145 CS-702 Advanced Algorithms Analysis and Design

5. Generalizations (more than one knapsacks)


• If there are n items, m knapsacks with capacities W i
• We get the multiple knapsack problem
m n
• Maximize   p j xij
i 1 j 1

n
• subject to  wj xij  Wi 1 i  m
j 1

m
•  x ij  1 1 i  n 1≤j≤n
i1

• xij  {0, 1}, 1 ≤ i ≤ m and 1 ≤ j ≤ n

6. Item’s Different Weight in Different Knapsack


• If in the multiple knapsack problem, the weights are not the same in every container
• We are allowed to choose each item multiple times, we get multiple constrained
knapsack problem
n
• Maximize  p j x j
j 1

n
• subject to  wij x j  Wi 1 i  m
j 1

• x j  0, xj  Z

Optimal Weight Triangulation

Why Polygon Triangulation?


• Finite element method is a technique for solving numerical problems e.g. stress or heat
flow simulations of any kind of systems
• It involves dividing a shape into simple elements for example triangles
• Then formulating a set of linear equations describing relations between simulated
quantities in each element, and solving these equations.
• The time and accuracy both, in solution, depend on the quality of dividing into triangles
• Generally, it is desired that triangles must be as close to equilateral as possible

Similarity: Optimal Polygon Triangulation, other Problem


• Optimal triangulation problem is very similar to matrix chain multiplication
• It is an excellent approach to make one to one corresponding between two problems
and
• Then solving one problem based on the approach already used in the solution of the
other problem
• This is what we are going to do in solving an optimal solution of the triangulation problem
which is very popular in computational geometry
• Applications of this problem can be observed in many other areas where division of
structures is required before performing computation over it.

Dr. Nazir Ahmad Zafar | Virtual University of Pakistan


146 CS-702 Advanced Algorithms Analysis and Design

Basic Concepts
• Polygon: A set of finite piecewise-linear, closed curve in a plane is called a polygon
• Sides: The pieces of the polygon are called its sides
• Vertex: A point joining two consecutive sides is called a vertex
• Interior: Set of points in plane enclosed by a simple polygon forms interior of the polygon
• Boundary: The set of point on the polygon forms its boundary
• Exterior: The set of points surrounding the polygon form its exterior
• Simple Polygon: A polygon is simple if it does not cross itself, i.e., if its sides do not
intersect one another except for two consecutive sides sharing a common vertex.
• Subdivision of Polygon: A simple polygon subdivides the plane into its interior, its
boundary and it‟s exterior.
• Convex Polygon: A simple polygon is convex if given any two points on its boundary or
in its interior all points on the line segment drawn between them are contained in the
polygon‟s boundary or interior.

Polygons

Labeling Convex Polygons


• For a convex polygon, it is assumed
that its vertices are labeled in
counterclockwise order
P  v0 ,v1,v2 ,...,vn1 .
• We assume that indexing is done
modulo n, so v0  vn and the above
polygon P has n number of vertices

Dr. Nazir Ahmad Zafar | Virtual University of Pakistan


147 CS-702 Advanced Algorithms Analysis and Design

Chords in Polygons
• Given two non-adjacent vertices vi,vj of a convex polygon (i < j), the line segment vivj is
called a chord
• For two non-adjacent vertices vi and vj of a simple polygon (i < j), line segment vivj is a
chord if interior of the segment lies entirely in the interior of polygon
• Any chord subdivides a polygon into two polygons

Optimal Weight Triangulation Problem


• A triangulation of a convex polygon is a maximal set T of pair-wise non-crossing chords,
i.e., every chord not in T intersects the interior of some chord in T
• It is easy to see that such a set subdivides interior of polygon into a collection of
triangles, pair-wise disjoint

Problem Statement: Given a convex polygon, determine a triangulation that minimizes sum of
the perimeters of its triangles

Analysis
• Given three distinct vertices, vi, vj and vk.
• Define a weight of associated triangle by a function w(vi, vj, vk) = |vi vj | + |vj vk | + |vk vi |,
• where |vi vj | denotes length of line segment (vi, vj).

Brute Force Triangulation: Triangulation


• In general, given a convex polygon, there are exponential number of possible
triangulations.
• There are many criteria that are used depending on application. For example, you have
to minimize the value of cable in designing such triangulation
• This suggests the optimal solution to this problem

Dr. Nazir Ahmad Zafar | Virtual University of Pakistan


148 CS-702 Advanced Algorithms Analysis and Design

Dual Graphs
• Dual graph of a triangulation is a graph whose vertices are the triangles, and in which
two vertices are adjacent if the corresponding both triangles share a common chord
• It is to be noted that dual graph is a tree. And hence algorithms for traversing trees can
be used for traversing the triangles of that triangulation

Observations in Dual Graph


• Each internal node corresponds to
one triangle
• Each edge between internal nodes
corresponds to one chord of
triangulation.
• Now for given n-vertex polygon
• n-2 internal nodes which are
in fact triangles and
• n-3 edges which are chords

Lemma 1
• A triangulation of a simple polygon, with n vertices, has n-2 number of triangles.

Proof:
Proof is done using mathematical induction

Basis Step
• Suppose that there three vertices, polygon will be a triangle, i.e. there are 3 - 2 = 1
number of triangles
• Hence statement is true for n = 3
• If there are 4 vertices, polygon will be in fact a rectangle, divide it into two triangles. The
result is true. Hence statement is true for n = 4

Dr. Nazir Ahmad Zafar | Virtual University of Pakistan


149 CS-702 Advanced Algorithms Analysis and Design

Inductive Hypothesis
• Let us suppose that statement is true for n = k, i.e., if there are k vertices then there are
k-2 number of triangles

Claim
• Now we have to prove that if there are k+1 vertices there must be k+1-2 = k-1, number
of triangles.
• Since for k vertices there are k-2 triangles. Insert one more point at boundary of polygon
• In fact point will be inserted at boundary of one of the triangles. So the triangle will
become rectangle. Divide it into two triangles. It will increase one more triangle in the
division. Hence it becomes; k – 2 + 1 = k - 1, number of triangles.
• It proves the claim. Hence by mathematical induction it proves that for n number of
vertices there are n - 2 number of triangles.

Lemma 2
• A triangulation of a simple polygon, with n vertices, has n-3 chords.

Proof
• Proof not difficult, and it can be proved following the steps of proof in lemma 1.
• If there are three points, it will be triangle. To make a chord in a polygon, it requires at
least four points.
• So you have to give proof for n ≥ 4.

Basis Step
• Suppose that there are four number of vertices, in this case polygon will be a rectangle,
there must be 4 - 3 = 1 number of chords
• Hence statement is true for n = 4

Inductive Hypothesis
• Let us suppose that the statement is true for n = k, i.e., if there are k vertices then there
are k - 3 number of chords of the polygon

Claim
• Now we have to prove that if there are k+1 vertices there must be k+1-3 = k-2, number
of chords.
• Since for k vertices there are k-3 chords. Insert one more point at boundary of polygon
• In fact point will be inserted at boundary of one of the triangles. So the triangle will
become rectangle. Divide it into two triangles. It will increase one more chord in the
division. Hence it becomes; k – 3 + 1 = k - 2, number of chords. Proved.

Dr. Nazir Ahmad Zafar | Virtual University of Pakistan


150 CS-702 Advanced Algorithms Analysis and Design

Correspondence to Binary Trees


• Relationship between optimal triangulation and chain matrix multiplication problem

• In chain matrix multiplication, associated binary tree is the evaluation tree for the
multiplication, where the leaves of the tree correspond to the matrices, and each node of
the tree is associated with a product of a sequence of two or more matrices.
• Now let us consider an (n+1) sided convex polygon, P = <v0, v1, . . ,vn> and fix one side
of it as (v0 ,vn)
• Consider a rooted binary tree whose:
– root node = is the triangle containing side (v0 ,vn),
– internal nodes = are nodes of the dual tree, and
– leaves = are remaining sides of the tree.
• This partitioning of polygon is equivalent to a binary tree with n-1 leaves, and vice versa.

Dynamic Programming Solution


• Let t[i, j] = minimum weight triangulation for the sub-polygon <vi-1, vi ,…, vj>,
for 1  i  j  n
• We have start with vi-1 rather than vi, to keep the structure as similar as matrix chain
multiplication
• It is to be noted that if we can compute t[i, j] for all i and j (1  i  j  n), then the weight
of minimum weight triangulation of the entire polygon will be t[1, n]. Hence it is our
objective function.
• For the base case
t[i, i] = 0, for line (vi-1, vi).

Dr. Nazir Ahmad Zafar | Virtual University of Pakistan


151 CS-702 Advanced Algorithms Analysis and Design

Optimal Substructure
• t[i, j] = weight of an optimal
triangulation of polygon <vi-
1,vi,…,vj>.
• t[i, j] = mink { t[i, k] + t[k+1, j] + w(∆vi-1
vk vj) }, i < j
• t[i, i] = 0
• i  k  j-1
• In general, to compute t[i, j],
consider the sub-polygon <vi-1, vi ,…,
vj>, where i  j.

• One of the chords of this polygon is the side (vi-1, vj).


• We may split this sub-polygon by introducing a triangle whose base is this chord, and
whose third vertex is any vertex vk, where i  k  j-1.
• This subdivides the polygon into 2 sub-polygons <vi-1,...vk> and <vk+1,... vj>, whose
minimum weights are t[i, k] and t[k+1, j].
• It leads to following recursive rule computing t[i, j]
– t[i, i] = 0
– t[i, j] = mini  k  j-1 (t[i, k] + t[k+1, j] + w(vi-1vkvj )) for i < j

Algorithm
t[i, j] = mini < k < j (t[i, k] + t[k, j] + w(vi vj vk)) if i < j;
t[i, j] = 0 if i = j.

function min_weight_tri(p[ ], n) T[1,1] T[1,2] ……… T[1,n]


1. for i ≡ 1 to n do T[2,2] ……… T[2,n]
2. t[i, i] ≡ 0; ……… ………
3. for l ≡ 2 to n do T[n,n]
4. for i ≡ 1 to n – l+1 do
5. j ≡ i + l-1; Computational Cost
n n n ni
6. t[i, j] ≡ ∞; T (n)  n    ( j  i)   k
i 1 j i 1 i 1 k 1
7. for k ≡ i to j - 1 do
8. q ≡ t[i, k] + t[k+1, j] + w(vi vj vk);
n (n  i)(n  i  1)
T ( n)  n  
9. if (q < t[i, j]) then i 1 2
10. t[i, j] ≡ min(t[i, j], q); 1 n 1 n
T (n)  n   (n 2  n  1)   ((1  2n)i  i 2 )
11. v[i, j] ≡ k; 2 i1 2 i1
12. return( t(1, n) ); 1 n 1 n 1 n
 n  (n 2  n  1)1  (1  2n) i   i 2
2 i 1 2 i 1 2 i1
 ( n )
3

Dr. Nazir Ahmad Zafar | Virtual University of Pakistan


152 CS-702 Advanced Algorithms Analysis and Design

Lecture No. 21
Optimal Weight Triangulation

Observations in Dual Graph


• Each internal node corresponds to
one triangle
• Each edge between internal nodes
corresponds to one chord of
triangulation.
• Now for given n-vertex polygon
• n-2 internal nodes which are
in fact triangles and
• n-3 edges which are chords

Proof of Lemmas:

Lemma 1:
• A triangulation of a simple polygon, with n vertices, has n-2 number of triangles.
Proof
• Proof is done using mathematical induction

Basis Step
• Suppose that there three vertices, polygon will be a triangle, i.e. there are 3 - 2 = 1
number of triangles
• Hence statement is true for n = 3
• If there are 4 vertices, polygon will be in fact a rectangle, divide it into two triangles. The
result is true. Hence statement is true for n = 4

Inductive Hypothesis
• Let us suppose that statement is true for n = k, i.e., if there are k vertices then there are
k-2 number of triangles

Claim
• Now we have to prove that if there are k+1 vertices there must be k+1-2 = k-1, number
of triangles.
• Since for k vertices there are k-2 triangles. Insert one more point at boundary of polygon
• In fact point will be inserted at boundary of one of the triangles. So the triangle will
become rectangle. Divide it into two triangles. It will increase one more triangle in the
division. Hence it becomes; k – 2 + 1 = k - 1, number of triangles.
• It proves the claim. Hence by mathematical induction it proves that for n number of
vertices there are n - 2 number of triangles.

Dr. Nazir Ahmad Zafar | Virtual University of Pakistan


153 CS-702 Advanced Algorithms Analysis and Design

Lemma 2
• A triangulation of a simple polygon, with n vertices, has n-3 chords.

Proof
• Proof not difficult and it can be proved following the steps of proof in lemma 1.
• If there are three points, it will be triangle. To make a chord in a polygon, it requires at
least four points.
• So you have to give proof for n ≥ 4.

Basis Step
• Suppose that there are four number of vertices, in this case polygon will be a rectangle,
there must be 4 - 3 = 1 number of chords
• Hence statement is true for n = 4

Inductive Hypothesis
• Let us suppose that the statement is true for n = k, i.e., if there are k vertices then there
are k - 3 number of chords of the polygon
Claim
• Now we have to prove that if there are k+1 vertices there must be k+1-3 = k-2, number
of chords.
• Since for k vertices there are k-3 chords. Insert one more point at boundary of polygon
• In fact point will be inserted at boundary of one of the triangles. So the triangle will
become rectangle. Divide it into two triangles. It will increase one more chord in the
division. Hence it becomes; k – 3 + 1 = k - 2, number of chords. Proved.

Correspondence to Binary Trees


Relationship between optimal triangulation and chain matrix multiplication problem

• In chain matrix multiplication, associated binary tree is the evaluation tree for the
multiplication, where the leaves of the tree correspond to the matrices, and each node of
the tree is associated with a product of a sequence of two or more matrices.
• Now let us consider an (n+1) sided convex polygon, P = <v0, v1, . . ,vn> and fix one side
of it as (v0 ,vn)

Dr. Nazir Ahmad Zafar | Virtual University of Pakistan


154 CS-702 Advanced Algorithms Analysis and Design

• Consider a rooted binary tree whose:


– root node = is the triangle containing side (v0 ,vn),
– internal nodes = are nodes of the dual tree, and
– leaves = are remaining sides of the tree.

• This partitioning of polygon is equivalent to a binary tree with n-1 leaves, and vice versa.

Dynamic Programming Solution


• Let t[i, j] = minimum weight triangulation for the sub-polygon <vi-1, vi ,…, vj>,
for 1  i  j  n
• We have start with vi-1 rather than vi, to keep the structure as similar as matrix chain
multiplication
• It is to be noted that if we can compute t[i, j] for all i and j (1  i  j  n), then the weight
of minimum weight triangulation of the entire polygon will be t[1, n]. Hence it is our
objective function.
• For the base case t[i, i] = 0, for line (vi-1, vi).

Optimal Substructure
• t[i, j] = weight of an optimal
triangulation of polygon
<vi-1,vi,…,vj>.

• t[i, j] = mink { t[i, k] + t[k+1, j]


+ w(∆vi-1 vk vj) }, i < j
• t[i, i] = 0
• i  k  j-1
• In general, to compute t[i, j],
consider the sub-polygon
<vi-1, vi ,…, vj>, where i  j.

• One of the chords of this polygon is


the side (vi-1, vj).

• We may split this sub-polygon by introducing a triangle whose base is this chord, and
whose third vertex is any vertex vk, where i  k  j-1.

• This subdivides the polygon into 2 sub-polygons <vi-1,...vk> and <vk+1,... vj>, whose
minimum weights are t[i, k] and t[k+1, j].
• It leads to following recursive rule computing t[i, j]
• t[i, i] = 0
• t[i, j] = mini  k  j-1 (t[i, k] + t[k+1, j] + w(vi-1vkvj )) for i < j

Dr. Nazir Ahmad Zafar | Virtual University of Pakistan


155 CS-702 Advanced Algorithms Analysis and Design

Algorithm
t[i, j] = mini < k < j (t[i, k] + t[k, j] + w(vi vj vk)) if i < j;
t[i, j] = 0 if i = j.

function min_weight_tri(p[ ], n) T[1,1] T[1,2] ……… T[1,n]


1. for i ≡ 1 to n do T[2,2] ……… T[2,n]
2. t[i, i] ≡ 0; ……… ………
3. for l ≡ 2 to n do T[n,n]
4. for i ≡ 1 to n – l+1 do
5. j ≡ i + l-1; Computational Cost
n n n ni
6. t[i, j] ≡ ∞; T (n)  n    ( j  i)   k
i 1 j i 1 i 1 k 1
7. for k ≡ i to j - 1 do
8. q ≡ t[i, k] + t[k+1, j] + w(vi vj vk);
n(n  i)(n  i  1)
T ( n)  n  
9. if (q < t[i, j]) then i 1 2
10. t[i, j] ≡ min(t[i, j], q); 1 n 2 1 n
T (n)  n   (n  n  1)   ((1  2n)i  i 2 )
11. v[i, j] ≡ k; 2 i1 2 i1
12. return( t(1, n) ); 1 n 1 n 1 n
 n  (n 2  n  1)1  (1  2n) i   i 2
2 i 1 2 i 1 2 i1
 ( n )
3

Longest Common Subsequence Problem


An Introduction
• In biological applications, we often want to compare the DNA of two (or more) different
organisms.
• A part of DNA consists of a string of molecules called bases, where the possible bases
are
– adenine,
– guanine,
– cytosine, and
– thymine.
• Represent each of the bases by their initial letters
• A part of DNA can be expressed as a string over the finite set {A, C, G, T}.
• For example, the DNA of one organism may be
S1= CCGGTCGAGTGCGCGGAAGCCGGCCGAA,
• While the DNA of another organism may be
S2 = GTCGTTCGGAATGCCGTTGCTCTGTAAA.
• One goal of comparing two parts of DNA is to determine how “similar” two parts are, OR
• Measure of how closely related two organisms are.
• As we know that similarity is an ambiguous term and can be defined in many different
ways.
• Here we give some ways of defining it with reference to this problem.

Dr. Nazir Ahmad Zafar | Virtual University of Pakistan


156 CS-702 Advanced Algorithms Analysis and Design

An Introduction: Similarity
• For example, we can say that two DNA parts are similar if one is a substring of the other.
In our case, neither S1 nor S2 is a substring of the other. This will be discussed in string
matching.
• Alternatively, we could say two parts are similar if changes needed to turn one to other is
small.
• Another way to measure similarity is by finding third part S3 in which bases in S3 appear
in both S1, S2
• Bases must preserve order, may not consecutively.
• Longer S3 we can find, more similar S1 and S2 are.
• In above, S3 is GTCGTCGGAAGCCGGCCGAA

What is a Subsequence?
• In mathematics, a subsequence of some sequence is a new sequence which is formed
from original one by deleting some elements without disturbing the relative positions of
the remaining elements.

Examples:
• < B,C,D,B > is a subsequence of < A,C,B,D,E,G,C,E,D,B,G > , with corresponding index
sequence <3,7,9,10>.
• < D, E, E, B > is also a subsequence of the same < A,C,B,D,E,G,C,E,D,B,G > , with
corresponding index sequence <4,5,8,10>.

Longest Common Subsequence


• The sequence Z = (B, C, A) is a subsequence of
X = (A, B, C, B, D, A, B).
• The sequence Z = (B, C, A) is also a subsequence of
Y = (B, D, C, A, B, A).
• Of course, it is a common subsequence of X and Y.
• But the above sequence is not a longest common subsequence
• This is because the sequence Z‟ = (B, D, A, B) is a longer subsequence of
X = (A, B, C, B, D, A, B) and Y = (B, D, C, A, B, A)

Problem
Statement:
• In the longest-common-subsequence (LCS) problem, we are given two sequences
X = <x1, x2, . . . , xm> and
Y = <y1, y2, . . . , yn>
• And our objective is to find a maximum-length common subsequence of X and Y.
Note:
• This LCS problem can be solved using brute force approach as well but using dynamic
programming it will be solved more efficiently.

Dr. Nazir Ahmad Zafar | Virtual University of Pakistan


157 CS-702 Advanced Algorithms Analysis and Design

Brute Force Approach


• First we enumerate all the subsequences of X = <x1, x2, . . . , xm>.
• There will be 2m such subsequences.
• Then we check if a subsequence of X is also a subsequence of Y.
• In this way, we can compute all the common subsequences of X and Y.
• Certainly, this approach requires exponential time, making it impractical for long
sequences.
Note:
• Because this problem has an optimal sub-structure property, and hence can be solved
using approach of dynamic programming

Dynamic Programming Solution

Towards Optimal Substructure of LCS: Prefixes


• As we shall see, the natural classes of sub-problems correspond to pairs of “prefixes” of
the two input sequences.
• To be precise, given a sequence X = <x1, x2, ..., xm>, we define the ith prefix of X, for i =
0, 1, ..., m, as Xi = <x1, x2, ..., xi>.

Examples,
If X = <A, B, C, B, D, A, B> then
• X4 = <A, B, C, B> and
• X0 is the empty sequence = < >

Theorem:
• If X = (x1, x2,. . ., xm), and Y = (y1, y2, . . ., yn) be sequences and let us suppose that Z =
(z1, z2, . . ., zk) be a longest common sub-sequence of X and Y
• Let, Xi = (x1, x2, …, xi), Yj = (y1, y2, …, yj) and Zl = (z1, z2, …, zl) are prefixes of X, Y and Z
res.
1. if xm = yn, then zk = xm and Zk – 1 is LCS of Xm – 1, Yn-1.
2. If xm  yn, then zk  xm implies that Z is LCS of Xm – 1 and Y
3. If xm  yn, then zk  yn implies that Z is LCS of X and Yn – 1

Proof of Theorem
Case 1
• On contrary suppose that xm = yn but zk ≠ xm,
• Then we could append xm = yn to Z to obtain a common subsequence of X and Y of
length k + 1, contradicting the supposition that Z is a LCS of X and Y.
• Thus, we must have zk = xm = yn.
• Now, the prefix Zk-1 is a length-(k - 1) common subsequence of Xm-1 and Yn-1.

Dr. Nazir Ahmad Zafar | Virtual University of Pakistan


158 CS-702 Advanced Algorithms Analysis and Design

Now we wish to show that it is an LCS.


• Suppose, there is a common subsequence W of Xm-1 & Yn-1 with length greater than k - 1
• Appending xm = yn to W gives common subsequence of X and Y whose length is greater
than k, a contradiction.

Case 2
• If zk ≠ xm, then Z is a common subsequence of Xm-1 and Y.
• If there were a common subsequence W of Xm-1 and Y with length greater than k, then W
would also be a common subsequence of Xm and Y, contradicting the assumption that Z
is an LCS of X and Y.

Case 3
• The proof is symmetric to (2).

Dr. Nazir Ahmad Zafar | Virtual University of Pakistan


159 CS-702 Advanced Algorithms Analysis and Design

Lecture No. 22
Review Lectures 1-21

Lecture No 1: Model of Computation


• Analysis independent of the variations in
– machine, operating system, language, compiler,
• We did not consider the low-level details
• We supposed our model to be an abstraction of a standard generic single-processor
machine, called a random access machine RAM, an idealized machine
– infinitely large random-access memory,
– instructions execute sequentially
• Every instruction is in fact a basic operation on two values in machine‟s memory which
takes unit time.

Drawbacks in Model of Computation


• We assumed each basic operation takes constant time i.e. adding, multiplying,
comparing etc. of two numbers of any length in constants time
• Addition of two numbers takes a unit time!
– not good because numbers may be arbitrarily
• Addition and multiplication both take unit time!
– Again very bad assumption

Finally what about Our Model?


• But with all these weaknesses, our model is not so bad because we have to give the
comparison not the absolute analysis of any algorithm.

Lecture No 2: Mathematical Tools


A Sequence of Mathematical Tools
• Sets • Relation
• Sequences • Functions
• Order pairs • Operators over above structures
• Cross Product

Lecture No 3: Logic and Proving Techniques


• Propositional Logic
• Predicate Logic
• Proofs using
– Truth Tables
– Logical Equivalences
– Counter Example
– Contradiction
– Rule of Inference

Dr. Nazir Ahmad Zafar | Virtual University of Pakistan


160 CS-702 Advanced Algorithms Analysis and Design

Lecture No 4 & 5: Mathematical Induction


Claim: P(n) is true for all n  Z+, for n  n0
1. Basis
– Show formula is true when n = n0
2. Inductive hypothesis
– Assume formula is true for an arbitrary n = k, where, k  Z+ and k  n0
3. To Prove Claim
– Show that formula is then true for k+1

Note: In fact we have to prove


1) P(n0) and
2) P(k)  P(k+1)

Mathematical Way of Expressing Induction


• Basis step.
Show that proposition P(1) is true.
• Inductive step.
Show that for every positive integer n, the implication P(n)  P(n+1) is true.

P(n) for a fixed n is called inductive hypothesis.


• [P(1)   n, (P(n)  P(n+1))]   n, P(n)

Well Ordering and Modus Ponens Principal

Definition (Well-Ordering Principle)


• The Well-ordering Principle is the following statement
• “every nonempty set of positive integers contains a least element”
• In a mathematical way we can define this Principle as:
there is a in S such that a  b for all b in S i.e.
 a  S, such that a  b,  b  S
• And we say that set S is well-ordered with respect to .
Modus Ponens Principal
pq
p
Hence, q

Why Mathematical Induction is Valid?


• Let‟s suppose that P(1) is true, and that
k (P(k)  P(k+1)) is also true,
• Claim: n P(n) is true
– Assume proposition  n, P(n) is false, i. e, there are some positive integers for
which P(n) false.
– Let S be the set of those n‟s. By well-ordering property, S has a least element,

Dr. Nazir Ahmad Zafar | Virtual University of Pakistan


161 CS-702 Advanced Algorithms Analysis and Design

suppose, k.
– As 1S, so 1< k, so k-1 is a positive
– Since k-1 < k, hence k-1 S. So P(k-1) is true.
– By modus ponens, P((k-1) + 1) = P(k) is true.
– Contradiction, hence n, P(n)

Another Reason for Validity


Basis Step Iterating gives a proof of  n, P(n). This is
First suppose that we have a proof another way of proving validity of
of P(0). mathematical Induction.
Inductive Hypothesis
 k > 0, P(k)  P(k + 1)
How it is proved  n > 0,?
P(0)  P(1)
P(1)  P(2)
P(2)  P(3)
...
Strong Mathematical Induction
• Let P(n) be a predicate defined for integers n, and a and b are fixed integers with a ≤ b.
• Suppose the following statements are true:
1. P(a), P(a + 1), … , P(b) are all true
(basis step)
2. For any integer k > b,
if P(i) is true for all integers i with a ≤ i < k,
then P(k) is true. (inductive step)
• Then P(n) is true for all integers n ≥ a.

Lecture No 6: Fibonacci Sequences


• Start with a pair of rabbits, one male and one female, born on January 1. Assume that all
months are of equal length and that rabbits begin to produce two months after their own
birth. After reaching age of two months, each pair produces another mixed pair, one
male and one female, then another mixed pair each month, and no rabbit dies.
How many pairs of rabbits will there be after one year?
• Construction of Mathematical Model
• Explicit Formula Computing Fibonacci Numbers
• Recursive Algorithms, Generalizations of Rabbits Problem and Constructing its
Mathematical Models
• Applications of Fibonacci Sequences

Lecture 7, 8, & 9: Recursion


• Recursion? Recursive Mathematical Models
• Solving Recurrence Relations
• First and second Order Linear Homogenous Recurrences with Constant Coefficients its

Dr. Nazir Ahmad Zafar | Virtual University of Pakistan


162 CS-702 Advanced Algorithms Analysis and Design

Characteristics and Solution


• General Homogenous Recurrences, Characteristics and solution
• Solution: General Homogenous Recurrence when
– Roots distinct, repeated, multiplicity of root is k
– many roots with different multiplicities
• Non-homogenous Recurrence Relations
• Characteristics and solution of various type of non-homogenous recurrence relations

Lecture 10 & 11: Asymptotic Notations


• Major Factors in Algorithms Design
• Complexity Analysis
• Growth of Functions
• Asymptotic Notations
• Usefulness of Notations
• Reflexivity, Symmetry, Transitivity Relations over , , O,  and o
• Relation between ,  and O
• Various Examples Explaining each concept

Big-Oh Notation (O)


If f, g: N  R+, then we can define Big-Oh as
For a given function g  n   0, denoted by   g  n   the set of functions,
  g  n     f  n  : there exist positive constants c and no such that
0  f  n   cg  n  , for all n  n o 
f  n     g  n   means function g  n  is an asymptotically
upper bound for f  n  .
We may write f(n) = O(g(n)) OR f(n)  O(g(n))
Intuitively: Set of all functions whose rate of growth is the same as or lower than that of g(n).

Big-Omega Notation ()


If f, g: N  R+, then we can define Big-Omega as
For a given function g  n  denote by   g  n   the set of functions,
  g  n     f  n  : there exist positive constants c and no such that
0  cg  n   f  n  for all n  n o 
f  n     g  n   , means that function g  n  is an asymptotically
lower bound for f  n  .
We may write f(n) = (g(n)) OR f(n)  (g(n))
Intuitively: Set of all functions whose rate of growth is the same as or higher than that of g(n).

Dr. Nazir Ahmad Zafar | Virtual University of Pakistan


163 CS-702 Advanced Algorithms Analysis and Design

Theta Notation ()


If f, g: N  R+, then we can define Big-Theta as
For a given function g  n  denoted by   g  n   the set of functions,
  g  n     f  n  : there exist positive constants c1 , c2 and no such that
0  c1 g  n   f  n   c2 g  n  for all n  n o 
f  n     g  n   means function f  n  is equal to g  n  to within a constant
factor, and g  n  is an asymptotically tight bound for f  n  .
We may write f(n) = (g(n)) OR f(n)  (g(n))
Intuitively: Set of all functions that have same rate of growth as g(n).

Relations over Asymptotic Notations


Reflexivity
• All the relations, Q, W, O, are reflexive
• Small o and small omega are not reflexive relations
Symmetry
 Q is symmetric.
• Big O, big omega , little o, and little , do not satisfy the symmetry property.
Transitivity
• All complexity measuring notations Q, W, O,  and o satisfy the transitive property.

Lecture 12 &13: Brute Force Approach


Brute Force Approach,
• Checking primality
• Sorting sequence of numbers
• Knapsack problem
• Closest pair in 2-D, 3-D and n-D
• Finding maximal points in n-D

Lecture 12 &13: Brute Force Approach


Brute Force Approach,
• Checking primality
• Sorting sequence of numbers
• Knapsack problem
• Closest pair in 2-D, 3-D and n-D
• Finding maximal points in n-D

Lecture 14: Divide and Conquer


Divide and Conquer?
• Merge Sort algorithm
• Finding Maxima in 1-D, and 2-D
• Finding Closest Pair in 2-D

Dr. Nazir Ahmad Zafar | Virtual University of Pakistan


164 CS-702 Advanced Algorithms Analysis and Design

Lecture 15 & 16:


Dynamic Programming

• Optimizations problem?
• Steps in Development of Dynamic Algorithms
• Why dynamic in optimization problem?
• Chain-Matrix Multiplication
• Problem Analysis
– Brute Force approach
– Time Complexity
• Chain-Matrix Multiplication
• Using Dynamic
– Notations
– Dynamic Algorithm
– Time Complexity

Chain Matrix Multiplication


Statement: The chain-matrix multiplication problem can be stated as below:
• Given a chain of [A1, A2, . . . , An] of n matrices where for i = 1, 2, . . . , n, matrix Ai has
dimension pi-1 x pi, find the order of multiplication which minimizes the number of scalar
multiplications.
Note:
• Order of A1 is p0 x p1,
• Order of A2 is p1 x p2,
• Order of A3 is p2 x p3, etc.
• Order of A1 x A2 x A3 is p0 x p3,
• Order of A1 x A2 x . . . x An is p0 x pn

Steps in Development of Dynamic Algorithms


1. Characterize the structure of an optimal solution
2. Recursively define the value of an optimal solution
3. Compute the value of an optimal solution in a bottom-up fashion
4. Construct an optimal solution from computed information
Note: Steps 1-3 form the basis of a dynamic programming solution to a problem. Step 4 can be
omitted only if the value of an optimal solution is required.

Lecture 17 & 18: Assembly Line Scheduling


• Assembly Line Scheduling Problem
• Problem Analysis
– Notations, Brute Force and Dynamic Solutions
• Algorithm using Dynamic Programming
• Time Complexity
• n-Line Assembly Problem
• n-Line Assembly Algorithm using Dynamic Programming

Dr. Nazir Ahmad Zafar | Virtual University of Pakistan


165 CS-702 Advanced Algorithms Analysis and Design

• Time Complexity
• Applications
• There are two assembly lines each with n stations
• The jth station on line i is denoted by Si, j
• The assembly time at that station is ai,j.
• An auto enters factory, goes into line i taking time ei
• After going through the jth station on a line i, the auto goes on to the (j+1)st station on
either line
• There is no transfer cost if it stays on the same line
• It takes time ti,j to transfer to other line after station Si,j
• After exiting the nth station on a line, it takes time xi for the completed auto to exit the
factory.
• Problem is to determine which stations to choose from lines 1 and 2 to minimize total
time through the factory.

Lecture 19 & 20: 0-1 Knapsack Problem


• 0-1 Knapsack Problem • Optimal Weight Triangulation
• Problem Analysis – Definitions, Problem Analysis
– Divide and Conquer – Dynamic Solution
– Dynamic Solution – Algorithm using Dynamic
• Algorithm using Dynamic Programming
Programming – Time Complexity
• Time Complexity • Conclusion
• Generalization, Variations and
Applications

Lecture 21: Longest Common Subsequence


• Longest Common sub-sequence problem
• Problem Analysis
– Brute Force approach
– Dynamic Solution
• Algorithm using Dynamic Programming

Dr. Nazir Ahmad Zafar | Virtual University of Pakistan


166 CS-702 Advanced Algorithms Analysis and Design

Mid-Term 2015 Exam Questions


1. Chain Matrix using brute force
2. jn = jn-2 solve the recurrence
3. Given a sequence [A1, A2, A3, A4]
[A1 = 10 x 100], [A2 = 100 x 5], [A3 = 5x 50] [A4 = 50x 20]
Compute the order of the product A1, A2, A3, A4 in such a way that minimizes the total
number of scalar multiplications.
4. Let N be a set of natural numbers. Then <= (equal) is relations over N. Prove or disprove
the < is reflexive, symmetric and transitive
5. Write algorithm to Closest Pair in 2-D using Divide and Conquer
6. Write algorithm to find line assembly scheduling DP pseudo code
7. 0-1 knapsack problem DP pseudo code
8. Write pseudo code of assembly line scheduling
9. Write knapsack for brute force algorithm
10. Write steps for divide and conquer with time complexity
11. Write assembly line dynamic algorithm
12. Use Dynamic Programming to find an optimal solution for the 0-1 Knapsack
problem.
item weight value knapsack capacity W = 11

i 1 2 3 4 5
vi 1 2 5 6 7
wi 1 6 18 22 28

And write algorithm for it.

3 4
13. Prove that 2.n + 3.n + 10 ∈ O(n )
14. Suppose sequence, b , b , b ,….., satisfies recurrence relation bk= 6bk-1-9bk-2
0 1 2
∀k≥2 with condition initial condition: b0=2 and b1=6, then find explicit formula for
b , b , b , . . ., using characteristic equation of the above recursion.
0 1 2
15. Show that any amount in cents ≥ 20 cents can be obtained using 5 cents and 6
cents coins only.
16. Use mathematical induction to prove sigma i=0 to n (i] = n(n+1)(2n+1)/6 .
17. Write 2 line assembly algorithm
18. What is the Fibonacci sequence, write formula for it.
19. Sigma i=0 to n (i) = n(n+1)(2n+1)/6 . Prove by mathematical induction
20. Write n-line assembly line algorithm
21. Write algorithm of 0-1 knapsack problem by brute force.
22. Write algorithm knapsack problem by dynamic programming.
23. Write algorithm of 2-dimension points.
24. N be a set of natural number < or = over relation prove or disprove ,symmetric ,transitive
,reflexive

Dr. Nazir Ahmad Zafar | Virtual University of Pakistan


167 CS-702 Advanced Algorithms Analysis and Design

Lecture No. 23
Longest Common Subsequence
(Dynamic Algorithm)
Optimal Binary Search Trees

Theorem: Optimal Substructure of an LCS

• If X = (x1, x2,. . ., xm), and Y = (y1, y2, . . ., yn) be sequences and let us suppose that Z =
(z1, z2, . . ., zk) be a longest common sub-sequence of X and Y
1. if xm = yn, then zk = xm and Zk – 1 is LCS of Xm – 1, Yn-1.
2. If xm  yn, then zk  xm implies that Z is LCS of Xm – 1 and Y
3. If xm  yn, then zk  yn implies that Z is LCS of X and Yn – 1

0 if i  0 OR j  0

c(i, j )  c(i  1, j  1)  1 if i, j  0 and x i  y j

max( c(i  1, j ), c(i, j  1)) if i, j  0 and x i  y j

Problem

If X = <A, B, C, B, D, A, B>, and Y = <B, D, C, A, B, A> are two sequences then compute a
maximum-length common subsequence of X and Y.

Solution:
• Let c(i, j) = length of LCS of Xi and Yj, now we have to compute c(7, 6).
• The recursive mathematical formula computing LCS is given below

0 if i  0 OR j  0

c(i, j )  c(i  1, j  1)  1 if i, j  0 and x i  y j

max( c(i  1, j ), c(i, j  1)) if i, j  0 and x i  y j

If X = <A, B, C, B, D, A, B>, Y = <B, D, C, A, B, A>

• c(1, 1) = max (c(0, 1), c(1, 0)) = max (0, 0) = 0 b[1, 1] = 


• c(1, 2) = max (c(0, 2), c(1, 1)) = max (0, 0) = 0 b[1, 2] = 
• c(1, 3) = max (c(0, 3), c(1, 2)) = max (0, 0) = 0 b[1, 3] = 
• c(1, 4) = c(0, 3) + 1 = 0 + 1 = 1; b[1, 4] = ↖
• c(1, 5) = max (c(0, 5), c(1, 4)) = max (0, 1) = 1 b[1, 5] = 
• c(1, 6) = c(0, 5) + 1 = 0 + 1 = 1; b[1, 6] = ↖

• c(2, 1) = c(1, 0) + 1 = 0 + 1 = 1; b[2, 1] = ↖


• c(2, 2) = max (c(1, 2), c(2, 1)) = max (0, 1) = 1 b[2, 2] = 
• c(2, 3) = max (c(1, 3), c(2, 2)) = max (0, 1) = 1 b[2, 3] = 
• c(2, 4) = max (c(1, 4), c(2, 3)) = max (1, 1) = 1 b[2, 4] = 
• c(2, 5) = c(1, 4) + 1 = 1 + 1 = 2; b[2, 5] = ↖
• c(2, 6) = max (c(1, 6), c(2, 5)) = max (1, 2) = 2 b[2, 6] = 

Dr. Nazir Ahmad Zafar | Virtual University of Pakistan


168 CS-702 Advanced Algorithms Analysis and Design

If X = <A, B, C, B, D, A, B>, Y = <B, D, C, A, B, A>

• c(3, 1) = max (c(2, 1), c(3, 0)) = max (1, 0) = 1 b[3, 1] = 


• c(3, 2) = max (c(2, 2), c(3, 1)) = max (1, 1) = 1 b[3, 2] = 
• c(3, 3) = c(2, 2) + 1 = 1 + 1 = 2; b[3, 3] = ↖
• c(3, 4) = max (c(2, 4), c(3, 3)) = max (1, 2) = 2 [3, 4] = 
• c(3, 5) = max (c(2, 5), c(3, 4)) = max (2, 2) = 2 b[3, 5] = 
• c(3, 6) = max (c(2, 6), c(3, 5)) = max (2, 2) = 2 b[2, 6] = 

• c(4, 1) = c(3, 0) + 1 = 0 + 1 = 1; b[4, 1] = ↖


• c(4, 2) = max (c(3, 2), c(4, 1)) = max (1, 1) = 1 b[4, 2] = 
• c(4, 3) = max (c(3, 3), c(4, 2)) = max (2, 1) = 2 b[4, 3] = ↑
• c(4, 4) = max (c(3, 4), c(4, 3)) = max (2, 2) = 2 b[4, 4] = 
• c(4, 5) = c(3, 4) + 1 = 2 + 1 = 3; b[4, 5] = ↖
• c(4, 6) = max (c(3, 6), c(4, 5)) = max (2, 3) = 3 b[4, 6] = 

• c(5, 1) = max (c(4, 1), c(5, 0)) = max (1, 0) = 1 b[5, 1] = ↑


• c(5, 2) = c(4, 1) + 1 = 1 + 1 = 2; b[5, 2] = ↖
• c(5, 3) = max (c(4, 3), c(5, 2)) = max (2, 2) = 2 b[5, 3] = 
• c(5, 4) = max (c(4, 4), c(5, 3)) = max (2, 2) = 2 b[5, 4] = 
• c(5, 5) = max (c(4, 5), c(5, 4)) = max (3, 2) = 3 b[5, 5] = ↑
• c(5, 6) = max (c(4, 6), c(5, 5)) = max (3, 3) = 3

• c(6, 1) = max (c(5, 1), c(6, 0)) = max (1, 0) = 1 b[6, 1] = ↑


• c(6, 2) = max (c(5, 2), c(6, 1)) = max (2, 1) = 2 b[6, 1] = ↑
• c(6, 3) = max (c(5, 3), c(6, 2)) = max (2, 2) = 2 b[6, 3] = 
• c(6, 4) = c(5, 3) + 1 = 2 + 1 = 3; b[6, 4] = ↖
• c(6, 5) = max (c(5, 5), c(6, 4)) = max (2, 3) = 3 b[6, 5] = 
• c(6, 6) = c(5, 5) + 1 = 3 + 1 = 4; b[6, 6] =↖

• c(7, 1) = c(6, 0) + 1 = 0 + 1 = 1; b[7, 1] = ↖


• c(7, 2) = max (c(6, 2), c(7, 1)) = max (2, 1) = 2 b[7, 2] = ↑
• c(7, 3) = max (c(6, 3), c(7, 2)) = max (2, 2) = 2 b[7, 3] = 
• c(7, 4) = max (c(6, 4), c(7, 3)) = max (3, 2) = 3 b[7, 4] = ↑
• c(7, 5) = c(6, 4) + 1 = 3 + 1 = 4; b[7, 5] = ↖
• c(7, 6) = max (c(6, 6), c(7, 5)) = max (4, 4) = 4

Dr. Nazir Ahmad Zafar | Virtual University of Pakistan


169 CS-702 Advanced Algorithms Analysis and Design

Results:

Computable Tables:

Dr. Nazir Ahmad Zafar | Virtual University of Pakistan


170 CS-702 Advanced Algorithms Analysis and Design

• Table size: O(n.m)


• Every entry takes O(1) time to
compute.
• The algorithm takes O(n.m) time and
space.
• The space complexity can be
reduced to 2 · min(m, n) + O(1).

Dr. Nazir Ahmad Zafar | Virtual University of Pakistan


171 CS-702 Advanced Algorithms Analysis and Design

Longest Common Subsequence Algorithm

c[i, j] = c(i-1, j-1) + 1 if xi = yj;


c[i, j] = max( c(i-1, j), c(i, j-1)) if xi ≠ yj;
c[i, j] = 0 if (i = 0) or (j = 0).

function LCS(X, Y) procedure PrintLCS(b, X, i, j)


1 m ≡ length [X] 1. if (i == 0) or (j == 0)
2 n ≡ length [Y] 2. then return
3 for i ≡ 1 to m 3. if b[i, j] == “ ”
4 do c[i, 0] ≡ 0; 4. then PrintLCS(b, X, i-1, j-1)
5 for j ≡ 1 to n 5. Print xi
6 do c[0, j] ≡ 0; 6. else if b[i, j] ≡ “↑”
7 for i ≡ 1 to m 7. then PrintLCS(b, X, i-1, j)
8 do for j ≡ 1 to n 8. else PrintLCS(b, X, i, j-1)
9 do if (xi = = yj)
10 then c[i, j] ≡ c[i-1, j-1] + 1
11 b[i, j] ≡ “ ”
12 else if c[i-1, j]  c[i, j-1]
13 then c[i, j] ≡ c[i-1, j]
14 b[i, j] ≡ “↑”
15 else c[i, j] ≡ c[i, j-1]
16 b[i, j] ≡ “”
17 Return c and b;

Relationship with shortest common supper-sequence


• Shortest common super-sequence problem is closely related to longest common
subsequence problem

Shortest common super-sequence


• Given two sequences:
X = < x1,...,xm > and
Y = < y1,...,yn >
• A sequence U = < u1,...,uk > is a common super-sequence of X and Y if U is a super-
sequence of both X and Y.
• The shortest common supersequence (scs) is a common supersequence of minimal
length.

Problem Statement
• The two sequences X and Y are given and task is to find a shortest possible common
supersequence.
• Shortest common supersequence is not unique.
• Easy to make SCS from LCS for 2 input sequences.

Example,
• X[1..m] = abcbdab, Y[1..n] = bdcaba, we get LCS = Z[1..r] = bcba
• Insert non-lcs symbols preserving order, we get SCS = U[1..t] = abdcabdab.

Dr. Nazir Ahmad Zafar | Virtual University of Pakistan


172 CS-702 Advanced Algorithms Analysis and Design

Binary Search Trees


• Binary search tree (BST) is a binary data structure which has the following properties:
• Each node has a value.
• An order is defined on these values.
• Left sub-tree of node contains values less than node value
• Right sub-tree of a node contains only values greater than or equal to the node‟s
value.

Optimal Binary Search Trees


Example: A translator from English to, say, Urdu.
• Use a binary search tree to store all the words in our dictionary, together with their
translations.
• The word “the” is much more likely to be looked up than the word “ring”
• So we would like to make the search time for the word “the” very short, possibly at the
expense of increasing the search time for the word “ring.”

Problem Statement: We are given a probability distribution that determines, for every key in the
tree, the likelihood that we search for this key.
• The objective is to minimize the expected search time of the tree.
• We need is known as an optimal binary search tree.
• Formally, we are given a sequence K = <k1, k2, ..., kn> of n distinct keys in sorted order
i.e. k1 < k2 < ··· < kn, and we wish to build a binary search tree from these keys.
• For each ki, we have a probability pi that search is for ki.
• Some searches may not be successful, so we have n + 1 “dummy keys” d0, d1, d2, ..., dn
representing values not in K
• In particular
d0 = represents all values less than k1,
dn = represents all values greater than kn, and
di = represents all values between ki and ki+1,  i = 1, 2, ..., n -1

• For each dummy key di, we have a probability qi that a search will correspond to di.
• Each ki is an internal node, each dummy key di is a leaf.
• Every search is either successful (finding some key ki) or failure (finding some dummy
key di), and so we have

Dr. Nazir Ahmad Zafar | Virtual University of Pakistan


173 CS-702 Advanced Algorithms Analysis and Design

Total Cost: Optimal Binary Search Trees

Total cos t 
n n

 pi (depth ((ki )  1)   qi (depth ((di )  1)


i 1 i 0
n n n n
  pi .depth (ki )   pi   qi depth (d i )   qi
i 1 i 1 i 0 i 0
n n
Since we know that : p  q
i 1
i
i 0
i 1

HenceTotal Cost
n n
  pi .depth (ki )   qi depth (d i )  1
i 1 i 0

Let qi 0.05 0.10 0.05 0.05 0.05


pi = probability of searching k1 0.10
qi = probability representing di Define cost of a search is as number of
nodes examined in a search
Expected cost = 2.8 Cost of a key = depth of the key + 1

Expected cost = 2.75

i 0 1 2 3 4
5
pi 0.15 0.10 0.05 0.10
0.20

Brute Force Solution


• Total number of binary trees will be exponential as in case of chain matrix problem

Dr. Nazir Ahmad Zafar | Virtual University of Pakistan


174 CS-702 Advanced Algorithms Analysis and Design

• Brute force approach is not economical

• Observations:
– Optimal BST may not have smallest height.
– Optimal BST may not have highest-probability key at root.
• Build by exhaustive checking?
– Construct each n-node BST.
– For each, assign keys and compute expected search cost.
– But there are (4n/n3/2) different BSTs with n nodes.

Optimal Substructure
Observation: Cut and paste method.
Any subtree of a BST contains keys range
ki, ..., kj for some 1 ≤ i ≤ j ≤ n.

Lemma:
If T is an optimal BST and contains subtree
T‟ with keys ki, ... ,kj , then T‟ must be an
optimal BST for keys ki, ..., kj.

Proof:

Limitations of Dynamic Programming


• Dynamic programming can be applied to any problem that observes the principle of
optimality.
• Generally, it means that partial solutions can be optimally extended with regard to the
state after the partial solution instead of the partial solution itself.
• The biggest limitation using dynamic programming is number of partial solutions we
must keep track of
• For all examples we have seen, partial solutions can be described by stopping places in
the input.
• This is because combinatorial objects e.g. strings, numerical sequences, and polygons
etc., all have an implicit order defined upon their elements.
• This order cannot be changed without completely changing the origional problem.
• Once order fixed, there are relatively few possible stopping places, and we get an
efficient algorithms.

Dr. Nazir Ahmad Zafar | Virtual University of Pakistan


175 CS-702 Advanced Algorithms Analysis and Design

• If objects are not firmly ordered then we have an exponential number of possible partial
solutions
• And we get an infeasible amount of memory resulting an infeasible solution.

Construction: Optimal Substructure


• One of the keys in ki, …,kj, say kr, i ≤
r ≤ j, must be the root of an optimal
subtree for these keys.
• Left subtree of kr contains ki,...,kr-1.
• Right subtree of kr contains kr+1, ...,kj

• To find an optimal BST:


– Examine all candidate roots kr , for i ≤ r ≤ j
– Determine all optimal BSTs containing ki,...,kr-1 and containing kr+1,...,kj
• Find optimal BST for ki,...,kj, where i ≥1, j ≤ n, j ≥ i1
• When j = i1, the tree is empty.
• Define e[i, j ] = expected search cost of optimal BST for ki,...,kj.
• If j = i1, then e[i, j ] = qi-1.
• If j ≥ i,
– Select a root kr, for some i ≤ r ≤ j .
– Recursively make an optimal BSTs
• for ki,..,kr1 as the left subtree, and
• for kr+1,..,kj as the right subtree.

Lemma

Prove that when OPT tree becomes a sub-tree of a node then expected search cost increases
by
j j
w(i, j )   pl   ql
l i l i 1
Proof

Total cos t when a tree becomes subtree


j j
  pl (depth ((kl )  1  1)   ql (depth ((d l )  1  1)
l i l i 1
j j j j
  pl .(depth (kl )  1)   pl   ql (depth (d l )  1)   ql
l i l i l i 1 l i 1
j j j j
  pl .(depth (kl )  1)   ql (depth (d l )  1)   pl   ql
l i l i 1 l i l i 1
j j
 total cost when tree was not subtree   pl   ql
l i l i 1

Dr. Nazir Ahmad Zafar | Virtual University of Pakistan


176 CS-702 Advanced Algorithms Analysis and Design

• When OPT subtree becomes a subtree of a node:


– Depth of every node in OPT subtree goes up by 1.
– Expected search cost increases by
j j
w(i, j )   pl   ql
l i l i 1

• If kr is the root of an optimal BST for ki,..,kj


e[i, j ] = pr + (e[i, r1] + w(i, r1))+(e[r+1, j] + w(r+1, j))
= e[i, r1] + e[r+1, j] + w(i, j).

• But, we don‟t know kr. Hence,



qi 1 if j  i  1
e[i, j ]  
min{e[i, r  1]  e[r  1, j ]  w(i, j )} if i  j
 ir  j

Algorithm: Optimal Binary Search


• OPTIMAL-BST(p, q, n)
• for i ← 1 to n + 1
• do e[i, i 1] ← qi-1.
• w[i, i 1] ← qi-1. Consider all trees with l keys
• for l ← 1 to n
• do for i ← 1 to nl + 1 Fix the first key
• do j ←i + l1
• e[i, j ]←∞ Fix the last key
• w[i, j ] ← w[i, j1] + pj + qj Determine the root of the optimal sub-tree
• for r ←i to j
• do t ← e[i, r1] + e[r + 1, j ] + w[i, j ]
• if t < e[i, j ]
• then e[i, j ] ← t
• root[i, j ] ←r
• return e and root

Dr. Nazir Ahmad Zafar | Virtual University of Pakistan


177 CS-702 Advanced Algorithms Analysis and Design

Lecture No. 24
Optimal Binary Search Trees
Constructing Dynamic Programming

Today Covered
• Introduction to Greedy Algorithms – Dynamic programming
– Why Greedy Algorithm? solution
– Where Greedy? – Greedy choice
– Where Greed Algorithm do – Recursive algorithm
not work? – Iterative algorithm
• Activity Selection Problem • Conclusion
• Steps developing activity selection
algorithm

Why Greedy Algorithm?


The algorithms we have studied in dynamic programming are relatively inefficient, for example
• Cost of 0-1 knapsack problem: O(nW)
• Cost of matrix chain multiplication: O( n 3 )
• Cost in longest common subsequence: O(mn)
• Optimal binary search trees: O( n 3 )
This is because
• We have many choices computing optimal solution.
• We check all of them in dynamic programming.
• We must think which choice is the best or
• At least restrict the choices we have to try.

What are Greedy Algorithm?


• In greedy algorithms, we do the same thing
• Mostly optimization algorithms go through a sequence of steps, with a set of choices at
each step.
• In dynamic programming best choices is ignored
• Some times a simpler and efficient algorithm required.
• Greedy algorithms make best choice at a moment.
• It makes a locally optimal choice in the hope that this choice will lead to a globally
optimal solution.
• Greedy algorithms do not always yield an optimal solutions, but mostly they do
• They tend to be easier to implement.

Where Greedy Algorithms do not work?


• Greedy choice:
• We make the choice that looks best at a moment.
• Every time make a choice, greedily maximize value
• An example where this does not work
• Find longest monotonically increasing subsequence
• Given sequence <3 4 5 17 7 8 9>
• Longest such subsequence is <3 4 5 7 8 9>.
• The greedy choice after choosing <3 4 5> is to choose 17, which is an unwanted
element, results in the sequence <3 4 5 17> which is suboptimal.

Dr. Nazir Ahmad Zafar | Virtual University of Pakistan


178 CS-702 Advanced Algorithms Analysis and Design

Some Definitions:
Closed Interval = [a, b] = {x R | a ≤ x ≤ b}
Open Interval = (a, b) = {x R | a < x < b}
Left Semi Open = (a, b] = {x R | a < x ≤ b}
Right Semi Open = [a, b) = {x R | a ≤ x < b}

Activity Selection Problem


The problem involves scheduling of several competing activities that require exclusive use of
common resource

Problem Statement
• The problem can be stated as, suppose we have a set:
S = {a1, a2, ..., an} of n proposed activities.
– Each activity wish to use a resource which can be used by only one activity at a
time.
– Each activity ai has starting time si, finishing time fi where, 0 ≤ si < fi < ∞
• Objective in activity-selection problem is to select a maximum-size subset of mutually
compatible activities

Steps in Designing Activity Selection Algorithm


• Steps to solve the problem
• We will formulate the dynamic-programming solution in which
– Combine optimal solutions to two subproblems to form an optimal solution
to original problem
– Check several choices when determining which subproblems to use in an
optimal solution
• Then needed to make a greedy choice in which
– One of the subproblems guaranteed empty, so that only one nonempty
subproblem remains
• Then a recursive greedy algorithm is developed and converted to an iterative one

Application : Scheduling Problem


• A classroom can be used for one class at a time.
• There are n classes that want to use the classroom.
• Every class has a corresponding time interval Ij = [sj, fj) during which the room would be
needed for this class.
• Our goal is to choose a maximal number of classes that can be scheduled to use the
classroom without two classes ever using the classroom at the same time.
• Assume that the classes are sorted according to increasing finish times; that is, f1 < f2 <
… < fn.

Dr. Nazir Ahmad Zafar | Virtual University of Pakistan


179 CS-702 Advanced Algorithms Analysis and Design

Designing Activity Selection Problem


Compatible Activity
• If a selected activity ai is required to take place during the half-open time interval [si, fi).
And activity aj is required to take place during the half-open time interval [sj, fj). Then the
activities ai and aj are compatible if the intervals [si, fi) and [sj, fj) do not overlap i.e
si ≥ fj or sj ≥ fi

Compatible Activities:

Not Compatible Activities:

Compatible not Maximal

A set S of activities sorted in increasing order of finish time


• The subset consisting of mutually compatible activities are
– {a3, a9, a11} but it is not a maximal subset,
– {a1, a4, a8, a11} is larger.
– {a2, a4, a9, a11} is another largest subset.

Optimal Substructure of Activity Selection Problem


• The first step is to find optimal substructure and then use it to construct an optimal
solution to the problem from optimal solutions to subproblems.
• Let us start by defining sets Sij = {ak S : fi ≤ sk < fk ≤ sj} Sij is the subset of activities in S
that can start after activity ai finishes and finish before activity aj starts.
• The fictitious activities a0 and an+1 are added and adopt the conventions that f0 = 0 and
sn+1 = ∞. Then S = S0.n+1, and the ranges for i and j are given by 0 ≤ i, j ≤ n + 1.
• Let us assume that Aij is a solution to Sij

Optimal Substructure of Problem


• Let us assume that the activities are sorted in monotonically increasing order of finish
times of the activities:
f0 ≤ f1 ≤ f2 ≤ … ≤ fn < fn+1

• Assuming that we have sorted set of activities, our space of subproblems is


– to select a maximum-size subset of mutually compatible activities from Sij, for 0 ≤
i < j ≤ n + 1,
– knowing that all other Sij are empty.

Dr. Nazir Ahmad Zafar | Virtual University of Pakistan


180 CS-702 Advanced Algorithms Analysis and Design

Decomposition: Optimal Substructure of Problem


• Suppose that a solution to Sij is non-empty and includes some activity ak, so that
fi ≤ sk < fk ≤ sj.
• After choosing activity ak, it decomposes Sij into two subproblems, Sik and Skj
Sik = activities that start after ai finishes and finish before ak starts and
Skj = activities that start after ak finishes and finish before aj starts,
• Each of Sik and Skj are subset of the activities in Sij

Solution to Si,j : Optimal Substructure of Problem


• Our solution to Sij is the union of the solutions to Sik and Skj, along with the activity ak.
• Thus, the number of activities in our solution to Sij is the size of our solution to Sik, plus
the size of our solution to Skj , plus ak.
Solution(Sij) = Solution(Sik)  Solution(Skj) {ak}, Aij = Aik  Akj {ak}
• Suppose we now that an optimal solution Aij includes activity ak, then the solutions Aik
and Akj used within this optimal solution must be optimal.

Why Ai k and Ak j are Optimal?


Proof Why Aik and Akj are Optimal?
• If we had a solution A‟ik to Sik that included more activities than Aik, we could cut out Aik
from Aij and paste A‟ik in Aij , thus producing another solution A‟ij to Sij with more activities
than Aij.
• Because we assumed that Aij is an optimal solution, we have derived a contradiction.
• Similarly, if we had a solution A‟kj to Skj with more activities than Akj, we could replace Akj
by A‟kj to produce solution to Sij with more activities than Aij

Further Decomposition to Find S0, n+1


• Now we can build a maximum-size subset of mutually compatible activities in Sij
– by splitting the problem into two subproblems, mutually compatible activities in Sik
and Skj
– finding maximum-size subsets Aik and Akj of theses activities for these
subproblems and then
– forming maximum-size subset Aij as Aij = Aik  {ak}  Akj
• Optimal solution to entire problem is: A0,n+1.

A Recursive Solution
• Let c[i, j] = number of activities in a maximum-size subset of mutually compatible
activities in Sij.
• We have c[i, j] = 0 whenever Sij = Ø; In particular we have, c[i, j] = 0 for i ≥ j.
• Since Aij = Aik {ak} Akj
Therefore the recurrence relation for the problem is c[i, j ] = c[i, k] + c[k, j ] + 1.
• Since value of k varies between i + 1, ..., j – 1, and hence there are (j - 1) - (i - 1) + 1
possible values of k, i.e., j - 1 – i - 1 + 1 = j – i - 1
• Since maximum-size subset of Sij must use one of these values for k, we check them all
to find the best.
• Thus, our full recursive definition of c[i, j] becomes
0 if Sij  
c[i, j ]  
max {c[i, k ]  c[k , j ]  1} if Sij  
ik  j

• Now it is a straightforward exercise to write a tabular, bottom-up, dynamic programming


algorithm based on recurrence relation defined in previous slide.

Dr. Nazir Ahmad Zafar | Virtual University of Pakistan


181 CS-702 Advanced Algorithms Analysis and Design

Lecture No. 25
Greedy Algorithm

Today Covered

• Activity Selection Problem


– Example
– Recursive algorithm
– Iterative Algorithm
• Fractional Knapsack Problem
– Problem Analysis
– Greedy Approach for Fractional Knapsack
• Coin Change Making Problem
– Analysis
– Greedy Algorithm

Theorem: Why This Solution is Optimal?

Statement:
Consider any nonempty subproblem Sij, and let am be the activity in Sij with the earliest finish
time: fm = min {fk : ak  Sij}, then
1. Activity am is used in some maximum-size subset of mutually compatible
activities of Sij.
2. The subproblem Sim is empty, so that choosing am leaves the subproblem Smj as
the only one that may be nonempty.

Note: After proving these properties, it is guaranteed that the greedy solution to this problem
does exist.

Proof (Part B)
First we prove second part because it is bit simpler
• Suppose that Sim is nonempty
• It means there is some activity ak such that: fi ≤ sk < fk ≤ sm < fm.  fk < fm.
• Then ak is also in Sij and it has an earlier finish time than am, which contradicts our choice
of am. Hence Sim is empty, proved

Part A
• To prove first part, suppose that Aij is a maximum-size subset of mutually compatible
activities of Sij,
• Order Aij monotonic increasing order of finish time
• Let ak be the first activity in Aij.

Dr. Nazir Ahmad Zafar | Virtual University of Pakistan


182 CS-702 Advanced Algorithms Analysis and Design

Case 1
• If ak = am, then we are done, since we have shown that am is used in some maximal
subset of mutually compatible activities of Sij.

Case 2
• If ak ≠ am, then we construct the subset
A‟ij = Aij \ {ak}  {am}
• Since activities in Aij are disjoint, so is true for A‟ij.
• As ak is first activity in Aij to finish, and fm ≤ fk.
• Noting that A‟ij has same number of activities as Aij
• We see that A‟ij is a maximal subset of mutually compatible activities of Sij that includes
am.
• Hence proves the theorem.

Why is this Theorem Useful?

Dynamic Using the theorem


programming
Number of 2 subproblems: 1 subproblem: Smj
subproblems in the Sik, Skj Sim = 
optimal solution
Number of choices to j – i – 1 choices 1 choice: the activity
consider with the earliest
finish time in Sij

• Making the greedy choice i.e., the activity with the earliest finish time in Sij
– Reduce the number of subproblems and choices
– Solved each subproblem in a top-down fashion
• Only one subproblem left to solve

A Recursive Greedy Algorithm

Recursive-Activity-Selector (s, f, i, j)
1 m←i+1
2 while m < j and sm < fi // Find the first activity in Sij.
3 do m ← m + 1
4 if m < j
5 then return {am}  Recursive-Activity-Selector (s, f, m, j)
6 else return Ø

Dr. Nazir Ahmad Zafar | Virtual University of Pakistan


183 CS-702 Advanced Algorithms Analysis and Design

i = 0,
j = n + 1 = 12
m←i+1←0+1=1
m < j (1 < 12) and s1 < f0 (But 1>0)
if m < j (1 < 12)
return {a1}  Recursive-Activity-Selector (s, f, 1,12)

i = 1,
m←i+1←1+1=2
m < j (2 < 12) and s2 < f1 (3 < 4)
m←m+1←2+1=3

m < j (3 < 12) and s3 < f1 (0 < 4)


m←m+1←3+1=4

Dr. Nazir Ahmad Zafar | Virtual University of Pakistan


184 CS-702 Advanced Algorithms Analysis and Design

m < j (4 < 12) and s4 < f1 (But 5 > 4)


if m < j (4 < 12)
return {a4}  Recursive-Activity-Selector(s, f, 4,12)

i = 4,
m←i+1←4+1=5
m < j (5 < 12) and s5 < f4 (3 < 7)
m←m+1←5+1=6

m < j (6 < 12) and s6 < f4 (5 < 7)


m←m+1←6+1=7

Dr. Nazir Ahmad Zafar | Virtual University of Pakistan


185 CS-702 Advanced Algorithms Analysis and Design

m < j (7 < 12) and s7 < f4 (6 < 7)


m←m+1←7+1=8

m < j (8 < 12) and s8 < f1 (But 8 > 7)


if m < j (8 < 12)
return {a8}  Recursive-Activity-Selector (s, f, 8,12)

i = 8,
m←i+1←8+1=9
m < j (9 < 12) and s9 < f8 (8 < 11)
m ← m + 1 ← 9 + 1 = 10

Dr. Nazir Ahmad Zafar | Virtual University of Pakistan


186 CS-702 Advanced Algorithms Analysis and Design

m < j (10 < 12) and s10 < f8 (2 < 11)


m ← m + 1 ← 10 + 1 = 11

m < j (11 < 12) and s11 < f8 (But 12 > 11)
if m < j (11 < 12)
return {a11}  Recursive-Activity-Selector (s, f, 11,12)

i = 11,
m ← i + 1 ← 11 + 1 = 12
m < j (But 12 = 12)

Dr. Nazir Ahmad Zafar | Virtual University of Pakistan


187 CS-702 Advanced Algorithms Analysis and Design

An Iterative Greedy Algorithm Summary


Iterative-Activity-Selector (s, f) A greedy algorithm obtains an optimal
1 n ← length[s] solution to a problem by making a sequence
2 A ← {a1} of choices.
3 i←1
4 for m ← 2 to n For each decision point in the algorithm, the
5 do if sm ≥ fi choice that seems best at the moment is
6 then A ← A  {am} chosen at that time.
7 i←m
8 return A This strategy does not always produce an
optimal solution, but as we saw in the
activity-selection problem, sometimes it
does.

Now we give a sequence of steps designing


an optimal solution of using greedy
approach

Summary: Steps Designing Greedy Algorithms


We went through the following steps in the above problem:
1. Determine the suboptimal structure of the problem.
2. Develop a recursive solution.
3. Prove that at any stage of the recursion, one of the optimal choices is the greedy choice.
Thus, it is always safe to make the greedy choice.
4. Show that all but one of the sub-problems induced by having made the greedy choice
are empty.
5. Develop a recursive algorithm that implements the greedy strategy.
6. Convert this recursive algorithm to an iterative one.

Checks in Designing Greedy Algorithms


• In the beneath every greedy algorithm, there is almost always a dynamic programming
solution.
How can one tell if a greedy algorithm will solve a particular optimization problem?
• There is no way in general, but there are two key ingredients
– greedy choice property and
– optimal sub-structure
• If we can demonstrate that the problem has these properties, then we are well on the
way to developing a greedy algorithm for it.

The Knapsack Problem


• The 0-1 Knapsack Problem
– A thief robbing a store finds n items: i-th item worth vi and weight wi, where vi and
wi integers
– The thief can only carry weight W in his knapsack
– Items must be taken entirely or left behind
– Which items should the thief take to maximize the value of his load?
• The Fractional Knapsack Problem
– Similar to 0-1 can be solved by greedy approach
– In this case, the thief can take fractions of items.

Dr. Nazir Ahmad Zafar | Virtual University of Pakistan


188 CS-702 Advanced Algorithms Analysis and Design

Greedy Fails in 0-1 knap sack problem

Developing Algorithm: Fractional Knapsack


• Pick the item with the maximum value per pound vi/wi
• If the supply of that element is exhausted and the thief can carry more then take as
much as possible from the item with the next greatest value per pound
• Continue this process till knapsack is filled
• It is good to order items based on their value per pound
v1 v2 v
  ...  n
w1 w2 wn

Algorithm: Fractional Knapsack Problem


Fractional-Knapsack (W, v[n], w[n])
1. While w > 0 and as long as there are items remaining
2. pick item with maximum vi/wi
3. xi  min (1, w/wi)
4. remove item i from list
5. w  w – xiwi

• w the amount of space remaining in the knapsack (w = W)


• Running time: (n) if items already ordered; else (nlgn)

Dr. Nazir Ahmad Zafar | Virtual University of Pakistan


189 CS-702 Advanced Algorithms Analysis and Design

Making Change A greedy approach is to add the highest


Someone comes to your store and makes a value coin possible.
purchase of 98.67. He/she gives you 100.
You want to give back change using the Greedy algorithm (C, N)
least number of coins. sort coins so C1  C2  . . .  Ck
S = ;
INPUT: The values of coins: C1, C2, . . . , Ck, Change = 0
and an integer N. Assume that some coin i = 1 \\ Check for next coin
has value 1. while Change  N do
\\ all most valuable coins
GOAL: To find a multi-set of coins S whose if Change + Ci ≤ N then
sum is N where the total number of coins is Change = Change + Ci
minimized. S = S  {Ci}
else i = i+1

• In Pakistan, our currency notes are


C1 = 5000, C2 = 1000, C3 = 500, C4 = 100, C5 = 50, C6 = 20 , C7 = 10
• Applying above greedy algorithm to N = 13,660, we get
S = {C1, C1, C2, C2, C2, C3 , C4 , C5 , C7}
• Does this algorithm always find an optimal solution? For Pakistani currency.
• It does but does not hold always

Dynamic Programming vs. Greedy Algorithms


• Dynamic programming
– We make a choice at each step
– The choice depends on solutions to subproblems
– Bottom up solution, smaller to larger subproblems
• Greedy algorithm
– Make the greedy choice and THEN
– Solve subproblem arising after the choice is made
– The choice we make may depend on previous choices, but not on solutions to
subproblems
Top down solution, problems decrease in size

Conclusion
• Weaknesses of dynamic programming are discussed
• Approach of designing dynamic algorithms is used for design of greedy algorithms.
• Activity selection problem is discussed in detail.
• Best, at a moment, of the sub-problems in dynamic programming are selected. The
other sub-problem is forced to become empty in activity selection problem
• Optimality and correctness is proved.
• Discussed why greedy algorithms are efficient.
• Some problems are discussed where Greedy algorithms do not work.
• 0-1 Knapsack problem discussed with greedy approach
• Fractional Knapsack problem analyzed and algorithm using greedy approach is given
• Two different versions of the Task Scheduling Problem are analyzed
• Task Scheduling linked with 0-1 Knapsack
• Coin change problem is discussed with greedy approach
• It is observed that all coin changing problems can not be solved using greedy approach
• Relationship between dynamic programming and greedy approach is reviewed

Dr. Nazir Ahmad Zafar | Virtual University of Pakistan


190 CS-702 Advanced Algorithms Analysis and Design

Lecture 26
Huffman Coding

Today Covered
• Huffman Problem
• Problem Analysis
– Binary coding techniques
– Prefix codes
• Algorithm of Huffman Coding Problem
• Time Complexity
• Road Trip Problem
– Analysis and Greedy Algorithm
• Conclusion

Using ASCII Code: Text Encoding


• Our objective is to develop a code that represents a given text as compactly as possible.
• A standard encoding is ASCII, which represents every character using 7 bits

Example
Represent “An English sentence” using ASCII code
1000001 (A) 1101110 (n) 0100000 ( ) 1000101 (E) 1101110 (n) 1100111 (g) 1101100 (l)
1101001 (i) 1110011 (s) 1101000 (h) 0100000 ( ) 1110011 (s) 1100101 (e) 1101110 (n)
1110100 (t) 1100101 (e) 1101110 (n) 1100011 (c) 1100101 (e) = 133 bits ≈ 17 bytes

Refinement in Text Encoding


• Now a better code is given by the following encoding:
‹space› = 000, A = 0010, E = 0011, s = 010,
c = 0110, g = 0111, h = 1000, i = 1001,
l = 1010, t = 1011, e = 110, n = 111

• Then we encode the phrase as 0010 (A) 111 (n) 000 ( ) 0011 (E) 111 (n) 0111 (g)
1010 (l) 1001 (i) 010 (s) 1000 (h) 000 ( ) 010 (s) 110 (e) 111 (n) 1011 (t)
110 (e) 111 (n) 0110 (c) 110 (e)

• This requires 65 bits ≈ 9 bytes. Much improvement.


• The technique behind this improvement, i.e., Huffman coding which we will discuss later
on.

Major Types of Binary Coding


There are many ways to represent a file of information.
• Binary Character Code (or Code)
– each character represented by a unique binary string.

• Fixed-Length Code
– If  = {0, 1} then
– All possible combinations of two bit strings
 x  = {00, 01, 10, 11}
– If there are less than four characters then two bit strings enough
– If there are less than three characters then two bit strings not economical
– All possible combinations of three bit strings

Dr. Nazir Ahmad Zafar | Virtual University of Pakistan


191 CS-702 Advanced Algorithms Analysis and Design

 x  x  = {000, 001, 010, 011, 100, 101, 110, 111}


– If there are less than nine characters then three bit strings enough
– If there are less than five characters then three bit strings not economical and
can be considered two bit strings
– If there are six characters then needs 3 bits to represent, following could be one
representation. a = 000, b = 001, c = 010, d = 011, e = 100, f = 101

• Variable-Length Code
– better than a fixed-length code
– It gives short code-words for frequent characters and
– long code-words for infrequent characters

• Assigning variable code requires some skill


• Before we use variable codes we have to discuss prefix codes to assign variable codes
to set of given characters
• A prefix code is a code typically a variable length code, with the “prefix property”
• Prefix property is defined as no codeword is a prefix of any other code word in the set.

Examples
1. Code words {0,10,11} has prefix property
2. A code consisting of {0, 1, 10, 11} does not have, because “1” is a prefix of both “10” and
“11”.

Other names
• Prefix codes are also known as prefix-free codes, prefix condition codes, comma-free
codes, and instantaneous codes etc.

Why are prefix codes?


• Encoding simple for any binary character code;
• Decoding also easy in prefix codes. This is because no codeword is a prefix of any
other.

Example 1
• If a = 0, b = 101, and c = 100 in prefix code then the string: 0101100 is coded as
0·101·100

Example 2
• In code words: {0, 1, 10, 11}, receiver reading “1” at the start of a code word would not
know whether
– that was complete code word “1”, or
– prefix of the code word “10” or of “11”

Prefix codes and binary trees


• Tree representation of prefix codes

Dr. Nazir Ahmad Zafar | Virtual University of Pakistan


192 CS-702 Advanced Algorithms Analysis and Design

Huffman Codes
• In Huffman coding, variable length code is used
• Data considered to be a sequence of characters.
• Huffman codes are a widely used and very effective technique for compressing data
– Savings of 20% to 90% are typical, depending on the characteristics of the data
being compressed.
• Huffman‟s greedy algorithm uses a table of the frequencies of occurrence of the
characters to build up an optimal way of representing each character as a binary string.
• Now let us see an example to understand the concepts used in Huffman coding

Example: Huffman Codes

Binary Tree: Variable Length Codeword

Cost of Tree Corresponding to Prefix Code


• Given a tree T corresponding to a prefix code. For each character c in the alphabet C,
– let f (c) denote the frequency of c in the file and
– let dT(c) denote the depth of c‟s leaf in the tree.
– dT(c) is also the length of the codeword for character c.

Dr. Nazir Ahmad Zafar | Virtual University of Pakistan


193 CS-702 Advanced Algorithms Analysis and Design

– The number of bits required to encode a file is


B(T )   f (c)dT (c)
cC
– which we define as the cost of the tree T.

Algorithm: Constructing a Huffman Codes

Huffman (C)
1 n ← |C|
2 Q←C
3 for i ← 1 to n - 1
4 do allocate a new node z
5 left[z] ← x ← Extract-Min (Q)
6 right[z] ← y ← Extract-Min (Q)
7 f [z] ← f [x] + f [y]
8 Insert (Q, z)
9 return Extract-Min(Q) Return root of the tree.

Example: Constructing a Huffman Codes

for i ← 1
Allocate a new node z
left[z] ← x ← Extract-Min (Q) = f:5
right[z] ← y ← Extract-Min (Q) = e:9
f [z] ← f [x] + f [y] (5 + 9 = 14)
Insert (Q, z)

Dr. Nazir Ahmad Zafar | Virtual University of Pakistan


194 CS-702 Advanced Algorithms Analysis and Design

for i ← 2
Allocate a new node z
left[z] ← x ← Extract-Min (Q) = c:12
right[z] ← y ← Extract-Min (Q) = b:13
f [z] ← f [x] + f [y] (12 + 13 = 25)
Insert (Q, z)

for i ← 3
Allocate a new node z
left[z] ← x ← Extract-Min (Q) = z:14
right[z] ← y ← Extract-Min (Q) = d:16
f [z] ← f [x] + f [y] (14 + 16 = 30)
Insert (Q, z)

for i ← 4 for i ← 5
Allocate a new node z Allocate a new node z
left[z] ← x ← Extract-Min (Q) = z:25 left[z] ← x ← Extract-Min (Q) = a:45
right[z] ← y ← Extract-Min (Q) = z:30 right[z] ← y ← Extract-Min (Q) = z:55
f [z] ← f [x] + f [y] (25 + 30 = 55) f [z] ← f [x] + f [y] (45 + 55 = 100)
Insert (Q, z) Insert (Q, z)

Dr. Nazir Ahmad Zafar | Virtual University of Pakistan


195 CS-702 Advanced Algorithms Analysis and Design

Lemma 1: Greedy Choice

There exists an optimal prefix code such that the two characters with smallest frequency are
siblings and have maximal depth in T.

Proof:
• Let x and y be two such characters, and let T be a tree representing an optimal prefix
code.
• Let a and b be two sibling leaves of maximal depth in T, and assume with out loss of
generality that f(x) ≤ f(y) and f(a) ≤ f(b).
• This implies that f(x) ≤ f(a) and f(y) ≤ f(b).
• Let T' be the tree obtained by exchanging a and x and b and y.

The cost difference between trees T and T' is

Dr. Nazir Ahmad Zafar | Virtual University of Pakistan


196 CS-702 Advanced Algorithms Analysis and Design

Hence B(T‟) ≤ B(T)


Since B(T) ≤ B(T‟)
Hence B(T) = B(T‟)

Dr. Nazir Ahmad Zafar | Virtual University of Pakistan


197 CS-702 Advanced Algorithms Analysis and Design

Lecture No. 27
Huffman Coding Problem and Graph Theory

Algorithm: Constructing a Huffman Codes


Huffman (C)
1 n ← |C|
2 Q←C
3 for i ← 1 to n - 1
4 do allocate a new node z
5 left[z] ← x ← Extract-Min (Q)
6 right[z] ← y ← Extract-Min (Q)
7 f [z] ← f [x] + f [y]
8 Insert (Q, z)
9 return Extract-Min(Q) // Return root of the tree

Lemma 2: Optimal Substructure Property


• Let C be a given alphabet with frequency f[c] defined for each character c  C.
• Let x, y (characters)  C with minimum frequency.
• Let C′ be alphabet C with characters x, y removed, new character z added, so that C′ =
C - {x, y}  {z};
• Define f for C′ as for C, except that f[z] = f[x] + f[y].
• Let T′ be any tree representing an optimal prefix code for the alphabet C′.
• Then tree T, obtained from T′ by replacing leaf node for z with an internal node having x,
y as children, represents an optimal prefix code for alphabet C.

Proof
• Since C′ = C - {x, y}  {z}; where f(z) = f(x) + f(y),
• We are give that T' is an optimal tree for C'.
• Let T be tree obtained from T' by making x, y children of z.
• We prove: B(T) = B(T') + f(x) + f(y)

• B(T‟) = B(T) - f(x) - f(y)

Dr. Nazir Ahmad Zafar | Virtual University of Pakistan


198 CS-702 Advanced Algorithms Analysis and Design

If T' is optimal for C', then T is optimal for C?


• Assume on contrary that there exists a better tree T'' for C, such that B(T‟‟) < B(T)
• Assume without loss of generality T‟‟ has siblings x and y.
• Let tree T''' be a tree T'' with the common parent of x and y replaced by vertex z with
frequency f[z] = f[x] + f[y]. Then
B(T‟‟‟) = B(T'') – f(x) – f(y)
< B(T) – f(x) – f(y) Since, B(T‟‟) < B(T)
= B(T').
• This contradicts the optimality of B(T').
• Hence, T must be optimal for C.

Road Trip Problem


Problem Statement
• You purchase a new car. On your semester break, you decide to take a road trip from
Peshawar to Karachi.
• Your car has a tank of some capacity such that only a distance k km can be traveled
before refilling the tank.
• Suppose there are filling stations at distances of
d0 < d1 < d2 < . . . < dn
where dn is the total distance of your trip.
• Your goal is to find the smallest number of stops required i.e. shortest subsequence of
<d0 · · · dn>, given that you start at d0 and end at dn.

INPUT:
• The max distance k, along with the distances: d0, d1, . . . ,dn.

GOAL:
• To find a smallest sub sequence of d0, … , dn so that you can start from d0 and end at dn.

Note
• Greedy approach is considered each di in order.
• We stop to refuel at di only if the tank will finish before we get to di+1.

Greedy algorithm
1. for i = 1 to n do
2. if di - di-1 > k then “do not use this car”
3. S = d0
4. last = d0 (the distance of the last item in S)
5. dn+1 =∞ (forces dn to be in S)
6. for i = 1 to n do
7. if di+1 - last > k then
8. S := S  di
9. last := di

Dr. Nazir Ahmad Zafar | Virtual University of Pakistan


199 CS-702 Advanced Algorithms Analysis and Design

Graph Theoretic Concepts


Definitions
• Graph G consists of two finite sets V(G) and E(G)
• Endpoints a set of one or two vertices of an edge
• Loop an edge with just one endpoint
• Edge-endpoint function: End-Point-Function: E Set of V
• Parallel edges two distinct edges with same endpoints
• Adjacent vertices vertices connected by an edge
• Vertex adjacent to itself vertex endpoint of a loop
• Adjacent edges two edges incident on the same endpoint
• Isolated a vertex on which no edge is incident
• Empty a graph with no vertices, otherwise nonempty.

Examples
1. Vertex set = {v1, v2, v3, v4, v5, v6}
2. Edge set = {e1, e2, e3, e4, e5, e6, e7}
3. e1, e2, and e3 are incident on v1
4. v2 and v3 are adjacent to v1
5. e2,, e3 and e4 are adjacent to e1
6. e6 and e7 are loops
7. e2 and e3 are parallel
8. v5 and v6 are adjacent to themselves
9. v4 is an isolated vertex
10. Endpoint(e5) = (v5, v6)

Directed, Simple and Complete Graph


• Directed graph (digraph) in which each edge is associated with an ordered pairs of
vertices
• Simple graph does not have any loop or parallel edge
• Subgraph H is subgraph of G if and only if, every vertex in H is also vertex in G, and
every edge in H has the same endpoints as in G.
• Complete graph on n vertices, (Kn) is a simple graph in which each pair of vertices has
exactly one edge

Dr. Nazir Ahmad Zafar | Virtual University of Pakistan


200 CS-702 Advanced Algorithms Analysis and Design

Complete Graph
Example 1:
Find a recursive formula to compute number of edges in a complete graph on n vertices.

Solution:
• Let Sk = total number of edges of a complete graph with k vertices
• Sk = total number of edges of a complete graph with k - 1 vertices + total number
of edges connected kth node
• = total number of edges of a complete graph with k - 1 vertices + k-1 number of
edges Sk = Sk-1 + (k – 1)

Example 2:
Find an explicit formula to compute number of edges in complete graph on n vertices.

Solution:
Since, Sk = Sk-1 + (k – 1)  Sk-1 = Sk-2 + (k – 2) and so on
By back substitution
Sk = Sk-2 + (k – 2) + (k - 1) = Sk-3 + (k – 3) + (k - 2) + (k - 1)
Sk = S1 + 1 + 2 + . . . + (k - 2) + (k - 1) = (k-1)k/2
Sk = (k-1)k/2
Sn = (n-1)n/2

Dr. Nazir Ahmad Zafar | Virtual University of Pakistan


201 CS-702 Advanced Algorithms Analysis and Design

Complete Bipartite Graph


• A complete bipartite graph on (m, n) vertices, denoted Km, n , is a simple graph with
vertices v1, v2, …,vn and w1, w2, …,wn that satisfies the following properties:
for all i, k = 1, 2, …, m and for all j, l = 1, 2, …, n
1. there is an edge from each vertex vi to each vertex wj ;
2. there is not an edge from any vertex vi to any other vertex vk ;
3. there is not an edge from any vertex wj to any other vertex wl

Degree of Graph
Definition degree of v is number of edges incident on v

Theorem:
In a graph G, sum of degrees of all vertices equals twice the number of edges of G. Specifically,
if the vertices of G are v1, v2, …,vn where n is a positive integer, then
Total degree of G = deg(v1 )+ deg(v2 ) + … + deg(vn )
= 2 . (the number of edges of G)
Proof: easy
Note: Total degree of an undirected graph, G, is even.

Proposition
In a graph there are even number of vertices of odd degree.

Solution:
Let us suppose that: V = all vertices of a graph
V1 = {v1, v2, . . ., vk} = set of all vertices of odd degree
V2 = {w1, w2, . . ., wm} = set of all vertices of even degree
Now we have to prove that k is even?
On contrary, suppose that k is odd
Degree (graph) = deg(v1) + deg(v2) + , . . ., deg(vk) + deg(V2) = odd + even = odd, contradiction.
Hence k must be even.
That is there even number of vertices of odd degree.

Dr. Nazir Ahmad Zafar | Virtual University of Pakistan


202 CS-702 Advanced Algorithms Analysis and Design

Walk of Graph
• Walk from v to w is a finite alternating sequence of adjacent vertices and edges of G. It
has the form v = v0e1v1e2 . . vn-1envn = w, for all i = 1, 2,…, n, vi-1 and vi are endpoints of ei
• Trivial walk from v to v consists of single vertex v.
• Closed walk starts and ends at the same vertex
• Path a walk that does not contain a repeated edge. v = v0e1v1e2 . . . vn-1envn = w , where
all the ei are distinct (that is, ei ≠ ek for any i ≠ k).
• Simple path a path that does not contain a repeated vertex. Thus a simple path is a walk
of form v = v0e1v1e2 . . . vn-1envn = w, all ei and vj are distinct (vi ≠ vj, ei ≠ ej for any i ≠ j).

Circuit of Graph
• A circuit is a closed walk that does not contain a repeated edge. Thus a circuit is a walk
of the form v0e1v1e2 . . . vn-1envn where v0 = vn and all the ei are distinct.
• A simple circuit is a circuit that does not have any other repeated vertex except the first
and last. Thus a simple circuit is walk of the form v0e1v1e2 . . . vn-1envn, where all the
ei are distinct and all the vj are distinct except that v0 = vn

Euler Circuit
• An Euler circuit for G is a circuit that contains every vertex and every edge of G. That is,
an Euler circuit is a sequence of adjacent vertices and edges in G that starts and ends at
the same vertex, uses every vertex of G at least once, and every edge exactly once.

Theorem
If a graph has an Euler circuit, then every vertex of the graph has even degree.

Theorem
A graph G has an Euler circuit if, and only if, G is connected and every vertex of G has even
degree.

Euler Path
• Let G be a graph and let v and w be two vertices of G. An Euler path from v to w is a
sequence of adjacent edges and vertices that starts at v, ends at w, passes through
every vertex of G at least once, and traverses every edge of G exactly once.

Corollary
• Let G be a graph and let v and w be two vertices of G. There is a an Euler path from v to
w if, and only if, G is connected, v and w have odd degree, and all other vertices of G
have even degree.

Hamiltonian Circuit
• Given a graph G, a Hamiltonian circuit for G is a simple circuit that includes every vertex
of G. That is, a Hamiltonian circuit of G is a sequence of adjacent vertices and distinct
edges in which every vertex of G appears exactly once.

Dr. Nazir Ahmad Zafar | Virtual University of Pakistan


203 CS-702 Advanced Algorithms Analysis and Design

• If a graph G has a Hamiltonian circuit then G has a sub-graph H with the following
properties:
1. H contains every vertex of G;
2. H is connected;
3. H has the same number of edges as vertices;
4. every vertex of H has degree 2.

Connected Graph
• Two vertices v and w of G are connected if, and only if, there is a walk from v to w.
• G is connected if, and only if, for any two vertices v and w in G, there is a walk from v to
w. symbolically: G is connected v, w V(G), a walk from v to w

Lemma
• If G is connected, then any two distinct vertices of G can be connected by a simple path.
• If v, w are in circuit and one edge is removed from the circuit, then there still exists a
path from v to w
• If G is connected and contains a circuit, then an edge of circuit can be removed without
disconnecting G.

Connected Component
• A graph H is a connected component of a graph G if, and only if,
1. H is a subgraph of G;
2. H is connected;
3. No connected subgraphs of G has H as a subgraph and contains vertices or
edges that are not in H.

Isomorphism
• Let G and G‟ be graphs with vertex sets V(G) and V(G‟) and edge sets E(G) and E(G‟),
respectively. G is isomorphic to G‟ if, and only if, there exist one-to-one correspondence
g : V(G) V(G‟) and h : E(G) E(G‟) that preserve the edge-endpoint functions of G
and G‟ in the sense that for all v V(G) and e E(G) , v is an endpoint of e g(v) is
an endpoint of h(e)

Dr. Nazir Ahmad Zafar | Virtual University of Pakistan


204 CS-702 Advanced Algorithms Analysis and Design

Isomorphism Invariants
• A property P is called an isomorphic invariant if, and only if, given any graphs G and G‟,
if G has property P and G‟ is isomorphic to G, then G‟ has property P.
• If G and G‟ are simple graphs then G is isomorphic to G‟ if, and only if, there exists a
one-to-one correspondence g from the vertex set V(G) of G to the vertex set V(G‟) of G‟
that preserves the edge-endpoint functions of G and G‟ in the sense that for all vertices u
and v of G, {u, v} is an edge in G {g(u), g(v)} is an edge in G‟

Theorem
• Each of following properties is an invariant for graph isomorphism, n, m, and k are all
nonnegative integers:
1. has n vertices;
2. has m edges;
3. has a vertex of degree k;
4. has m vertices of degree k;
5. has a circuit of length k;
6. has a simple circuit of length k;
7. has m simple circuits of length k;
8. is connected;
9. has an Euler circuit;
10. has a Hamiltonian circuit.

Trees
• Graph is circuit-free  it has no nontrivial circuits.
• A graph is a tree  it is circuit-free and connected.
• A trivial tree is a graph that consists of a single vertex
• Empty tree that does not have any vertices or edges.
• Forest a graph if circuit-free.
• Terminal vertex (Leaf) a vertex of degree 1in T
• Internal vertex a vertex of degree greater than 1 in T

Lemma 1:
Any tree having more than one vertices has at least one vertex of degree 1.

Lemma 2:
If G is any connected graph, C is any nontrivial circuit in G, and one of the edges of C is
removed form G‟, then the graph that remains is connected.

Theorem:
For any positive integer n, if G is a connected graph with n vertices and n – 1 edges, then G is a
tree

Dr. Nazir Ahmad Zafar | Virtual University of Pakistan


205 CS-702 Advanced Algorithms Analysis and Design

Statement
For positive integer n, any tree with n vertices has n – 1 edges.

Solution
We prove this theorem by mathematical induction
Basis
n = 1, tree has no edge and hence true

Inductive hypothesis
Suppose that id n = k then tree has k – 1 edges

Claim
• Now if we add one more vertex to the tree then exactly one edge will be added
otherwise it will not remain tree. And hence it will become k edges in the tree. Proved.

Rooted Trees
• Rooted tree a distinguished vertex
• Level of a vertex is the number of edges along the unique path between it and the root.
• Height of a rooted tree is maximum level to any vertex
• Children of v are all those vertices that are adjacent to v and are one level farther away
from the root than v.
• Parent if w is child of v, then v its parent
• Siblings vertices that are children of same parent
• Ancestor and Descendent given vertices v and w, if v lies on the unique path between w
and the root, then v is an ancestor of w and w is a descendent of v.

Dr. Nazir Ahmad Zafar | Virtual University of Pakistan


206 CS-702 Advanced Algorithms Analysis and Design

Binary Trees
• A binary tree is a rooted tree in which every internal vertex has at most two children.
Each child in a binary tree is either left child or a right child (but not both), an internal
vertex has at most one left and one right child.
• Full binary tree is a binary tree in which each internal vertex has exactly two children

Theorem
If k is a positive integer and T is a full binary tree with k internal vertices, the T has a total of 2k
+ 1 vertices and has k + 1 terminal vertices.

Theorem
If T is a binary tree that has t number of terminal vertices and height is h, then t ≤ 2k OR log2 t
≤h

Spanning Trees
• A spanning tree for a graph G is a subgraph of G that contains every vertex of G and is a
tree.
Proposition
• Every connected graph has a spanning tree.
• Any two spanning trees for a graph have the same number of edges.

Minimal Spanning Trees


• A weighted graph is a graph for which each edge has an associated real number weight.
The sum of the weights of all the edges is the total weight of the graph.
• A minimal spanning tree for a weighted graph is a spanning tree that has the least
possible total weight compared to all other spanning trees for the graphs.
• If G is a weighted graph and e is an edge of G then w(e) denotes the weight of e and
w(G) denotes the total weight of G.

Dr. Nazir Ahmad Zafar | Virtual University of Pakistan


207 CS-702 Advanced Algorithms Analysis and Design

Lecture No. 28
Breadth First Search
Contents of the Today Lecture
• Representation of Graphs
• Breadth First Search
– Algorithm – Proof of correctness
– Analysis – Shortest paths, for un-
– Supporting lemmas in the weighted edges, based on
proof Breadth First Search
• Conclusion

Representations of Graphs
• Two standard ways to represent a graph
– Adjacency lists,
– Adjacency Matrix
• Applicable to directed and undirected graphs.
Adjacency lists
• A compact way to represent sparse graphs.
• |E| is much less than |V|2
• Graph G(V, E) is represented by array Adj of |V| lists
• For each u V, the adjacency list Adj[u] consists of all the vertices adjacent to u in G
• The amount of memory required is: (V + E)
Adjacency Matrix
• A graph G(V, E) assuming the vertices are numbered 1, 2, 3, … , |V| in some arbitrary
manner, then representation of G consists of: |V| × |V| matrix A = (aij) such that

• Preferred when graph is dense


– |E| is close to |V|2

Adjacency matrix of undirected graph

Dr. Nazir Ahmad Zafar | Virtual University of Pakistan


208 CS-702 Advanced Algorithms Analysis and Design

Adjacency Matrix
• The amount of memory required is (V2)
• For undirected graph to cut down needed memory only entries on and above diagonal
are saved
– In an undirected graph, (u, v) and (v, u) represents the same edge, adjacency matrix
A of an undirected graph is its own transpose A = AT
• It can be adapted to represent weighted graphs.

Breadth First Search


• One of simplest algorithm searching graphs
• A vertex is discovered first time, encountered
• Let G (V, E) be a graph with source vertex s, BFS
– discovers every vertex reachable from s.
– gives distance from s to each reachable vertex
– produces BF tree root with s to reachable vertices
• To keep track of progress, it colors each vertex
– vertices start white, may later gray, then black
– Adjacent to black vertices have been discovered
– Gray vertices may have some adjacent white vertices
• It is assumed that input graph G (V, E) is represented using adjacency list.
• Additional structures maintained with each vertex v V are
– color[u] – stores color of each vertex
– π[u] – stores predecessor of u
– d[u] – stores distance from source s to vertex u
BFS(G, s)
1 for each vertex u  V [G] – {s}
2 do color [u] ← WHITE
3 d [u] ← ∞
4 π[u] ← NIL
5 color[s] ← GRAY
6 d [s] ← 0
7 π[s] ← NIL
8 Q←Ø /* Q always contains the set of GRAY vertices */
9 ENQUEUE (Q, s)
10 while Q ≠ Ø
11 do u ← DEQUEUE (Q)
12 for each v  Adj [u]
13 do if color [v] = WHITE /* For undiscovered vertex. */
14 then color [v] ← GRAY
15 d [v] ← d [u] + 1
16 π[v] ← u
17 ENQUEUE(Q, v)
18 color [u] ← BLACK

Dr. Nazir Ahmad Zafar | Virtual University of Pakistan


209 CS-702 Advanced Algorithms Analysis and Design

Except root node, s


For each vertex u  V(G)
color [u] ≡ WHITE
d[u] ≡ ∞
π [s] ≡ NIL

Considering s as root node


color[s] ≡ GRAY
d[s] ≡ 0
π [s] ≡ NIL
ENQUEUE (Q, s)

DEQUEUE s from Q
Adj[s] = w, r
color [w] = WHITE
color [w] ← GRAY
d [w] ← d [s] + 1 = 0 + 1 = 1
π[w] ← s
ENQUEUE (Q, w)
color [r] = WHITE
color [r] ← GRAY
d [r] ← d [s] + 1 = 0 + 1 = 1
π[r] ← s
ENQUEUE (Q, r)
color [s] ← BLACK

Dr. Nazir Ahmad Zafar | Virtual University of Pakistan


210 CS-702 Advanced Algorithms Analysis and Design

DEQUEUE w from Q
Adj[w] = s, t, x
color [s] ≠ WHITE
color [t] = WHITE
color [t] ← GRAY
d [t] ← d [w] + 1 = 1 + 1 = 2
π[t] ← w
ENQUEUE (Q, t)
color [x] = WHITE
color [x] ← GRAY
d [x] ← d [w] + 1 = 1 + 1 = 2
π[x] ← w
ENQUEUE (Q, x)
color [w] ← BLACK

DEQUEUE r from Q
Adj[r] = s, v
color [s] ≠ WHITE
color [v] = WHITE
color [v] ← GRAY
d [v] ← d [r] + 1 = 1 + 1 = 2
π[v] ← r
ENQUEUE (Q, v)
color [r] ← BLACK

DEQUEUE t from Q
Adj[t] = u, w, x
color [u] = WHITE
color [u] ← GRAY
d [u] ← d [t] + 1 = 2 + 1 = 3
π[u] ← t
ENQUEUE (Q, u)
color [w] ≠ WHITE
color [x] ≠ WHITE
color [t] ← BLACK

Dr. Nazir Ahmad Zafar | Virtual University of Pakistan


211 CS-702 Advanced Algorithms Analysis and Design

DEQUEUE x from Q
Adj[x] = t, u, w, y
color [t] ≠ WHITE
color [u] ≠ WHITE
color [w] ≠ WHITE
color [y] = WHITE
color [y] ← GRAY
d [y] ← d [x] + 1 = 2 + 1 = 3
π[y] ← x
ENQUEUE (Q, y)
color [x] ← BLACK

DEQUEUE v from Q
Adj[v] = r
color [r] ≠ WHITE
color [v] ← BLACK

DEQUEUE u from Q
Adj[u] = t, x, y
color [t] ≠ WHITE
color [x] ≠ WHITE
color [y] ≠ WHITE
color [u] ← BLACK

Dr. Nazir Ahmad Zafar | Virtual University of Pakistan


212 CS-702 Advanced Algorithms Analysis and Design

DEQUEUE y from Q
Adj[y] = u, x
color [u] ≠ WHITE
color [x] ≠ WHITE
color [y] ← BLACK

• Each vertex is enqueued and dequeued atmost once


– Total time devoted to queue operation is O(V)
• The sum of lengths of all adjacency lists is  (E)
– Total time spent in scanning adjacency lists is O(E)
• The overhead for initialization O(V)
• Total Running Time of BFS = O(V+E)

Shortest Paths
• The shortest-path-distance δ (s, v) from s to v as the minimum number of edges in any
path from vertex s to vertex v.
– if there is no path from s to v, then δ (s, v) = ∞
• A path of length δ (s, v) from s to v is said to be a shortest path from s to v.
• Breadth First search finds the distance to each reachable vertex in the graph G (V, E)
from a given source vertex s V.
• The field d, for distance, of each vertex is used.

BFS-Shortest-Paths (G, s)
1 vV
2 d [v] ← ∞
3 d [s] ← 0
4 ENQUEUE (Q, s)
5 while Q ≠ φ
6 do v ← DEQUEUE(Q)
7 for each w in Adj[v]
8 do if d [w] = ∞
9 then d [w] ← d [v] +1
10 ENQUEUE (Q, w)

Dr. Nazir Ahmad Zafar | Virtual University of Pakistan


213 CS-702 Advanced Algorithms Analysis and Design

Lemma 1
Statement:
• Let G = (V, E) be a directed or undirected graph, and let s  V be an arbitrary vertex.
Then, for any edge (u, v)  E, δ(s, v) ≤ δ(s, u) + 1
Proof
– If u is reachable from s, then so is v. In this case, the shortest path from s to v
cannot be longer than the shortest path from s to u followed by the edge (u, v),
and thus the inequality holds.
– If u is not reachable from s, then δ(s, u) = ∞, and the inequality holds.

Lemma 2
Statement:
Let G = (V, E) be a directed or undirected graph, and suppose that BFS is run on G from a
given source vertex s  V. Then upon termination, for each vertex v  V, value d[v] computed
by BFS satisfies: d[v] ≥ δ(s, v).
Proof
• Induction on number of ENQUEUE operations.
– To prove d[v] ≥ δ(s, v) for all v  V
• The basis of the induction is situation immediately after s is enqueued in line 9 of BFS
algorithm.
• Base case holds, because d[s] = 0 = δ(s, s) and d[v] = ∞ ≥ δ(s, v) for all v  V - {s}
• Inductive hypothesis: d[u] ≥ δ(s, u). Here white vertex v is discovered during search from
a vertex u.
• By line 15 of BFS we have d[v] = d[u] + 1 (1)
• By Inductive hypothesis d[u] ≥ δ(s, u) (2)
• By previous Lemma, δ(s, u) + 1 ≥ δ(s, v) (3)
• Now by (1), (2) and (3),
– d[v] = d[u] + 1 ≥ δ(s, u) + 1 ≥ δ(s, v)
• Hence d[v] ≥ δ(s, v). Vertex v is then enqueued, and never enqueued again because it is
also grayed.
• Hence it prove the theorem

Lemma 3
Statement
• Suppose that during execution of BFS on a graph G = (V, E), the queue Q contains the
vertices v1, v2,..., vr↑, where v1 is the head of Q and vr is the tail. Then, d[vr] ≤ d[v1] + 1
and d[vi ] ≤ d[vi+1] for i = 1, 2,..., r - 1
Proof
– Proof is done by induction on queue operations
– Initially, when queue contains s, lemma holds.
– For inductive step, we must prove that lemma holds after dequeuing and
enqueuing a vertex.

Dr. Nazir Ahmad Zafar | Virtual University of Pakistan


214 CS-702 Advanced Algorithms Analysis and Design

Dequeuing a vertex.
– If head v1 of queue is dequeued, v2 becomes new head. (If queue is empty,
lemma holds vacuously.)
– Now d[v1] ≤ d[v2] (by inductive hypothesis)
– To prove that d[vr] ≤ d[v2] + 1
– We have d[vr] ≤ d[v1] + 1 ≤ d[v2] + 1
– And remaining inequalities are unaffected.

Enqueuing a vertex.
– When we enqueue vertex vr+1
– At time of enqueuing vr+1, let u was removed. Hence, by inductive hypothesis,
d[v1] ≥ d[u] i.e.
d[u] ≤ d[v1]. (1)
– Since vr+1 is adjacent to u
d[vr+1] = d[u] + 1 (2)
– By (1) and (2), d[vr+1] = d[u] + 1 ≤ d[v1] + 1
– By inductive hypothesis we have d[vr] ≤ d[u] + 1
– Now d[vr] ≤ d[u] + 1 = d[vr+1], and the remaining inequalities are unaffected.
– Thus, the lemma is proved when vr+1 is enqueued

Corollary
Suppose that vertices vi and vj are enqueued during execution of BFS, and that vi is enqueued
before vj. Then d[vi] ≤ d[vj] at the time that vj is enqueued.

Proof
– Immediate from above Lemma and
– the property that each vertex receives a finite d value at most once during the
course of BFS

Theorem (Correctness of BFS)


Statement: Let G = (V, E) be a directed or undirected graph, and suppose that BFS is run on G
from a given source vertex s  V. Then, during its execution, BFS discovers every vertex v  V
that is reachable from the source s, and upon termination d[v] = δ(s, v) for all v  V.
Moreover, for any vertex v ≠ s that is reachable from s, one of the shortest paths from s to v is a
shortest path from s to π[v] followed by edge (π[v], v).

Proof
• Assume, for the purpose of contradiction, that some vertex receives a d value not equal
to its shortest path distance.
• Let v be the vertex with minimum δ(s, v) that receives such an incorrect d value;
clearly v ≠ s.
• By Lemma 22.2, d[v] ≥ δ(s, v), and thus we have that d[v] > δ(s, v). Vertex v must be
reachable from s, for if it is not, then δ(s, v) = ∞ ≥ d[v].

Dr. Nazir Ahmad Zafar | Virtual University of Pakistan


215 CS-702 Advanced Algorithms Analysis and Design

• Let u be the vertex immediately preceding v on a shortest path from s to v, so that


δ(s, v) = δ(s, u) + 1.
• Because δ(s, u) < δ(s, v), and because of how we chose v, we have d[u] = δ(s, u).
• Putting these properties together, we have
• d[v] > δ(s, v) = δ(s, u) + 1 = d[u] +1 (22.1)
• Now consider the time when BFS chooses to dequeue vertex u from Q in line 11.
• At this time, vertex v is, white, gray, or black.
• We shall show that in each of these cases, we derive a contradiction to inequality (22.1).
• If v is white, then line 15 sets d[v] = d[u] + 1, contradicting inequality (22.1).
• If v is black, then it was already removed from the queue and, by Corollary 22.4, we
have d[v] ≤ d[u], again contradicting inequality (22.1).
• If v is gray, then it was painted gray upon dequeuing some vertex w, which was removed
from Q earlier than u and, d[v] = d[w] + 1.
• By Corollary 22.4, however, d[w] ≤ d[u], and so we have d[v] ≤ d[u] + 1, once again
contradicting inequality (22.1).
• Thus we conclude that d[v] = δ(s, v) for all v  V . All vertices reachable from s must be
discovered, if they were not, they would have infinite d values.
• To conclude the proof of the theorem, observe that if π[v] = u, then d[v] = d[u] + 1.
• Thus, we can obtain a shortest path from s to v by taking a shortest path from s to π[v]
and then traversing the edge (π[v], v)

Lemma
When applied to a directed or undirected graph G = (V, E), procedure BFS constructs π so that
the predecessor subgraph Gπ = (Vπ, Eπ) is a breadth-first tree.

Proof
• Line 16 of BFS sets π[v] = u if and only if (u v)  E and δ(s, v) < ∞ that is, if v is
reachable from s and thus Vπ consists of the vertices in V reachable from s.
• Since Gπ forms a tree, it contains a unique path from s to each vertex in Vπ .
• By applying previous Theorem inductively, we conclude that every such path is a
shortest path.
• The procedure in upcoming slide prints out the vertices on a shortest path from s to v,
assuming that BFS has already been run to compute the shortest-path tree.

Print Path
PRINT-PATH (G, s, v)
1 if v = s
2 then print s
3 else if π[v] = NIL
4 then print “no path from s to v exists
5 else PRINT-PATH (G, s, π[v])
6 print v

Dr. Nazir Ahmad Zafar | Virtual University of Pakistan


216 CS-702 Advanced Algorithms Analysis and Design

Conclusion
• How graphs can be represented
• Breadth First Search Techniques is discussed
• Algorithms is designed
• It is to be noted that just designing an algorithm of any problem is not enough, to give its
proof is required as well.
• Correctness of Breadth First Search is given
• BFS algorithm is refined to find shortest path
• This shortest path is, of course, for un-weighted graphs
• Searching algorithms have various applications.

Dr. Nazir Ahmad Zafar | Virtual University of Pakistan


217 CS-702 Advanced Algorithms Analysis and Design

Lecture 29
Proof (Breadth First Search Algorithm)
Depth First Search

Depth First Search


• The predecessor subgraph of a depth-first search forms a depth-first forest composed of
several depth-first trees defined as
Gπ = (Vπ, Eπ), where
Eπ = {(π[v], v) : v ᶆ V and π[v] ≠ NIL}
the edges in Eπ are called tree edges.
• Each vertex is initially white
– It is grayed when it is discovered in the search, and
– It is blackened when it is finished, that is, when its adjacency list has been
examined completely.

Discovery and Finish Times


• It guarantees that each vertex ends up in exactly one depth-first tree, so that these trees
are disjoint.
• It timestamps each vertex
– the first timestamp d[v] records when v is first discovered (and grayed), and
– the second timestamp f [v] records when the search finishes examining v's
adjacency list (and blackens v).
 For every vertex u d[u] < f[u]

Algorithm: Depth First Search

DFS(G) DFS-Visit(u)
1 for each vertex u ᶆ V [G] 1 color [u] ← GRAY
2 do color [u] ← WHITE 2 time ← time + 1
3 π[u] ← NIL 3 d [u] ← time
4 time ← 0 4 for each v ᶆ Adj [u]
5 for each vertex u ᶆ V [G] 5 do if color [v] = WHITE
6 do if color [u] = WHITE 6 then π[v] ← u
7 then DFS-Visit (u) 7 DFS-Visit (v)
8 color [u] ← BLACK
Total Running Time = * (V + E) 9 f[u] ← time ← time + 1

Dr. Nazir Ahmad Zafar | Virtual University of Pakistan


218 CS-702 Advanced Algorithms Analysis and Design

For each vertex u ᶆ V(G)


color [u] ≡ WHITE
π [u] ≡ NIL
time ≡ 0

Considering white vertex u


color [u] ≡ GRAY
d[u] ≡ time + 1 = 0 + 1 = 1
Adj[u] = v, x
color [v] = WHITE
π[v] ← u
DFS-VISIT (v)

color [v] ≡ GRAY


d[v] ≡ time + 1 = 1 + 1 = 2
Adj[v] = y
color [y] = WHITE
π[y] ← v
DFS-VISIT (y)

color [y] ≡ GRAY


d[y] ≡ time + 1 = 2 + 1 = 3
Adj[y] = x
color [x] = WHITE
π[x] ← y
DFS-VISIT (x)

Dr. Nazir Ahmad Zafar | Virtual University of Pakistan


219 CS-702 Advanced Algorithms Analysis and Design

color [x] ≡ GRAY


d[x] ≡ time + 1 = 3 + 1 = 4
Adj[x] = v
color [v] ≠ WHITE

The edge (x, v) is a back


edge that is a non tree edge
and is labeled as B

The vertex x is finished.


color [x] ≡ BLACK
f[x] ≡ time + 1 = 4 + 1 = 5

The vertex y is finished.


color [y] ≡ BLACK
f[y] ≡ time + 1 = 5 + 1 = 6

Dr. Nazir Ahmad Zafar | Virtual University of Pakistan


220 CS-702 Advanced Algorithms Analysis and Design

The vertex v is finished.


color [v] ≡ BLACK
f[v] ≡ time + 1 = 6 + 1 = 7

The edge (u, x) is a forward


edge that is a non tree edge
and is labeled as F

The vertex u is finished.


color [u] ≡ BLACK
f[u] ≡ time + 1 = 7 + 1 = 8

Considering white vertex w


color [w] ≡ GRAY
d[w] ≡time + 1 = 8 + 1 = 9
Adj[w] = y, z
color [y] ≠ WHITE
color [z] = WHITE
π[z] ← w
DFS-VISIT (z)

Dr. Nazir Ahmad Zafar | Virtual University of Pakistan


221 CS-702 Advanced Algorithms Analysis and Design

The edge (w, y) is a cross


edge that is a non tree edge
and is labeled as C

color [z] ≡ GRAY


d[z] ≡ time + 1 = 9 + 1 = 10
Adj[z] = z
color [z] ≠ WHITE

The edge (z, z) is a back


edge that is a non tree edge
and is labeled as B

The vertex z is finished.


color [z] ≡ BLACK
f[z] ≡ time + 1 = 10 + 1 = 11

Dr. Nazir Ahmad Zafar | Virtual University of Pakistan


222 CS-702 Advanced Algorithms Analysis and Design

The vertex w is finished.


color [w] ≡ BLACK
f[w] ≡ time + 1 = 11 + 1 = 12

Properties of Depth First Search


• It yields valuable information about structure of a graph.
– Predecessor subgraph Gπ does indeed form a forest of trees, since the structure
of the depth-first trees exactly mirrors the structure of recursive calls of DFS-
VISIT.
• Discovery and finishing times have parenthesis structure.
– If we represent the discovery of vertex u with a left parenthesis “(u” and represent
its finishing by a right parenthesis “u)”, then
– history of discoveries and finishing makes well-formed expression in a sense that
parentheses properly nested.

Parenthesis Structure

Theorem: Parenthesis Theorem


In any depth-first search of a (directed or undirected) graph G = (V, E), for any two vertices u
and v, exactly one of the following three conditions holds:

Dr. Nazir Ahmad Zafar | Virtual University of Pakistan


223 CS-702 Advanced Algorithms Analysis and Design

1. The intervals [d[u], f[u]] and [d[v], f[v]] are entirely disjoint, and neither u nor v is a
descendant of the other in the depth-first forest,
2. The interval [d[u], f[u]] is contained entirely within the interval [d[v], f[v]], and u is a
descendant of v in a depth-first tree, or
3. The interval [d[v], f[v]] is contained entirely within the interval [d[u], f[u]], and v is a
descendant of u in a depth-first tree.
Proof
• We begin with case in which d[u] < d[v].
• There are two sub-cases, either d[v] < f[u] or d[v] > f[u] .
Case 1
• d[v] < f[u]  v discovered while u was still gray.
• This means v is a descendant of u.
• Since v was discovered more recently than u, all of its outgoing edges are explored, and
v is finished, before search finishes u.
• Hence d[u] < d[v] < f(v) < f(u) (part 3 is proved)

Case 2
• d[u] < d[v] (supposed)
• and f[u] < d[v] (by case 2)
• Hence intervals [d[u], f[u]] and [d[v], f[v]] disjoint.
• Because intervals are disjoint, neither vertex was discovered while the other was gray,
and so neither vertex is a descendant of the other.
• Now if we suppose d[v] < d[u], then again either
• Intervals will be disjoint OR
• Interval of v will contain interval of u.

Corollary (Nesting of Descendants’ Intervals)


Vertex v is a proper descendant of vertex u in the depth-first forest for a (directed or undirected)
graph G if and only if d[u] < d[v] < f[v] < f[u]

Proof
• Immediate from the above Theorem

Classification of Edges
The depth-first search can be used to classify the edges of the input graph G = (V, E).

• Tree edges
– These are edges in the depth-first forest Gπ.
– Edge (u, v) is a tree edge if v was first discovered by exploring edge (u, v).
• Back edges
– those edges (u, v) connecting a vertex u to an ancestor v in a depth first tree.
– Self-loops, which may occur in directed graphs, are considered to be back
edges.

Dr. Nazir Ahmad Zafar | Virtual University of Pakistan


224 CS-702 Advanced Algorithms Analysis and Design

• Forward edges
– Those nontree edges (u, v) connecting a vertex u to a descendant v in a depth-
first tree.

• Cross edges
– These are all other edges.
– They can go between vertices in the same depth-first tree, as long as one vertex
is not an ancestor of the other, or
– They can go between vertices in different depth-first trees.

Theorem
In a depth-first search of an undirected graph G, every edge of G is either a tree edge or back
edge.

Proof
• Let (u, v) an arbitrary edge of G, and suppose without loss of generality that d[u] < d[v].
• Then, v must be discovered and finished before we finish u (while u is gray), since v is
on u's adjacency list.
• If the edge (u, v) is explored first in direction from u to v, then v is undiscovered (white)
until that time, for otherwise we would have explored this edge already in the direction
from v to u.
• Thus, (u, v) becomes a tree edge.
• If (u, v) is explored first in the direction from v to u, then (u, v) is a back edge, since u is
still gray at the time the edge is first explored.

Conclusion
• Depth First Search Techniques is discussed
• Algorithms is designed
• Correctness of Depth First Search is given
• Topological sort and its benefits
• Computing strongly connected components
• Applications and Conclusion

Dr. Nazir Ahmad Zafar | Virtual University of Pakistan


225 CS-702 Advanced Algorithms Analysis and Design

Lecture 30
Proof (White Path Theorem)
Applications of Depth First Search

Classification of Edges

Theorem: White-Path Theorem


In a depth-first forest of a (directed or undirected) graph G = (V, E), vertex v is a descendant of
vertex u if and only if at the time d[u] that the search discovers u, vertex v can be reached from
u along a path consisting entirely of white vertices.

Proof:
• Assume that v is a descendant of u.
• Let w be any vertex on the path between u and v in depth-first tree, so that w is a
descendant of u
• As d[u] < d[w], and so w is white at time d[u].
• Second part is proved by contradiction
• Suppose that vertex v is reachable from u along a path of white vertices at time d[u], but
v does not become a descendant of u in the depth-first tree.
• Without loss of generality, assume that every other vertex along the path becomes a
descendant of u.
• (Otherwise, let v be the closest vertex to u along the path that doesn't become a
descendant of u.)
• Let w be predecessor of v in the path, so that w is a descendant of u (w, u may be same)
by Corollary above f[w] ≤ f[u]. (1)
• Note v must be discovered after u is discovered, d[u] < d[v] (2)
• but v must be discovered before w is finished. d[v] < f[w] (3)
• Therefore, by (1), (2) and (3) d[u] < d[v] < f[w] ≤ f[u].
• Above Theorem implies that interval [d[v],f[v]] contained entirely within interval [d[u],f[u]].
• By Corollary above, v must be a descendant of u.

Dr. Nazir Ahmad Zafar | Virtual University of Pakistan


226 CS-702 Advanced Algorithms Analysis and Design

Topological Sort
• A Topological Sort of a directed acyclic graph, or a “dag” G = (V, E) is a linear ordering
of all its vertices such that
– if G contains an edge (u, v), then u appears before v in the ordering.
• It is ordering of its vertices along a horizontal line so that all directed edges go from left
to right
• The depth-first search can be used to perform a topological sort of a dag.

TOPOLOGICAL-SORT (G)
1. Call DFS(G) to compute f [v] of each vertex v ᶆ V.
2. Set an empty linked list L = Ø.
3. When a vertex v is colored black, assign it f (v).
4. Insert v onto the front of the linked list, L = {v}.L.
5. Return the linked list.
6. The rank of each node is its position in the linked list started from the head of the list.
Total Running Time =  (V + E)

Example: Topological Sort

Ordering w. r. t. Finishing Time: Topological Sort

Dr. Nazir Ahmad Zafar | Virtual University of Pakistan


227 CS-702 Advanced Algorithms Analysis and Design

Lemma
A directed graph G is acyclic if and only if a depth-first search of G yields no back edges.

Proof

: G is acyclic.
• Suppose that there is a back edge (u, v).
• Then, vertex v is an ancestor of u in DF forest.
• There is thus a path from v to u in G, and the back edge (u, v) completes a cycle.
• G is cyclic and hence a contradiction,
• Our supposition is wrong and
• Hence G has no back edge

: If DFS yields no back edges G has no cycle


• We prove it by contra positive
• We prove that if G contains a cycle c the DFS of G yields a back edge.
• Let G has a cycle c.
• Let v be the first vertex to be discovered in c, and let (u, v) be the preceding edge in c.
• At time d[v], the vertices of c form a path of white vertices from v to u.
• By the white-path theorem, vertex u becomes a descendant of v in the depth-first forest.
Therefore, (u, v) is a back edge.

Dr. Nazir Ahmad Zafar | Virtual University of Pakistan


228 CS-702 Advanced Algorithms Analysis and Design

Theorem
TOPOLOGICAL-SORT (G) produces a topological sort of a directed acyclic graph G .

Proof
• Let DFS is run on G to determine finishing times.
• It sufficient to show that for any two distinct u, v  V, if there is an edge in G from u to v,
then f[v] < f[u]
• Consider any edge (u, v) explored by DFS(G).
• When (u, v) is explored, v is gray, white or black

Case 1
• v is gray. v is ancestor of u. (u, v) would be a back edge. It contradicts the above
Lemma.

Case 2
• If v is white, it becomes a descendant of u, and hence f[v] < f[u].

Case 3
• If v is black, it has already been finished, so that f[v] has already been set.
• Because we are still exploring from u, we have yet to assign a timestamp to f[u] to u, and
so once we do, we will have f[v] < f[u] as well.

Thus, for any edge (u, v) in the dag, we have f[v] < f[u]. It proves the theorem.

Strongly Connected Components


• A strongly connected component of a directed graph G = (V, E) is a maximal set of
vertices C  V such that for every pair of vertices u and v in C, we have
– u v, v is reachable from u.
– v u; u is reachable from v.
• The depth-first search can be used in decomposing a directed graph into its strongly
connected components.

Transpose of a Graph
• The strongly connected components of a graph G = (V, E) uses the transpose of G,
which is defined as
GT = (V, ET), where
ET ={(u, v) : (v, u)  E}
T
E consists of the edges of G with reversed directions.
• G and GT have exactly the same strongly connected components
– u and v are reachable from each other in G if and only if they are reachable from
each other in GT.

Dr. Nazir Ahmad Zafar | Virtual University of Pakistan


229 CS-702 Advanced Algorithms Analysis and Design

STRONGLY-CONNECTED-COMPONENTS (G)
1 call DFS(G), to compute the finish time f [u] of each vertex u
2 Compute GT.
3 Call DFS (GT), but in the main loop of DFS, consider the vertices in order of decreasing
f[u]. (as computed in line 1)
4 Output of the vertices of each tree in the depth-first forest formed in line 3 as a separate
strongly connected component.

Total Running Time = * (V + E)

Dr. Nazir Ahmad Zafar | Virtual University of Pakistan


230 CS-702 Advanced Algorithms Analysis and Design

Component Graph

• The component graph GSCC = (VSCC, ESCC)


– VSCC = {v1, v2, …, vk}, where vi corresponds to each strongly connected
component Ci
– There an edge (vi, vj)  ESCC if G contains a directed edge (x, y) for some x  Ci
and y  Cj
• The component graph is a DAG Lemma

Lemma 1
• Let C and C‟ be distinct SCC‟s in G
• Let u, v  C, and u‟, v‟  C‟
• Suppose there is a path u  u‟ in G
• Then there cannot also be a path v‟  v in G.
Proof
• Suppose there is path v‟ v
• There exists u u‟ v‟
• There exists v‟ v u
• u and v‟ are reachable from each other, so they are not in separate SCC‟s: contradiction!

Notations

Dr. Nazir Ahmad Zafar | Virtual University of Pakistan


231 CS-702 Advanced Algorithms Analysis and Design

Notations: Vertices to SCC


• d and f times of vertices of SCC
• Let U  V, a SCC
– d(U) = minuU { d[u] } (earliest discovery time)
– f(U) = max uU { f[u] } (latest finishing time)

Lemma 2
• Let C and C‟ be distinct SCCs in a directed graph G = (V, E). If there is an edge (u, v) 
E, where u  C and v  C‟ then f(C) > f(C‟).

Proof
• Consider C1 and C2, connected by edge (u, v)
• There are two cases, depending on which strongly connected component, C or C′, had
the first discovered vertex during the depth-first search

Case 1
• If d(C) < d(C′), let x be the first vertex discovered in C. At time d[x], all vertices in C and
C′ are white.
• There is a path in G from x to each vertex in C consisting only of white vertices.
• Because (u, v)  E, for any vertex w  C′, there is also a path at time d[x] from x to w in
G consisting only of white vertices: x u v w.
• By the white-path theorem, all vertices in C and C′ become descendants of x in the
depth-first tree. By Corollary, f[x] = f(C) > f(C′).

Case 2
• d(C) > d(C′) (supposition)
• Now (u, v)  E, where u  C and v  C‟ (given)
• Let y be the first vertex discovered in C′.
• At time d[y], all vertices in C′ are white and there is a path in G from y to each vertex in
C′ consisting only of white vertices.
• By the white-path theorem, all vertices in C′ become descendants of y in the depth-first
tree, and by Corollary, f[y] = f(C′).

Dr. Nazir Ahmad Zafar | Virtual University of Pakistan


232 CS-702 Advanced Algorithms Analysis and Design

• At time d[y], all vertices in C are white. Since there is an edge (u, v) from C to C′, Lemma
implies that there cannot be a path from C′ to C.
• Hence, no vertex in C is reachable from y.
• At time f[y], therefore, all vertices in C are still white.
• Thus, for any vertex w  C, we have f[w] > f[y], which implies that f(C) > f(C′).

Corollary
Let C and C′ be distinct strongly connected components in directed graph G = (V, E). Suppose
that there is an edge (u, v)  ET, where u  C and v  C′. Then f(C) < f(C′)

Proof
• Since (u, v)  ET, we have (v, u)  E.
• Since strongly connected components of G and GT are same, Lemma implies that f(C) <
f(C′).

Theorem: Correctness of SCC Algorithm


STRONGLY-CONNECTED-COMPONENTS (G) correctly computes SCCs of a directed graph
G.

Proof
• We argue by induction on number of DF trees of GT that “vertices of each tree form a
SCC”.
• The basis for induction, when k = 0, is trivial.
• Inductive hypothesis is that, first k trees produced by DFS of GT are strongly connected
components.
• Now we prove for (k+1)st tree produced from GT, i.e. vertices of this tree form a SCC.
• Let root of this tree be u, which is in SCC C.
• Now, f[u] = f(C) > f(C′),  C′ yet to be visited and  C
• By inductive hypothesis, at the time search visits u, all other vertices of C are white.
• By white-path theorem, all other vertices of C are descendants of u in its DF tree.
• Moreover, by inductive hypothesis and by Corollary above, any edges in GT, that leave C
must be, to SCCs that have already been visited.
• Thus, no vertex in any SCC other than C will be a descendant of u during the DFS of GT.
• Thus, vertices of DF tree in GT rooted at u form exactly one SCC.

Dr. Nazir Ahmad Zafar | Virtual University of Pakistan


233 CS-702 Advanced Algorithms Analysis and Design

Lecture No. 31
Backtracking and Branch & Bound
Algorithms
Today Covered
• Why backtracking? – Knapsack Problem
• What is backtracking? – The Queens Problem
• Backtracking • Branch and bound technique
– Solution Spaces – Assigning Task to Agents

Why BackTracking?
• When the graph is too large
– Depth and breadth-first techniques are infeasible
• In this approach if node searched for
– is found out that cannot exist in the branch then
– return back to previous step and continue the search to find the required node
• What is backtracking?

What is BackTracking?
• Backtracking is refinement of Brute Force approach
• It is a technique of constraint satisfaction problems
• Constraint satisfaction problems are with complete solution, where elements order does
not matter.
• In backtracking, multiple solutions can be eliminated without examining, by using specific
properties
• Backtracking closely related to combinatorial search
• There must be the proper hierarchy in produces
• When a node is rejected, whole sub-tree rejected, and we backtrack to the ancestor of
node.
• Method is not very popular, in the worst case, it takes an exponential amount of time to
complete.

Dr. Nazir Ahmad Zafar | Virtual University of Pakistan


234 CS-702 Advanced Algorithms Analysis and Design

Solution Spaces
• Solutions are represented by vectors (v1, ..., vm) of values. If Si is the domain of vi, then
S1 × ... × Sm is the solution space of the problem.
• Approach
– It starts with an empty vector.
– At each stage it extends a partial vector with a new value
– Upon reaching a partial vector (v1, ..., vi, v) which can‟t represent a partial
solution, the algorithm backtracks by removing the trailing value from the vector,
and then proceeds by trying to extend the vector with alternative values.

General Algorithm: Solution Spaces


ALGORITHM try(v1,...,vi)
IF (v1,...,vi) is a solution
THEN RETURN (v1,...,vi)
FOR each v DO
IF (v1,...,vi,v) is acceptable vector
THEN
sol = try(v1,...,vi,v)
THEN RETURN sol

Knapsack: Feasible Solutions


• Partial solution is one in which only first k items have been considered.
– Solution has form Sk = {x1, x2,…, xk}, 1 ≤ k < n.
– The partial solution Sk is feasible if and only if
k

w x
i 1
i i C

– If Sk is infeasible, then every possible complete solution containing Sk is also


infeasible.

Knapsack Example: Backtracking


Maximum Capacity = 8

(2,2,3;11) means that two elements of each weight 2 and one element of weight 3 is with total
value 11

Dr. Nazir Ahmad Zafar | Virtual University of Pakistan


235 CS-702 Advanced Algorithms Analysis and Design

Knapsack Algorithm: Backtracking


BackTrack(i, r) \\ BackTrack(1, C)
b0
{try each kind of item in tern}
for k  i to n
do
if w(k) ≤ r then
b  max (b, v[k] + BackTrack(k, r - w[k]))
return b

Dr. Nazir Ahmad Zafar | Virtual University of Pakistan


236 CS-702 Advanced Algorithms Analysis and Design

Lecture No. 32
Minimal Spanning Tree Problem

Today Lecture Covers


• Importance of Minimal Spanning – Algorithm
Trees (MST) – Analysis
• MST Problem • Prim‟s Algorithm
– Definitions and analysis – Algorithm
– Generic Solution – Analysis
– Proofs of correctness • Conclusion
• Kruskal‟s Algorithm

Minimum Spanning Tree


• Given a graph G = (V, E) such that
– G is connected and undirected
– w(u, v) weight of edge (u, v)
– T is a Minimum Spanning Tree (MST) of G if
– T is acyclic subset of E (T E)
– It connects all the vertices of G and
– Total weight, w(T) = 
(u , v )  T
w(u, v) is minimized

Example of MST
• Minimum spanning trees are not unique
– If we replace (b, c) with (a, h), get a different spanning tree with the same cost
• MST have no cycles
– We can take out an edge of
– a cycle, and still have the
– vertices connected while reducing the cost

Generic Solution : To Compute MST


Minimum-spanning-tree problem: Find a MST for a connected, undirected graph, with a weight
function associated with its edges

Dr. Nazir Ahmad Zafar | Virtual University of Pakistan


237 CS-702 Advanced Algorithms Analysis and Design

A generic solution:
• Build a set A of edges
(initially empty)
• Incrementally add edges to A such that they would belong to a MST
• An edge (u, v) is safe for A  A  {(u, v)} is also a subset of some MST

How to Find Safe Edge?


• Let us look at edge (h, g)
– Is it safe for A initially?
– Let S  V be any set of vertices that includes h but not g (so that g is in V - S)
– In any MST, there has to be one edge (at least) that connects S with V - S
– Why not choose edge with minimum weight (h, g)

Generic Algorithm: Minimum Spanning Tree

GENERIC-MST(G, w)
1 A←Ø
2 while A does not form a spanning tree
3 do find an edge (u, v) that is safe
for A
4 A ← A  {(u, v)}
5 return A

Dr. Nazir Ahmad Zafar | Virtual University of Pakistan


238 CS-702 Advanced Algorithms Analysis and Design

Strategy: Growing Minimum Spanning Tree


• The algorithm uses greedy strategy which grows MST one edge at a time.
• Given a connected, undirected graph G = (V, E) with a weight function w : E ↗ R
• Algorithm manages a set of edges A, maintaining loop invariant
• Prior to each iteration, A is a subset of some MST
• An edge (u, v) is a safe edge for A such that A  {(u, v)} is also a subset of some MST.
• Algorithms, discussed here, to find safe edge are
– Kruskal‟s Algorithm
– Prim‟s Algorithm

Definitions (Kruskal’s Algorithm)


• A cut (S, V-S) of an undirected graph is a partition of V
• An edge crosses the cut (S, V-S) if one of its endpoints is in S and the other is in V-S.
• A cut respects set A of edges if no edge in A crosses cut.
• An edge is a light edge crossing a cut if its weight is the minimum of any edge crossing
the cut.

Theorem (Kruskal’s Algorithm)


Let G = (V, E) be a connected, undirected graph with a real-valued weight function w on E. Let
A be a subset of E that is included in some minimum spanning tree for G, let (S, V -S) be any
cut of G that respects A, and let (u, v) be a light edge crossing (S, V - S). Then, edge (u, v) is
safe for A.

Proof
• Let T be a minimum spanning tree
that includes A (edges of A are
shaded),

• Assume that T does not contain the


light edge (u, v), since if it does, we
are done.

Dr. Nazir Ahmad Zafar | Virtual University of Pakistan


239 CS-702 Advanced Algorithms Analysis and Design

Construction of another MST


• For (u, v)  T
• We construct another MST T′ that includes A  {(u, v)} by cut-and-paste, and showing
that (u, v) is a safe A.
• Since (u, v) crosses cut set (S, V-S) and
• (u, v)  T,
• Hence there must be an edge (x, y)  T which crosses the cut set
• By removing (x, y) breaks T into two components.
• Adding (u, v) reconnects them to form a new spanning tree T′ = T - {(x, y)}  {(u, v)}.

Show that T′ is a minimum spanning tree.


• Since (u, v) is a light edge crossing (S, V - S) and (x, y) also crosses this cut, w(u, v) ≤
w(x, y).
• Hence, w(T′) = w(T) - w(x, y) + w(u, v) ≤ w(T).
• But T is a MST, so that w(T) ≤ w(T′); thus, T′ must be a minimum spanning tree also.

Show that (u, v) is safe for A: (u, v) can be part of MST


• Now (x, y) is not in A, because the cut respects A.
• Since A  T and (x, y)  A  A  T - {(x, y)}
• A  {(u, v)}  T- {(x, y)}  {(u, v)} = T‟
• Since T‟ is an MST  (u, v) is safe for A

Kruskal’s Algorithm

MST-KRUSKAL (G, w)
1 A←Ø
2 for each vertex v V[G]
3 do MAKE-SET(v)
4 sort edges in non-decreasing order by weight w
5 for each (u, v) in non-decreasing order by weight
6 do if FIND-SET(u) ≠ FIND-SET(v)
7 then A ← A  {(u, v)}
8 UNION (u, v)
9 return A

Total Running time = O (E lg V),

Dr. Nazir Ahmad Zafar | Virtual University of Pakistan


240 CS-702 Advanced Algorithms Analysis and Design

Kruskal’s Algorithm

Edges Weight Edges Weight


(g, h) 1 (h, i) 7
(c, i) 1 (a, h) 8
(f, g) 2 (b, c) 8
(a, b) 4 (d, e) 9
(c, f) 4 (e, f) 10
(g, i) 6 (b h) 11
(c, d) 7 (d, f) 14
Initial sets = {a}, {b}, {c}, {d}, {e}, {f}, {g}, {h},
{i}
Initial sets = {a}, {b}, {c}, {d}, {e}, {f}, {g}, {h},
{i}
Final sets = {a}, {b}, {c}, {d}, {e}, {f}, {g, h},
{i}

A=
(g, h) is the least weight edge
FIND-SET (g) ≠ FIND-SET (h)
A ≡ A  {(g, h)}
UNION (g, h)

Initial sets = {a}, {b}, {c}, {d}, {e}, {f}, {g, h},
{i}
Final sets = {a}, {b}, {c, i}, {d}, {e}, {f}, {g, h}

(c, i) is the least weight edge


FIND-SET (c) ≠ FIND-SET (i)
A ≡ A  {(c, i)}
UNION (c, i)

Initial sets = {a}, {b}, {c, i}, {d}, {e}, {f}, {g, h}
Final sets = {a}, {b}, {c, i}, {d}, {e}, {f, g, h}

(f, g) is the least weight edge


FIND-SET (f) ≠ FIND-SET (g)
A ≡ A  {(f, g)}
UNION (f, g)

Dr. Nazir Ahmad Zafar | Virtual University of Pakistan


241 CS-702 Advanced Algorithms Analysis and Design

Initial sets = {a}, {b}, {c, i}, {d}, {e}, {f, g, h}


Final sets = {a, b}, {c, i}, {d}, {e}, {f, g, h}

(a, b) is the least weight edge


FIND-SET (a) ≠ FIND-SET (b)
A ≡ A  {(a, b)}
UNION (a, b)

Initial sets = {a, b}, {c, i}, {d}, {e}, {f, g, h}


Final sets = {a, b}, {c, f, g, h , i}, {d}, {e}

(c, f) is the least weight edge


FIND-SET (c) ≠ FIND-SET (f)
A ≡ A  {(c, f)}
UNION (c, f)

Initial sets = {a, b}, {c, f, g, h, i}, {d}, {e}


Final sets = {a, b}, {c, f, g, h, i}, {d}, {e}

(g, i) is the least weight edge


FIND-SET (g) = FIND-SET (i)

Initial sets = {a, b}, {c, f, g, h, i}, {d}, {e}


Final sets = {a, b}, {c, d, f, g, h, i}, {e}

(c, d) is the least weight edge


FIND-SET (c) ≠ FIND-SET (d)
A ≡ A  {(c, d)}
UNION (c, d)

Dr. Nazir Ahmad Zafar | Virtual University of Pakistan


242 CS-702 Advanced Algorithms Analysis and Design

Initial sets = {a, b}, {c, d, f, g, h , i}, {e}


Final sets = {a, b}, {c, f, d, g, h , i}, {e}

(h, i) is the least weight edge


FIND-SET (h) = FIND-SET (i)

Initial sets = {a, b}, {c, d, f, g, h, i}, {e}


Final sets = {a, b, c, d, f, g, h , i}, {e}
(a, h) is the least weight edge
FIND-SET (a) ≠ FIND-SET (h)
A ≡ A  {(a, h)}
UNION (a, h)

Initial sets = {a, b, c, d, f, g, h , i}, {e}


Final sets = {a, b, c, d, f, g, h , i}, {e}

(b, c) is the least weight edge


FIND-SET (b) = FIND-SET (c)

Initial sets = {a, b, c, d, f, g, h , i}, {e}


Final sets = {a, b, c, d, e, f, g, h , i}

(d, e) is the least weight edge


FIND-SET (d) ≠ FIND-SET (e)
A ≡ A  {(d, e)}
UNION (d, e)

Dr. Nazir Ahmad Zafar | Virtual University of Pakistan


243 CS-702 Advanced Algorithms Analysis and Design

Initial sets = {a, b, c, d, e, f, g, h , i}


Final sets = {a, b, c, d, e, f, g, h , i}

(e, f) is the least weight edge


FIND-SET (e) = FIND-SET (f)

Initial sets = {a, b, c, d, e, f, g, h, i}


Final sets = {a, b, c, d, e, f, g, h, i}

(b, h) is the least weight edge


FIND-SET (b) = FIND-SET (h)

Initial sets = {a, b, c, d, e, f, g, h, i}


Final sets = {a, b, c, d, e, f, g, h , i}

(d, f) is the least weight edge


FIND-SET (d) = FIND-SET (f)

Correctness of Kruskal’s Algorithm


• Used to determine the safe edge of GENERIC-MST
• The algorithm manages set of edges A which always form a single tree.
• The tree starts from an arbitrary vertex r and grows until tree spans all the vertices in V.
• At each step, a light edge added to the tree A that connects A to an isolated vertex of GA
= (V, A)
• It is a greedy algorithm
– At each step tree is augmented with an edge that contributes least possible
amount to tree‟s weight
• Since vertices, of each edge considered, are in different sets hence no cycle is created.

Dr. Nazir Ahmad Zafar | Virtual University of Pakistan


244 CS-702 Advanced Algorithms Analysis and Design

Prim’s Algorithm
MST-PRIM (G, w, r)
1 for each u  V [G]
2 do key[u] ← ∞
3 π[u] ← NIL
4 key[r] ← 0
5 Q ← V [G]
6 while Q ≠ Ø
7 do u ← EXTRACT-MIN(Q)
8 for each v  Adj[u]
9 do if v  Q and w(u, v) < key[v]
10 then π[v] ← u
11 key[v] ← w(u, v)

• The performance depends on the implementation of min-priority queue Q.


• Using binary min-heap Total Running time = O (E lg V)
• Using fibonacci heaps Total Running time = O (E + V lg V)

For each vertex u  V(G)


key[u] ≡ ∞
π [u] ≡ NIL
Considering a as root node
key[a] ≡ 0

Dr. Nazir Ahmad Zafar | Virtual University of Pakistan


245 CS-702 Advanced Algorithms Analysis and Design

a ≡ EXTRACT-MIN(Q)
Adj[a] = b, h
b  Q and
w(a, b) < key[b] (4 < ∞)
π[b] ≡ a
key[b] ≡ w(a, b) = 4
h  Q and
w(a, h) < key[h] (8 < ∞)
π[h] ≡ a
key[h] ≡ w(a, h) = 8

b ≡ EXTRACT-MIN(Q)
Adj[b] = a, c, h
a↗Q
c  Q and
w(b, c) < key[c] (8 < ∞)
π[c] ≡ b
key[c] ≡ w(b, c) = 8
h  Q and
w(b, h) < key[h]
(but 11 > 8)

c ≡ EXTRACT-MIN(Q)
Adj[c] = b, d, f, i
b↗Q
d  Q and
w(c, d) < key[d] (7 < ∞)
π[d] ≡ c
key[d] ≡ w(c, d) = 7
f  Q and
w(c, f) < key[f] (4 < ∞)
π[f] ≡ c
key[f] ≡ w(c, f) = 4
i  Q and
w(c, i) < key[i] (2 < ∞)
π[i] ≡ c
key[i] ≡ w(c, i) =

Dr. Nazir Ahmad Zafar | Virtual University of Pakistan


246 CS-702 Advanced Algorithms Analysis and Design

i ≡ EXTRACT-MIN(Q)
Adj[i] = c, g, h
c↗Q
g  Q and
w(i, g) < key[g] (6 < ∞)
π[g] ≡ I
key[g] ≡ w(i, g) = 6
h  Q and
w(i, h) < key[h] (7 < 8)
π[h] ≡ I
key[h] ≡ w(i, h) = 7

f ≡ EXTRACT-MIN(Q)
Adj[f] = c, d, e, g
c↗Q
d  Q and
w(f, d) < key[d]
But (14 < 7)
e  Q and
w(f, e) < key[e] (10 < ∞)
π[e] ≡ f
key[e] ≡ w(f, e) = 10
g  Q and
w(f, g) < key[g] (2 < 6)
π[g] ≡ f
key[g] ≡ w(f, g) = 2

g ≡ EXTRACT-MIN(Q)
Adj[g] = f, h, i
f↗Q
h  Q and
w(g, h) < key[h] (1 < 7)
π[h] ≡ g
key[h] ≡ w(g, h) = 1
i↗Q

Dr. Nazir Ahmad Zafar | Virtual University of Pakistan


247 CS-702 Advanced Algorithms Analysis and Design

h ≡ EXTRACT-MIN(Q)
Adj[h] = a, b, g, i
a↗Q
b↗Q
g↗Q
I↗Q

d ≡ EXTRACT-MIN(Q)
Adj[d] = c, e, f
c↗Q
e  Q and
w(d, e) < key[e] (9 < 10)
π[e] ≡ d
key[e] ≡ w(d, e) = 9
f↗Q

e ≡ EXTRACT-MIN(Q)
Adj[e] = d, f
d↗Q
f↗Q

Dr. Nazir Ahmad Zafar | Virtual University of Pakistan


248 CS-702 Advanced Algorithms Analysis and Design

Importance of Minimal Spanning Trees


There are various applications of Minimal Spanning Trees (MST). Let us consider a couple of
real-world examples

• One practical application would be in designing a network.


– For example, a group of individuals, separated by varying distances, are to be
connected in a telephone network.
– Although MST cannot do anything about distance from one connection to another,
but it can reduce connecting cost.
• Another useful application of it is finding airline routes.
– The vertices of the graph would represent cities, and the edges would represent
routes between the cities.
– Obviously, more traveling require more cost
– Hence MST can be applied to optimize airline routes by finding the least costly paths
with no cycles.

Dr. Nazir Ahmad Zafar | Virtual University of Pakistan


249 CS-702 Advanced Algorithms Analysis and Design

Lecture No. 33
Single-Source Shortest Path

Today Covered
• Road map problem – Relaxation property
• Linking road map problem with – Algorithm design and
graph theory analysis
• Paths and Shortest paths – Proof of correctness
• Cycles and their role in finding • Applications
shortest paths • Conclusion
• The Bellman-Ford Algorithm
– Initialization of graphs

Road Map Problem


• We are given a road map on which the distance between each pair of adjacent cities is
marked, and our goal is to determine the shortest route from one city to another.
• The number of possible routes can be huge.
• How do we choose which one routes is shortest?
• This problem can be modelled as a graph
• And then we can find the shortest path from one city to another using graph algorithms.
• How to solve this problem efficiently?

Linking Road Map with Graph Theory

Road map problem


• This problem can be modeled as a graph problem
• Road map is a weighted graph:
set of vertices = set of cities
set of edges = road segments between cities
edge weight = length between two cities
– Goal: find a shortest path between two vertices i.e. between two cities

Weight of a Path
• In a shortest path problem, a weighted, directed graph G = (V, E) is given with weight
function
w : E ↗ R mapping edges to real-valued weights.
• The weight of path p = v0 , v1 ,..., vk  is the sum of the weights of its constituents edges
k
w( p)   w(vi 1 , vi )
i 1

 w(v0 , v1 )  w(v1 , v2 )  ...  w(vk 1 , vk )

Dr. Nazir Ahmad Zafar | Virtual University of Pakistan


250 CS-702 Advanced Algorithms Analysis and Design

Shortest Path
• A shortest path from vertex u to v is denoted by δ (u, v) and is defined as
min{w ( p) : u 
p
 v} if there is a path from u to v
 (u, v)  
 otherwise

• Weight of edges can represent any metric such as


– Distance, – penalty,
– time, – loss etc.
– cost,

Variants of Shortest Path


• Single-source shortest path
– G = (V, E)  find a shortest path from a given source vertex s to each vertex v 
V
• Single-destination shortest path
– Find a shortest path to a given destination vertex t from each vertex v
– Reverse the direction of each edge  single-source
• Single-pair shortest path
– Find a shortest path from u to v for given vertices u and v
– Solve the single-source problem
• All-pairs shortest-paths
– Find shortest path for every pair of vertices u and v of G

Lemma : subpath of a shortest path, a shortest path


Statement
Given a weighted, directed graph G = (V, E) with weight function w : E → R, let p = ↖ v1, v2,..., vk
↑ be a shortest path from vertex v1 to vertex vk, for any i, j such that 1 ≤ i ≤ j ≤ k, let pij = ↖ vi,
vi+1,..., vj ↑ be subpath of p from vi to vertex vj. Then, pij is a shortest path from vi to vj.

Proof
• We prove this lemma by contradiction
• If we decompose path p into v1 ₰p1i vi ₰pij vj ₰pjk vk, then we have that w(p) = w(p1i) + w(pij)
+ w(pjk)
• Now, assume that there is a path p‟ij from vi to vj with weight w(p‟ij) < w(pij)
• That is there is a subpath p‟i,j from vi to vertex vj which is shortest than pi,j
• Then, v1 ₰p1i vi ₰pij vj ₰pjk vk is a path from vertices v1 to vk whose weight w(p1i) + w(p‟ij) +
w(pjk) is less than w(p).
• It contradicts the assumption that p is a shortest path from v1 to vk.
• Hence subpath of a given shortest path is also a shortest path.

Dr. Nazir Ahmad Zafar | Virtual University of Pakistan


251 CS-702 Advanced Algorithms Analysis and Design

Why Positive Cycle Not?


• s  a: only one path
(s, a) = w(s, a) = 3
• s  b: only one path
(s, b) = w(s, a) + w(a, b) = -1
• s  c: infinitely many paths
s, c, s, c, d, c, s, c, d, c, d, c
• cycle has positive weight (6 - 3 = 3)
s, c shortest path with weight
(s, c) = w(s, c) = 5,
• Positive cycle increases length of paths

Why Negative Cycle Not?


• s  e: infinitely many paths:
– s, e, s, e, f, e, s, e, f, e, f, e etc.
– cycle e, f, e has negative weight:
3 + (- 6) = -3
– paths from s to e with arbitrarily large
negative weights
– (s, e) =-   no shortest path exists
between s and e
– Similarly: (s, f) = - , (s, g) = - 

Removing cycles from shortest paths


• If p = v0 , v1 ,..., vk  is a path and c = vi , vi 1 ,..., v j  is a positive weight cycle on this path
then the path p‟ = v0 , v1 , ..., vi , v j 1 , v j  2 , ..., vk  has weight w(p‟) = w(p) – w(c) < w(p), and
so p cannot be a shortest path from v0 to vk
• As long as a shortest path has 0-weight cycles, we can repeatedly remove these cycles
from path until a cycle-free shortest path is obtained.

When is no shortest path?


• There may be edges with negative weight.
• A cycle p = v0,v1,…,vk,v0 is a negative cycle such that w(p) < 0
• If a graph G = (V, E) contains no negative weight cycle reachable from the source s,
then for all v  V, shortest path δ(s, v) remains well defined.
• If there is a negative weight cycles reachable from s, then shortest path weight is not
well defined.
• If there is a path from u to v that contains a negative cycle, then shortest path is defined
as (u, v) = -

Dr. Nazir Ahmad Zafar | Virtual University of Pakistan


252 CS-702 Advanced Algorithms Analysis and Design

Summary of cycles in SPP


• Can shortest paths contain cycles?
• Negative-weight cycles:
• Positive-weight cycles:
– By removing the cycle we can get a shorter path
• Zero-weight cycles
– No reason to use them
– Can remove them to obtain a path with similar weight
Note
• We will assume that when we are finding shortest paths, the paths will have no cycles

Representing Shortest Paths


• For a graph G=(V, E) , a predecessor π[v] is maintained for each vertex v  V
– Either vertex or NIL
– We are interested in predecessor subgraph Gπ=(Vπ , Eπ ) induced by π values,
such that
Vπ = {v  V : π[v] ≠ NIL} {s}
Eπ = {(π[v], v)  E : v  Vπ - {s}}

Shortest Path Rooted Tree


• Let G = (V, E) be a weighted, directed graph with weight function w : E ↗ R and assume
that G contains no negative weight cycles reachable from the source vertex s  V, so
that shortest paths are well defined.
• A shortest path tree rooted at s is a directed subgraph G‟=(V‟, E‟), where V‟ V and E‟
E
• Shortest path are not necessarily unique and neither are shortest path trees.

Shortest path not unique


• Shortest path are neither necessarily
– unique and
– nor shortest path trees

Dr. Nazir Ahmad Zafar | Virtual University of Pakistan


253 CS-702 Advanced Algorithms Analysis and Design

Initialization and Relaxation


Initialization
• All the shortest-paths algorithms start with initialization of vertices.

Relaxation
• For each vertex v  V, an attribute d[v] is defined and called a shortest path estimate,
maintained
– which is in fact, an upper bound on the weight of a shortest path from source s to
v
• Process of relaxing an edge (u, v) consists of testing whether we can improve shortest
path to v found so far, through u, if so update d[v] and π[v].

Relaxation
• Relaxing edge (u, v), testing whether we can improve shortest path to v found so far
through u
– If d[v] > d[u] + w(u, v)
– we can improve the shortest path to v
–  update d[v] and [v]

Initialization and Relaxation


INITIALIZE-SINGLE-SOURCE (G, s) RELAX (u, v, w)
1 for each vertex v  V[G] 1 if d[v] > d[u] + w(u, v)
2 do d[v] ← ∞ 2 then d[v] ← d[u] + w(u, v)
3 π[v] ← NIL 3 π[v] ← u
4 d[s] ≡ 0

Running time = (V)

Note:
All the single-source shortest-paths algorithms, start by calling INIT-SINGLE-SOURCE then
relax edges. The algorithms differ in the order and how many times they relax each edge

Dr. Nazir Ahmad Zafar | Virtual University of Pakistan


254 CS-702 Advanced Algorithms Analysis and Design

The Bellman-Ford Algorithm


Input:
• Weighted, directed graph G, edges may be negative with weight function w : E → R,
Output
• it returns boolean value indicating whether or not there is a negative-weight cycle
reachable from source.
• If there is such a cycle, it indicates no solution exists
• Else it produces shortest paths and their weights.

Note:
• It uses relaxation progressively decreasing estimate d[v] on weight of a shortest path
from source s to each vertex v V until it achieves actual SP weight δ(s, v).

BELLMAN-FORD (G, w, s)
1 INITIALIZE-SINGLE-SOURCE (G, s) (V)
2 for i ← 1 to |V [G]| - 1 (E)
3 do for each edge (u, v)  E[G]
4 do RELAX (u, v, w)
5 for each edge (u, v)  E[G] O(E)
6 do if d[v] > d[u] + w(u, v)
7 then return FALSE
8 return TRUE

Total Running Time = O(E)

For each vertex v  V(G)


d[v] ← ∞
π[v] ← NIL

Considering s as root node


d[s] ≡ 0

Dr. Nazir Ahmad Zafar | Virtual University of Pakistan


255 CS-702 Advanced Algorithms Analysis and Design

Considering edge (s, t)


d[t] > d[s] + w(s, t) (∞ > 0 + 6)
d[t] ← d[s] + w(s, t)
d[t] ← 0 + 6 = 6
π[t] ← s
Considering edge (s, y)
d[y] > d[s] + w(s, y) (∞ > 0 + 7)
d[y] ← d[s] + w(s, t)
d[y] ← 0 + 7 = 7
π[y] ← s

Considering edge (t, y)


d[y] > d[t] + w(t, y)
But (7 < 6 +8)
Considering edge (t, z)
d[z] > d[t] + w(t, z) (∞ > 6 +(-4))
d[z] ← d[t] + w(t, z)
d[z] ← 6 + (-4) = 2
π[z] ← t
Considering edge (y, x)
d[x] > d[y] + w(y, x) (∞ > 7 +(-3))
d[x] ← d[y] + w(y, x)
d[x] ← 7 + (-3) = 4
π[x] ← y

Considering edge (x, t)


d[t] > d[x] + w(x, t) (6 > 4 + (-2))
d[t] ← d[x] + w(x, t)
d[t] ← 4 + (-2) = 2
π[t] ← x
Considering edge (y, z)
d[z] > d[y] + w(y, z)
but (2 < 7 + 9)
Considering edge (z, x)
d[x] > d[z] + w(z, x)
but (4 < 2 + 7)
Considering (z, s)
d[s] > d[z] + w(z, s)
but (0 < 2 + 2)

Dr. Nazir Ahmad Zafar | Virtual University of Pakistan


256 CS-702 Advanced Algorithms Analysis and Design

Lemma 1
Let G = (V, E) be a weighted, directed graph with source s and weight function w : E → R, and
assume that G contains no negative-weight cycles that are reachable from s. Then, after the |V|
- 1 iterations of the for loop of lines 2-4 of BELLMAN-FORD, we have d[v] = δ(s, v) for all
vertices v that are reachable from s.

Proof
• We prove the lemma by appealing to the path-relaxation property.
• Consider any vertex v that is reachable from s, and let p = ↖ v0, v1,..., vk ↑, where v0 = s
and vk = v, be any acyclic shortest path from s to v.
• Path p has at most |V| - 1 edges, and so k ≤ |V| - 1.
• Each of the |V| - 1 iterations of the for loop of lines 2-4 relaxes all E edges.
• Among the edges relaxed in the ith iteration, for i = 1, 2,..., k, is (vi-1, vi).
• By the path-relaxation property, therefore, d[v] = d[vk] = δ(s, vk) = δ(s, v).

Theorem : Correctness of Bellman-Ford algorithm


Let BELLMAN-FORD be run on weighted, directed graph G = (V, E), with source vertex s, and
weight function w : E → R.
• If G contains no negative-weight cycles that are reachable from s, then
– d[v] = δ(s, v) for all vertices v  V, and
– the algorithm returns TRUE
– the predecessor subgraph Gπ is shortest-paths tree rooted at s.
• If G does contain a negative weight cycle reachable from s, then the algorithm returns
FALSE.

Proof:
Case 1
Suppose graph G contains no negative-weight cycles that are reachable from the source s.
• We first prove the claim that at termination, d[v] = δ(s, v) for all vertices v V .
– If v is reachable from s, Lemma above proves it.
– If v is not reachable from s, then the claim follows from the no-path property.
Thus, the claim is proven.
• The predecessor subgraph property, along with the claim, implies that Gπ is a shortest-
paths tree.
• Now we use the claim to show that BELLMAN-FORD returns TRUE.
– At termination, for all edges (u, v)
– d[v] = δ(s, v) ≤ δ(s, u) + w(u, v) = d[u] + w(u, v),
– It therefore returns TRUE

Case 2,
• Suppose that graph G contains a negative-weight cycle that is reachable from the
source s
• Let this cycle be c = ↖v0, v1,..., vk↑, where v0 = vk,

Dr. Nazir Ahmad Zafar | Virtual University of Pakistan


257 CS-702 Advanced Algorithms Analysis and Design

k
Then,  w(v
i 1
i 1 , vi )  0 (A)

• Assume for the purpose of contradiction that the Bellman-Ford algorithm returns TRUE.
• Thus, d[vi] ≤ d[vi-1] + w(vi-1, vi) for i = 1, 2,..., k.
• Summing the inequalities around cycle c gives us
k k

 d[vi ]   (d[vi 1 ]  w(vi 1 , vi ))


i 1 i 1
k k
  (d [vi 1 ]   w(vi 1 , vi )
i 1 i 1

• Since v0 = vk, each vertex in c appears exactly once in each of the summations and, and
so
k k

 d[vi ]   d[vi1 ]
i 1 i 1

• Of course d[vi] is finite for i = 1, 2,..., k. Thus,


k
0   w(vi 1 , vi )
i 1

• Which contradicts inequality (A). And hence it proves the theorem

Applications
Different applications of shortest path
• Transportation problems
– finding the cheapest way to travel between two locations
• Motion planning
– what is the most natural way for a cartoon character to move about a simulated
environment
• Communications problems
– how look will it take for a message to get between two places which two locations
are furthest apart i.e.
– what is the diameter of network

Dr. Nazir Ahmad Zafar | Virtual University of Pakistan


258 CS-702 Advanced Algorithms Analysis and Design

Lecture No. 34
Proof: Bellman-Ford Algorithm &
Shortest Paths in Directed Acyclic Graphs

Today Covered
• Bellman-Ford Algorithm – Assumptions
– Analysis – Algorithm
– Proof – Analysis
• Shortest path in Directed Acyclic – Proof of correctness
Graphs

Analysis: The Bellman-Ford Algorithm


BELLMAN-FORD (G, w, s)
1 INITIALIZE-SINGLE-SOURCE (G, s) (V)
2 for i ← 1 to |V [G]| - 1
3 do for each edge (u, v)  E[G] (V.E)
4 do RELAX (u, v, w)
5 for each edge (u, v)  E[G] O(E)
6 do if d[v] > d[u] + w(u, v)
7 then return FALSE
8 return TRUE

Total Running Time = O(V.E)

Lemma 1
Statement: Let G = (V, E) be
• directed, with source s,
• a weighted, with weight function w : E → R, and
• Contains no negative-weight cycle reachable from s. Then, after the |V| - 1 iterations of
the for loop of lines 2-4 of BELLMAN-FORD, we have d[v] = δ(s, v) for all vertices v that
are reachable from s.

Path relaxation property


• If p = ↖ v0, v1,..., vk ↑, be a shortest path from s = v0 to vk and edges of p are relaxed in
the order (v0, v1), (v1, v2) . . . (vk-1, vk), then d(vk) = δ(s, vk)

Proof
• We prove it using path-relaxation property.
• Consider any vertex v that is reachable from s
• And let p = ↖ v0, v1,..., vk ↑, be any acyclic shortest path from s to v, where v0 = s and vk
= v,
• As there are k+1 vertices in the path p, hence there must be k edges in p.
• Because Graph has |V| vertices and path p contains no cycle, hence path p has at most
|V| - 1 edges, and therefore, k ≤ |V| - 1.

Dr. Nazir Ahmad Zafar | Virtual University of Pakistan


259 CS-702 Advanced Algorithms Analysis and Design

• Each of the |V| - 1 iterations of the for loop of lines 2-4 relaxes all E edges.
• At i = 1, edge (v0, v1) is relaxed, and d[v1] = δ(s, v1)
• At i = 2, edge (v1, v2) is relaxed, and d[v2] = δ(s, v2)
• By mathematical induction we can prove that
• At i = k, edge (vk-1, vk) is relaxed, d[vk] = δ(s, vk)
• Hence all the edges (vi-1, vi) will be relaxed after the iterations, i = 1, 2,..., k.
• By the path-relaxation property, after kth iteration, d[v] = d[vk] = δ(s, vk) = δ(s, v).
• Hence we have proved the required result using path relaxation property.

Theorem : Correctness of Bellman-Ford algorithm


Let BELLMAN-FORD be run on weighted, directed graph G = (V, E), with source vertex s, and
weight function w : E → R.
• If G contains no negative-weight cycles that are reachable from s, then
– d[v] = δ(s, v) for all vertices v  V, and
– The algorithm returns TRUE
– The predecessor subgraph Gπ is shortest-paths tree rooted at s.
• If G does contain a negative weight cycle reachable from s, then the algorithm returns
FALSE.

Proof
Case 1
Suppose graph G contains no negative-weight cycles that are reachable from the source
s.
• We first prove the claim that at termination, d[v] = δ(s, v) for all vertices v V .
– If v is reachable from s, Lemma above proves it.
– If v is not reachable from s, then claim follows from no-path property.
• The predecessor subgraph property, along with the claim, implies that Gπ is a shortest-
paths tree.
(Once d[v] = δ(s, v) for all v  V, the predecessor sub-graph is a shortest paths tree
rooted at s)
• Now we use the claim to show that BELLMAN-FORD returns TRUE.
– At termination, for all edges (u, v)
– d[v] = δ(s, v) ≤ δ(s, u) + w(u, v) = d[u] + w(u, v),
– It therefore returns TRUE
Case 2,
• Suppose that graph G contains a negative-weight cycle that is reachable from the
source s
• Let this cycle be c = ↖v0, v1,..., vk↑, where v0 = vk,
k
Then,  w(v
i 1
i 1 , vi )  0 (A)

• Assume for the purpose of contradiction that the Bellman-Ford algorithm returns TRUE.
• Thus, d[vi] ≤ d[vi-1] + w(vi-1, vi) for i = 1, 2,..., k.
• Summing the inequalities around cycle c gives us

Dr. Nazir Ahmad Zafar | Virtual University of Pakistan


260 CS-702 Advanced Algorithms Analysis and Design

k k

 d[vi ]   (d[vi 1 ]  w(vi 1 , vi ))


i 1 i 1
k k
  (d [vi 1 ]   w(vi 1 , vi )
i 1 i 1

• Since v0 = vk, each vertex in c appears exactly once in each of the summations and, and
so
k k

 d[vi ]   d[vi1 ]
i 1 i 1

• Of course d[vi] is finite for i = 1, 2,..., k. Thus,


k
0   w(vi 1 , vi )
i 1

• Which contradicts inequality (A). And hence it proves the theorem

Shortest Paths in Directed Acyclic Graphs


• By relaxing edges of Directed Acyclic Graph (dag) G = (V, E) according to topological
sort of vertices single source shortest path can be computed in (V + E) time
• Shortest paths are always well defined in a dag
– Since even if there are negative-weight edges no negative weight cycle exists.
• It starts topologically sorting dag, to impose linear ordering of vertices.
– If there is path from u to v then u precedes v.
• Each vertex and each edge that leaves the vertex is processed that is why this approach
is well defined

Algorithm : Topological Sort


TOPOLOGICAL-SORT (G)
1. Call DFS(G) to compute f [v] of each vertex v  V.
2. Set an empty linked list L = Ø.
3. When a vertex v is colored black, assign it f (v).
4. Insert v onto the front of the linked list, L = {v}.L.
5. Return the linked list.
6. The rank of each node is its position in the linked list started from the head of the list.
Total Running Time = O(V + E)

Algorithm : Shortest Path (dag)


DAG-SHORTEST-PATHS (G, w, s)
1 topologically sort the vertices of G O (V+E)
2 INITIALIZE-SINGLE-SOURCE (G, s) O (V)
3 for each vertex u, taken in topologically sorted order  (V)
4 do for each vertex v  Adj[u]
5 do RELAX (u, v, w)
(3 to 5) takes (E)

Dr. Nazir Ahmad Zafar | Virtual University of Pakistan


261 CS-702 Advanced Algorithms Analysis and Design

Each iteration of for loop takes O(1)


Total Running Time = O(V+E)

SSSP in Directed Acyclic Graphs


For each vertex v  V(G)
d[v] ← ∞
π[v] ← NIL
Considering s as root node
d[s] ≡ 0
The vertices are taken in
topologically sorted order

Adj[r] = s, t
d[s] > d[r] + w(r, s)
But (0 < ∞ + 5)
d[t] > d[r] + w(r, t)
But (∞ < ∞ + 3)

Considering vertex r

(∞ > 0 + 2)
d[t] ← d[s] + w(s, t)
0+2=2
π[t] ← s
d[x] > d[s] + w(s, x)
(∞ > 0 + 6)
d[x] ← d[s] + w(s, x)
0+6=6
π[x] ← s
Considering vertex s
Adj[s] = t, x
d[t] > d[s] + w(s, t)

Considering vertex t
Adj[t] = x, y, z
d[x] > d[t] + w(t, x)
But (6 < 9)

d[y] > d[t] + w(t, y)


(∞ > 2 + 4)

Dr. Nazir Ahmad Zafar | Virtual University of Pakistan


262 CS-702 Advanced Algorithms Analysis and Design

d[y] ← d[t] + w(t, y) d[z] ← d[t] + w(t, z)


2+4=6 2+2=4
π[y] ← t π[z] ← t
d[z] > d[t] + w(t, z)
(∞ > 2 + 2)
Considering vertex x
Adj[x] = y, z
d[y] > d[x] + w(x, y)
(6 > 6 + (-1))
d[y] ← d[x] + w(x, y)
6 + (-1) = 5
π[y] ← x
d[z] > d[x] + w(x, z)
But (4 < 6 + 1)

Adj[y] = z
d[z] > d[y] + w(y, z)
(4 > 5 + (-2))
d[z] ← d[y] + w(y, z)
5 + (-2) = 3
π[z] ← y

Considering vertex y

Considering vertex z
Adj[z] =

Theorem: Proof of Correctness


If a weighted, directed graph G = (V, E) has source vertex s and no cycles, then at the
termination of the DAG-SHORTEST-PATHS procedure, d[v] = δ(s, v) for all vertices v  V, and
the predecessor subgraph Gπ is a shortest-paths tree.

Proof
• We first show that d[v] = δ(s, v) for all vertices v  V at termination.

Case 1
• If v is not reachable from s, then d[v] = δ(s, v) = ∞ by the no-path property.

Dr. Nazir Ahmad Zafar | Virtual University of Pakistan


263 CS-702 Advanced Algorithms Analysis and Design

Case 2
• Now, suppose that v is reachable from s, so that there is a shortest path p = ↖v0,
v1,…..,vk↑, where v0 = s and vk = v.
• Because we process the vertices in topologically sorted order, the edges on p are
relaxed in the order (v0, v1), (v1, v2),……,(vk-1, vk).
• The path-relaxation property implies that d[vi] = δ(s, vi) at termination for i = 0, 1,..., k.
• Hence it proves the theorem

Dr. Nazir Ahmad Zafar | Virtual University of Pakistan


264 CS-702 Advanced Algorithms Analysis and Design

Lecture No. 35
Dijkstra’s Algorithm
Problem Statement
• Given a graph G = (V, E) with a source vertex s, weight function w, edges are non-
negative, i.e., w(u, v) ≥ 0,  (u, v)  E
• The graph is directed, i.e., if (u, v)  E then (v, u) may or may not be in E.
• The objective is to find shortest path from s to every vertex u  V.

Approach
• A “cloud S” of vertices, beginning with s, will be constructed, finally covering all vertices
of graph
• For each vertex v, a label d(v) is stored, representing distance of v from s in the
subgraph consisting of the cloud and its adjacent vertices
• At each step
– We add to the cloud the vertex u outside the cloud with the smallest distance
label, d(u)
– We update labels of the vertices adjacent to u

Mathematical Statement of Problem Edge Relaxation


Input: A graph G(V,E) with source s, weight Consider edge e = (u, z) such that
w u is vertex most recently added to the
cloud S
Assumption: z is not in the cloud
Edges non-negative, w(u, v) ≥ 0,  (u, v) 
E Relaxation of edge e updates distance d(z)
Directed, if (u, v)  E then (v, u) may be in E as
d(z) = min {d(z), d(u) + weight(e)}
Objective:
Find shortest paths from s to every u  V

Approach
Maintain a set S of vertices whose final
shortest-path weights from s have been
determined

Repeatedly select, u  V – S with minimum


shortest path estimate, add u to S, relax all
edges leaving u.

Greedy, always choose light vertex in V-S ,


add to S

Dr. Nazir Ahmad Zafar | Virtual University of Pakistan


265 CS-702 Advanced Algorithms Analysis and Design

Dijkstra’s Algorithm
DIJKSTRA(G, w, s)
1 INITIALIZE-SINGLE-SOURCE(G, s)
2 S←Ø
3 Q ← V[G]
4 while Q ≠ Ø
5 do u ← EXTRACT-MIN(Q)
6 S ← S  {u}
7 for each vertex v  Adj[u]
8 do RELAX (u, v, w)

Example: Dijkstra’s Algorithm

For each vertex v  V(G)


d[v] ← ∞
π[v] ← NIL

Considering s as root node


d[s] ≡ 0
S≡

s is extracted form queue


S ≡ S {s}
Adj[s] = t, y
d[t] > d[s] + w(s, t)
(∞ > 0 + 10)
d[t] ← d[s] + w(s, t)
0 + 10 = 10
π[t] ← s
d[y] > d[s] + w(s, y)
(∞ > 0 + 5)
d[y] ← d[s] + w(s, y)
0+5=5
π[y] ← s

Dr. Nazir Ahmad Zafar | Virtual University of Pakistan


266 CS-702 Advanced Algorithms Analysis and Design

d[t] ← d[y] + w(y, t)


5+3=8
π[t] ← y
d[x] > d[y] + w(y, x)

(∞ > 5 + 9)
d[x] ← d[y] + w(y, x)
5 + 9 = 14
π[x] ← y
d[z] > d[y] + w(y, z)
(∞ > 5 + 2)
d[z] ← d[y] + w(y, z)
y is extracted form queue 5+2=7
S ≡ S {y} π[z] ← y
Adj[y] = t, x, z
d[t] > d[y] + w(y, t)
(10 > 5 + 3)

z is extracted form queue


S ≡ S {z}
Adj[z] = s, x
d[s] > d[z] + w(s, z)
But (0 < 7 + 7)
d[x] > d[z] + w(z, x)
(14 > 7 + 6)
d[x] ← d[z] + w(z, x)
7 + 6 = 13
π[x] ← z

t is extracted form queue


S ≡ S {t}
Adj[t] = x, y
d[x] > d[t] + w(t, x)
(13 > 8 + 1)
d[x] ← d[t] + w(t, x)
8+1=9
π[x] ← t
d[y] > d[t] + w(t, y)
But (5 < 8 + 3)

Dr. Nazir Ahmad Zafar | Virtual University of Pakistan


267 CS-702 Advanced Algorithms Analysis and Design

x is extracted form queue


S ≡ S {x}
Adj[x] = z
d[z] > d[x] + w(x, z)
But (7 < 9 + 4)

Analysis: Dijkstra’s Algorithm


Cost depends on implementation of min-priority queue
Case 1: Vertices being numbered 1 to |V|
• INSERT, DECREASE-KEY operations takes O(1)
• EXTRACT-MIN operation takes O(V) time
• Sub cost is O(V2)
• Total number of edges in all adjacency list is |E|
• Total Running time = O (V2 + E) = O(V2)

Case 2: Graph is sufficiently spare, e.g., E = O (V2 /lgV)


Implement min-priority queue with binary min heap
Vertices being numbered 1 to |V|
• Each EXTRACT-MIN operation takes O(lgV)
• There |V| operations, time to build min heap O(V)
• Sub cost is O(V lgV)
• Each DECREASE-KEY operation takes time O(lgV), and there are |E| such operation.
• Sub cost is O(E lgV)
Hence Total Running time = O (V + E) lgV = E lgV

Case 3: Implement min-priority queue with Fibonacci heap


Vertices being numbered 1 to |V|
• Each EXTRACT-MIN operation takes O(lgV)
• There |V| operations, time to build min heap O(V)
• Sub cost is O(V lgV)
• Each DECREASE-KEY operation takes time O(1), and there are |E| such operation.
• Sub cost is O(E)
Hence Total Running time = O (V.lgV + E) = V lgV

Dr. Nazir Ahmad Zafar | Virtual University of Pakistan


268 CS-702 Advanced Algorithms Analysis and Design

Case 1: Computation Time


1. INITIALIZE-SINGLE-SOURCE(V, s) ← (V)
2. S ← 
3. Q ← V[G] ← O(V) build min-heap
4. while Q  
5. do u ← EXTRACT-MIN(Q) ← O(V)
6. S ← S  {u}
7. for each vertex v  Adj[u] ← O(E)
8. do RELAX(u, v, w)

Running time: O(V2 + E) = O((V2)


Note: Running time depends on Impl. Of min-priority (Q)

Case 2: Binary min Heap


1. INITIALIZE-SINGLE-SOURCE(V, s) ← (V)
2. S ← 
3. Q ← V[G] ← O(V) build min-heap
4. while Q   ← Executed O(V) times
5. do u ← EXTRACT-MIN(Q) ← O(lgV)
6. S ← S  {u}
7. for each vertex v  Adj[u]
8. do RELAX(u, v, w) ← O(E) times O(lgV)

Running time: O(VlgV + ElgV) = O(ElgV)

Case 3: Fibonacci Heap


1. INITIALIZE-SINGLE-SOURCE(V, s) ← (V)
2. S ← 
3. Q ← V[G] ← O(V) build min-heap
4. while Q   ← Executed O(V) times
5. do u ← EXTRACT-MIN(Q) ← O(lgV)
6. S ← S  {u}
7. for each vertex v  Adj[u]
8. do RELAX(u, v, w) ← O(E) times O(1)

Running time: O(VlgV + E) = O(VlgV)

Theorem: Correctness of Dijkstra’s Algorithm


Dijkstra‟s algorithm, runs on a weighted, directed graph G = (V, E) with non-negative weight
function w and source s, terminates with d[u] = δ(s, u) for all vertices u V.

Dr. Nazir Ahmad Zafar | Virtual University of Pakistan


269 CS-702 Advanced Algorithms Analysis and Design

Proof
• We use the following loop invariant:
– At start each iteration of the while loop of lines 4-8, d[v] = δ(s, v) for each vertex v
 S.
• It suffices to show for each vertex u  V, we have d[u] = δ(s, u) at time when u is added
to set S.
• Once we show that d[u] = δ(s, u), we rely on the upper-bound property to show that the
equality holds at all times thereafter.

Initialization:
• Initially, S = Ø, and so the invariant is trivially true

Maintenance:
• We wish to show that in each iteration, d[u] = δ(s, u), for the vertex added to set S.
• On contrary suppose that d[u] ≠ δ(s, u) when u is added to set S. Also suppose that u is
the first vertex for which the equality does not hold.
• We focus on situation at beginning of while loop in which u is added to S and derive a
contradiction.
• First of all, u ≠ s because s is the first vertex added to set S and d[s] = δ(s, s) = 0 at that
time.
• Secondly S ≠ Ø just before u is added to S, this is because s is at least in S.
• There must be some path from s to u, otherwise d[u] = δ(s, u) = ∞ by no-path property,
which would violate our assumption that d[u] ≠ δ(s, u).
• Because there is at least one path, there must be a shortest path p from s to u.
• Prior to adding u to S, path p connects a vertex in S, namely s, to a vertex in V - S,
namely u.

• Let us consider the first vertex y along p such that y  V - S, and let x  S be y's
predecessor.
• Thus, path p can be decomposed: s ₰p1 x  y ₰p2 u (either of paths p1 or p2 may have
no edges.)
• We claim that d[y] = δ(s, y) when u is added to S.

Dr. Nazir Ahmad Zafar | Virtual University of Pakistan


270 CS-702 Advanced Algorithms Analysis and Design

Proof of Claim: observe that x  S.


• Because u is chosen as the first vertex for which d[u] ≠ δ(s, u) when it is added to S, we
had d[x] = δ(s, x) when x was added to S.
• Edge (x, y) was relaxed at that time, and hence d[y] = δ(s, y) (convergence property).
• Because y occurs before u on a shortest path from s to u and all edge weights are
nonnegative (on path p2), we have δ(s, y) ≤ δ(s, u),
• Now d[y] = δ(s, y) ≤ δ(s, u) ≤ d[u]  d[y] ≤ d[u]
(1)
• But because both vertices u and y were in V - S when u was chosen, we have d[u] ≤
d[y]. (2)
• From (1) and (2), d[u] = d[y]
• Now, d[y] = δ(s, y) ≤ δ(s, u) = d[u] = d[y]  δ(s, y) = δ(s, u) .
• Finally, d[u] = δ(s, u), it contradicts choice of u
• Hence, d[u] = δ(s, u) when u is added to S, and this equality is maintained at all times
after that

Termination:
• At termination, Q = Ø which, along with our earlier invariant that Q = V - S, implies that
S = V.
• Thus, d[u] = δ(s, u) for all vertices u  V.

Lemma 1
Statement
• Let G = (V, E) be a weighted, directed graph with weight function w : E → R, let s  V be
a source vertex. Assume that G contains no negative-weight cycles reachable from s.
Then, after the graph is initialized by INITIALIZE-SINGLE-SOURCE(G, s), the
predecessor sub-graph Gπ forms a rooted tree with root s, and any sequence of
relaxation steps on edges of G maintains this property as an invariant.

Proof
• Initially, the only vertex in Gπ is the source vertex, and the lemma is trivially true.
• Let Gπ be a predecessor subgraph that arises after a sequence of relaxation steps.

a. First we prove that Gπ is a rooted tree.

1. Gπ is acyclic
• On contrary suppose that some relaxation step creates a cycle in the graph Gπ .
• Let c = <v0, v1,….,vk> be cycle, where vk = v0.
• Then, π[vi] = vi-1 for i = 1, 2,..., k
• Now, without loss of generality, we can assume that it was the relaxation of edge (vk-1,
vk) that created the cycle in Gπ.

Dr. Nazir Ahmad Zafar | Virtual University of Pakistan


271 CS-702 Advanced Algorithms Analysis and Design

Claim: all vertices on cycle c reachable from s.


• Because each vertex has non-NIL predecessor, and it was assigned a finite shortest-
path estimate when it was assigned non-NIL π value
• By upper-bound property, each vertex on c has a finite shortest-path weight, and
reachable from s.

Shortest-path on c just prior RELAX(vk-1, vk, w)


• Just before call, π[vi] = vi-1 for i = 1, 2,..., k - 1.
• Thus, for i = 1, 2,..., k - 1, last update to d[vi] was d[vi] ← d[vi-1] + w(vi-1, vi).
• It is obvious that, d[vk] > d[vk-1] + w(vk-1, vk).
• Summing it with k - 1 inequalities,
k k

 d [v ]   ( d [v
i 1
i
i 1
i 1 ]  w(vi 1 , vi ))
k k
  d [vi 1 ]   w(vi 1 , vi )
i 1 11
k k
But,  d [v ]   d [v
i 1
i
i 1
i 1 ]
k
Hence, 0   w(vi 1 , vi )
11

• Thus, sum of weights around cycle c is negative, which provides the contradiction.
• We have proved that Gπ is a directed, acyclic.

2. To show that it forms a rooted tree with root s


• Sufficient to prove that  v  Vπ, there is a unique path from s to v in Gπ.
• On contrary, suppose there are two simple paths from s to some vertex v, and (x ≠ y)
p1: s₰u₰xz₰v
p2: s₰u₰yz₰v
• π[z] = x and π[z] = y,  x = y, a contradiction.
• Hence there exists unique path in Gπ from s to v. Thus Gπ forms a rooted tree with root
s.

b. Now by predecessor subgraph property


• d[v] = δ(s, v) for all vertices v  V. Proved

Lemma 2
• If we run Dijkstra's algorithm on weighted, directed graph G = (V, E) with nonnegative
weight function w and source s, then at termination, predecessor subgraph Gπ is a
shortest paths tree rooted at s.
Proof: Immediate from the above lemma.

Dr. Nazir Ahmad Zafar | Virtual University of Pakistan


272 CS-702 Advanced Algorithms Analysis and Design

Lecture No. 36
All Pairs Shortest Paths

Today Covered
• All Pairs Shortest Paths
• Algorithms
– Matrix Multiplication
– The Floyd-Warshall Algorithm
• Time Complexity
• Conclusion

All-Pairs Shortest Path (APSP): Approach


• In all-pair shortest path problems, graph G given as
– Directed, weighted with weight function w : E↗ R
– where w is a function from edge set to real-valued weights
• Our objective is to find shortest paths, for all pair of vertices u, v  V,

Approach
• All-pair shortest path problem can be solved by running single source shortest path in |V|
times, by taking each vertex as a source vertex.
• Now there are two cases.

Edges are non-negative

Case 1
• Then use Dijkstra‟s algorithm
• Linear array of min-priority queue takes O(V 3)
• Binary min-heap of min-priority queue, O(VE lg V)
• Fibonacci heap of min-priority queue takes O(V 2 lg V+VE)

Negative weight edges are allowed

Case 2
• Bellman-Ford algorithm can be used when negative weight edges are present
• In this case, the running time is O(V 2E)
• However if the graph is dense then the running time is O(V 4)
Note
• Unlike single-source shortest path algorithms, most algorithms of all pair shortest
problems use an adjacency-matrix representation
• Let us define adjacency matrix representation.

Dr. Nazir Ahmad Zafar | Virtual University of Pakistan


273 CS-702 Advanced Algorithms Analysis and Design

Adjacency Matrix Representation


Assumptions
• Vertices are numbered from 1, 2,. . ., |V|
• In this way input is an n × n matrix
• W represents edges weights of n-vertex directed weighted graph G i.e.,
W = (wij), where
0 if i  j

wi j  the weight of directed edge (i, j ) if i  j and (i, j )  E ,
 if i  j and (i, j )  E

Shortest Path and Solution Representation


• For a moment we assume that negative-weight edges are allowed, but input graph
contains no negative-weight cycle
• The tabular output of all-pairs shortest-paths algorithms will be presented an n × n matrix
D = (dij), where entry dij contains the weight of a shortest path from vertex i to vertex j.
And the
• A Predecessor Matrix Π = (πij), where
πij = NIL, if either i = j or no path from i to j
πij = predecessor of j on some shortest path from i, otherwise

Example: All-Pairs Shortest Path


Given:
Directed graph G = (V, E)
Weight function w: E → R

Compute:
The shortest paths between all pairs of
vertices in a graph
Representation of result:
5 × 5 matrix of shortest-path distances δ(u,
v)
5 × 5 matrix of predecessor sub-graph

Structure of Output: Sub-graph for each row


• For each vertex i  V the Predecessor Subgraph of G for i is defined as Gπ, i = (Vπ, i,
Eπ.i), where
Vπ.i = {j  V : πij ≠ NIL} {i} and
Eπ.i = {(i, j) : j  Vπ.i – {i}}

• Gπ, i is shortest pat tree as was in single source shortest path problem

Dr. Nazir Ahmad Zafar | Virtual University of Pakistan


274 CS-702 Advanced Algorithms Analysis and Design

Printing Output
PRINT-ALL-PAIRS-SHORTEST-PATH (Π, i, j)
1 if i = j
2 then print i
3 else if πij = NIL
4 then print "no path from" i "to" j "exists"
5 else PRINT-ALL-PAIRS-SHORTEST-PATH (Π, i, πij)
6 print j

Shortest Paths and Matrix Multiplication


• Here we present a dynamic-programming algorithm for all-pairs shortest paths on a
directed graph G = (V, E).
• Each major loop of dynamic program will invoke an operation very similar to
multiplication of two matrices, and algorithm looks like repeated matrix multiplication
• At first we will develop Θ(V4)-time algorithm and then improve its running time to Θ(V3 lg
V).
• Before we go for dynamic solution, let us have a review of steps involved in dynamic-
programming algorithms.

Steps in Dynamic Programming

Steps on dynamic-programming algorithm are


• Characterize the structure of an optimal solution.
• Recursively define value of an optimal solution
• Computing value of an optimal solution in bottom-up
• Constructing optimal solution from computed information

Note:
Steps 1-3 are for optimal value while step 4 is for computing optimal solution

1. Structure of an Optimal Solution


• Consider shortest path p from vertex i to j, and suppose that p contains at most m edges
– If i = j, then p has weight 0 and no edges
– If i and j are distinct, then decompose path p into i ₰p′ k ↗ j, where path p′
contains at most m - 1 edges and it is a shortest path from vertex i to vertex k,
and
– Hence δ (i, j) = δ (i, k) + wkj.

2. A Recursive Solution
(m)
• Let l i j = minimum weight of path i to j at most m edges
– m = 0, there is shortest path i to j with no edges  i = j, thus

Dr. Nazir Ahmad Zafar | Virtual University of Pakistan


275 CS-702 Advanced Algorithms Analysis and Design

0 if i  j
l i(0)j  
 if i  j
– m ≥ 1, compute using and adjacency matrix w

 
l i( mj )  min l i( mj 1), min l i( km 1)  wk j
1 k  n


 min l i( km 1)  wk j
1 k  n

• The actual shortest-path weights are therefore given by
 (i, j )  l i( nj 1)  l i( nj )  l i( nj 1)  ...

3. Compute Shortest Path Weights Bottom-up


• Input matrix W = (wij),
• Suppose that, L(m) = (lij(m)), where, m = 1, 2,..., n – 1
• Compute series of matrices L(1), L(2),..., L(n-1),
• Objective function, L(n-1) , at most n-1 edges in each path
Note
• Observe that lij(1), = wij, for all i, j  V , and so L(1) = W
• Heart of the algorithm is : given matrices L(m-1) and W, and compute the matrix L(m)
• That is, it extends shortest paths computed so far by one more edge.

Algorithm: Extension from L(m-1) to L(m)


EXTEND-SHORTEST-PATHS (L, W)
1 n ← rows[L]
2 let L′ = be an n × n matrix
3 for i ← 1 to n
4 do for j ← 1 to n
5 do ←∞
6 for k ← 1 to n
7 do
8 return L′

li' j  min l i' j , l i k  wk j 
Total Running Time = (n3)

Complete but Slow Algorithm


SLOW-ALL-PAIRS-SHORTEST-PATHS (W)
1 n ← rows [W]
2 L(1) ← W
3 for m ← 2 to n - 1
4 do L(m) ← EXTEND-SHORTEST-PATHS (L(m-1), W)
5 return L(n-1)

Total Running Time = (n4)

Dr. Nazir Ahmad Zafar | Virtual University of Pakistan


276 CS-702 Advanced Algorithms Analysis and Design

Example
0 3 8   4
 
 0  1 7
L  
(1)
4 0  
 
2  5 0 
   0 
 6
0 3 8 2 4 
 
3 0 4 1 7
L(2)   4 0 5 11
 
2 1  5 0 2 
8  0 
 1 6

The reader may verify that L(4) = L(5) = L(6) = . . .


0 3 3 2  4
 
 3 0  4 1 1 
L(3)   7 4 0 5 11 
 
 2 1  5 0  2 
8 5 0 
 1 6
0 1 3 2  4 
 
 3 0  4 1 1 
L(4)   7 4 0 5 3
 
 2 1  5 0  2 
8 5 0 
 1 6

Improving Running Time


• Running time of previous algorithm is very high and needs improvement.
• The goal is not to compute all the L(m) matrices but only computation of matrix L(n-1) is of
interest
• As Matrix multiplication associative, L(n-1) can be calculated with only ⌈lg(n - 1)⌉ matrix
products as.
L(1) = W,
L(2) = W 2 = W · W,
L(4) = W 4 = W 2 · W 2,
L(8) = W 8 = W 4 · W 4,

[ lg (n 1)] [ lg ( n 1)]
Ln 1  L2 W2

Dr. Nazir Ahmad Zafar | Virtual University of Pakistan


277 CS-702 Advanced Algorithms Analysis and Design

Improved Algorithm
FASTER-ALL-PAIRS-SHORTEST-PATHS (W)
1 n ← rows[W]
2 L(1) ← W
3 m←1
4 while m < n - 1
5 do L(2m) ← EXTEND-SHORTEST-PATHS (L(m), L(m))
6 m ← 2m
7 return L(m)

Total Running Time = O(n3 lg n)

Dr. Nazir Ahmad Zafar | Virtual University of Pakistan


278 CS-702 Advanced Algorithms Analysis and Design

Lecture No. 37
The Floyd-Warshall Algorithm
& Johnson’s Algorithm
Intermediate Vertices
• Vertices in G are given by: V = {1, 2, …, n}
• Consider a path p = v1, v2, …, vl
– An intermediate vertex of p is any vertex in set {v2, v3, …, vl-1}

Example 1 Example 2
If p = 1, 2, 4, 5 then If p = 2, 4, 5 then
I.V. = {2, 4} I.V. = {4}

The Floyd Warshall Algorithm

1. Structure of a Shortest Path


• Let V = {1, 2,..., n} be a set of vertices of G
• Consider subset {1, 2,..., k} of vertices for some k
• Let p be a shortest paths from i to j with all intermediate vertices in the set {1, 2,..., k}.
• It exploits a relationship between path p and shortest paths from i to j with all
intermediate vertices in the set {1, 2,..., k - 1}.
• The relationship depends on whether or not k is an intermediate vertex of path p.
• For both cases optimal structure is constructed

2. k not an I. vertex. of path p


• Shortest path i to j with I.V. from {1, 2, …, k} is shortest path i to j with I.V. from {1, 2, …,
k - 1}

1. k an intermediate vertex of path p


• p1 is a shortest path from i to k
• p2 is a shortest path from k to j
• k is neither intermediate vertex of p1 nor of p2
• p1, p2 shortest paths i to k with I.V. from: {1, 2, …, k - 1}

Dr. Nazir Ahmad Zafar | Virtual University of Pakistan


279 CS-702 Advanced Algorithms Analysis and Design

2. A Recursive Solution
• Let d i( kj ) = be the weight of a shortest path from vertex i to vertex j for which all
intermediate vertices are in the set {1, 2,. . ., k}.
• Now D(n) = (di, j(n)),
• Base case di, j(0)) = wi, j
• D(0) = (wi, j) = W
• The recursive definition is given below

 wi j if k  0
d i( kj )  
min  d i j , d i k  d k j  if k  1
( k  1) ( k  1) ( k  1)

3. The Floyd Warshall Algorithm

FLOYD-WARSHALL (W)
1 n ← rows[W]
2 D (0) ← W
3 for k ← 1 to n
4 do for i ← 1 to n
5 do for j ← 1 to n
6 do d i( kj )  min  d i( kj 1) , d i( kk 1)  d (kkj1) 
7 return D (n)

Total Running Time = O(n3)

Constructing a Shortest Path


• One way is to compute matrix D of SP weights and then construct predecessor matrix Π
from D matrix.
– It takes O(n3)
• A recursive formulation of:  i( kj )
– k = 0, shortest path from i to j has no intermediate vertex

 NIL if i  j or wij  
 ij( 0 )  

i if i  j and wij  
– For k ≥ 1
  ij( k 1) if d ij( k 1)  d ik( k 1)  d (kjk 1)
 (k )
  ( k 1)
  kj if d ij( k 1)  d ik( k 1)  d (kjk 1)
ij

Dr. Nazir Ahmad Zafar | Virtual University of Pakistan


280 CS-702 Advanced Algorithms Analysis and Design

Example: Floyd Warshall Algorithm

 0 3 8  4 
 
 0  1 7 
D ( 0)    4 0   
 
 2  5 0  
   6 0 
 
Adjacency Matrix of given Graph

For k = 0

For k = 1

For k = 2

Dr. Nazir Ahmad Zafar | Virtual University of Pakistan


281 CS-702 Advanced Algorithms Analysis and Design

For k = 3

For k = 4

Dr. Nazir Ahmad Zafar | Virtual University of Pakistan


282 CS-702 Advanced Algorithms Analysis and Design

For k = 5

Dr. Nazir Ahmad Zafar | Virtual University of Pakistan


283 CS-702 Advanced Algorithms Analysis and Design

Existence of Shortest Paths Between any Pair


Transitive Closure
• Given a directed graph G = (V, E) with vertex set V = {1, 2,...,n}, we may wish to find out
whether there is a path in G from i to j for all vertex pairs i, j  V.
• The transitive closure of G is defined as the graph G* = (V, E*), where E*= {(i, j) : there is
a path from vertex i to vertex j in G}.
• One way is to assign a weight of 1 to each edge of E and run the Floyd-Warshall
algorithm.
– If there is a path from vertex i to j, then dij < n
– Otherwise, we get dij = ∞.
– The running time is Θ(n3) time

Substitution
• Substitute logical operators, (for min) and (for +) in the Floyd-Warshall algorithm
– Running time: Θ(n3) which saves time and space
– A recursive definition is given by
0 if i  j and (i, j )  E
– K=0 t i(0)j  
1 if i  j or (i, j )  E
– For k ≥ 1 t i( kj )  t i( kj 1)   t i( kk 1)  d (kkj1) 

Transitive Closure
TRANSITIVE-CLOSURE(G) 1 0 0 0 1 0 0 0 
1 n ← |V [G]|    
0 1 1 1 0 1 1 1
2 for i ← 1 to n T 
( 0)
T 
(1) 
0 1 1 0 0 1 1 0
3 do for j ← 1 to n    
4 do if i = j or (i, j)  E[G] 1 0 1 1 1 0 1 1 
5 then t i( 0)j ← 1 1 0 0 0 1 0 0 0 
   
0 1 1 1  (3)  0 1 1 1 
6 else t i( 0)j ← 0 T 
( 2)
T 
0 1 1 1 0 1 1 1 
7 for k ← 1 to n    
8 do for i ← 1 to n 1 0 1 1 1 1 1 1 
9 do for j ← 1 to n 1 0 0 0
 
10 do 1 1 1 1
T 
( 4)

t ij t ij
(k) ( k  1)
 t i k
( k  1)
d kj
( k  1)
 1 1 1 1
 
11 return T(n) 1 1 1 1

Total Running Time = O (n3)

Dr. Nazir Ahmad Zafar | Virtual University of Pakistan


284 CS-702 Advanced Algorithms Analysis and Design

Johnson’s Algorithm
• For sparse graphs, Johnson‟s Algorithm is asymptotically better than
– Repeated squaring of matrices and
– The Floyd-Warshall algorithm.
• It uses as subroutines both
– Dijkstra‟s algorithm and
– The Bellman-Ford algorithm.
• It returns a matrix of shortest-path weights for all pairs of vertices OR
• Reports that the input graph contains a negative-weight cycle.
• This algorithm uses a technique of reweighting.

Re-weighting
• The technique of reweighting works as follows.
– If all edge weights are nonnegative, find shortest paths by running Dijkstra‟s
algorithm, with Fibonacci heap priority queue, once for each vertex.
– If G has negative-weight edges, we simply compute a new set of nonnegative
edges weights that allows us to use the same method.
• New set of edge weights must satisfy the following
– For all pairs of vertices u, v  V, a shortest path from u to v using weight function
w is also a shortest path from u to v using weight function w‟.
– For all (u, v ), new weight w‟ (u, v) is nonnegative

δ, δ‟ Preserving Shortest Paths by Re-weighting


• From the lemma given in the next slide shows, it is easy to come up with a re-weighting
of the edges that satisfies the first property above.
• We use δ to denote shortest-path weights derived from weight function w
• And δ‟ to denote shortest-path weights derived from weight function w‟.
• And then we will show that, for all (u, v ), new weight w‟ (u, v) is nonnegative.

Re-weighting does not change shortest paths


Lemma Statement
• Given a weighted, directed graph G = (V, E) with weight function w : E → R, let h : V →
R be any function mapping vertices to real numbers.
• For each edge (u, v) E, define
w‟(u, v) = w(u, v) + h(u) – h(v)
• Let p = <v0, v1,. . ., vk> be any path from vertex v0 to vertex vk. Then p is a shortest path
from v0 to vk with weight function w if and only if it is a shortest path with weight function
w‟.
• That is, w(p) = δ(v0, vk) if and only if w‟(p) = δ‟(v0, vk).
• Also, G has a negative-weight cycle using weight function w if and only if G has a
negative-weight cycle using weight function w‟.

Dr. Nazir Ahmad Zafar | Virtual University of Pakistan


285 CS-702 Advanced Algorithms Analysis and Design

Proof: Lemma
We start by showing that
w'(p)  w(p)  h(v 0 )  h(vk )
We have
k
w'(p)   w'(v i-1 , v i )
i 1
k
  w(p)  h(vi-1 )  h(vi )
i 1
k k
  w(p)   ( h(vi-1 )  h(vi ))
i 1 i 1
k
  w(p)  h(v 0 )  h(vk )
i 1

• Therefore, any path p from v0 to vk has w‟(p) = w(p) + h(v0) – h(vk).


• If one path from v0 to vk is shorter than another using weight function w, then it is also
shorter using w‟.
• Thus, w(p) = δ(v0, vk,)  w‟(p) = δ‟(v0, vk,).
• Finally, we show that G has a negative-weight cycle using weight function w if and only if
G has a negative-weight cycle using weight function w‟.
• Consider any cycle c = <v0, v1,..., vk>, where v0 = vk.
• Now w‟(c) = w(c) + h(v0) - h(vk) = w(c),
• And thus c has negative weight using w if and only if it has negative weight using w‟.
• It completes the proof of the theorem

Producing nonnegative weights by re-weighting


• Next we ensure that second property holds i.e. w‟(u, v) to be nonnegative for all edges
(u, v)E
• Given a weighted, directed graph G = (V, E) with weight function w : E → R, we make a
new graph G′ = (V′, E′), where V′ = V  {s} for some new vertex s ∉ V and
• E′ = E  {(s, v) : v  V}.
• Extend weight function w so that w(s, v) = 0 for all v  V.
• Note that because s has no edges that enter it, no shortest paths in G′, other than those
with source s, contain s.
• Moreover, G′ has no negative-weight cycles if and only if G has no negative-weight
cycles.
• Now suppose that G and G′ have no negative-weight cycles.
• Let us define h(v) = δ(s, v) for all v  V′.
• By triangle inequality, we have
h(v) ≤ h(u) + w(u, v),  (u, v)  E′. (1)
• Thus, if we define the new weights w‟, we have w‟(u, v) = w(u, v) + h(u) – h(v)  0. by
(1)
• And the second property is satisfied.

Dr. Nazir Ahmad Zafar | Virtual University of Pakistan


286 CS-702 Advanced Algorithms Analysis and Design

Johnson’s Algorithm
JOHNSON (G)
1 compute G′, where V [G′] = V [G] {s},
E [G′] = E [G] {(s, v) : v  V [G]}, and
w(s, v) = 0 for all v  V [G]
2 if BELLMAN-FORD(G′, w, s) = FALSE
3 then print “the input graph contains a negative-weight cycle”
4 else for each vertex v  V [G′]
5 do set h(v) to the value of δ(s, v)
computed by the Bellman-Ford algorithm
6 for each edge (u, v)  E [G′]
7 do w(u, v) ≡ w(u, v) + h(u) - h(v)
8 for each vertex u  V [G]
9 do run DIJKSTRA(G, w, u) to compute δ(u, v) for all v  V [G]
10 for each vertex v  V [G]
11 do duv ≡ δ(u, v) + h(v) - h(u)
12 return D

Total Running Time = O(V 2 lgV + VE)

Bellman-Ford algorithm is used to determine δ(s, v) for all v  V e.g., δ(s, 3) = -5 path: <s, 4, 3>

Dr. Nazir Ahmad Zafar | Virtual University of Pakistan


287 CS-702 Advanced Algorithms Analysis and Design


 w (0,1) ≡ w(0,1) + h(0) - h(1) = (0 + 0 - (-0)) = 5

 w (0,2) ≡ w(0,2) + h(0) - h(2) = (0 + 0 - (-1)) = 1

 w (0,3) ≡ w(0,3) + h(0) - h(3) = (0 + 0 - (-5)) = 5

 w (0,4) ≡ w(0,4) + h(0) - h(4) = (0 + 0 - (-0)) = 0

 w (0,5) ≡ w(0,5) + h(0) - h(5) = (0 + 0 - (-4)) = 4

 w (1,2) ≡ w(1,2) + h(1) - h(2) = (3 + 0 - (-1)) = 4

 w (1,3) ≡ w(1,3)+ h(1) - h(3) = (8 + 0 - (-5)) = 13

 w (1,5) ≡ w(1,5) + h(1) - h(5) = (-4 + 0 - (-4)) = 0

 w (2,4) ≡ w(2,4) + h(2) - h(4) = (1 + (-1) - 0) = 0

 w (2,5) ≡ w(2,5) + h(2) - h(5) = (7+(-1)–(-4))= 10

 w (3,2) ≡ w(3,2) + h(3) - h(2) = (4+(-5)–(-1)) = 0

 w (4,1) ≡ w(4,1) + h(4) - h(1) = (2+0–0) = 2

 w (4,3) ≡ w(4,3) + h(4) - h(3) = (-5+0–(-5)) = 0

 w (5,4) ≡ w(5,4) + h(5) - h(4) = (6+(-4)–0)= 2

Dr. Nazir Ahmad Zafar | Virtual University of Pakistan


288 CS-702 Advanced Algorithms Analysis and Design

aplying Dijkstra’s Algorithm on vertex 1

 
 (1,5) ≡ 0,  (4,3) ≡ 2,
δ(1,5) ≡ -4 δ(4,3) ≡ -3
d(1,5) ≡ δ(1,5) = -4 d(4,3) ≡ δ(4,3) = -3
 
 (5,4) ≡ 2,  (3,2) ≡ 2,
δ(5,4) ≡ 2 δ(3,2) ≡ 1
d(5,4) ≡ δ(5,4) = 2 d(3,2) ≡ δ(3,2) = 1

Applying Dijkstra’s Algorithm on vertex 2

 
 (2,4) ≡ 0,  (4,3) ≡ 0,
δ (2,4) ≡ 1 δ (4,3) ≡ -4
d (2,4) ≡ δ(2,4) = 1 d (4,3) ≡ δ(4,3) = -4
 
 (4,1) ≡ 2,  (1,5) ≡ 2,
δ (4,1) ≡ 3 δ (1,5) ≡ -1
d (4,1) ≡ δ(4,1) = 3 d (1,5) ≡ δ(1,5) = -1

Applying Dijkstra’s Algorithm on vertex 3

 
 (3,2) ≡ 0,  (4,1) ≡ 2,
δ (3,2) ≡ 4 (4,1) ≡ 7
d (3,2) ≡ δ(3,2) = 4 d (4,1) ≡ δ(4,1) = 7
 
 (2,4) ≡ 0,  (1,5) ≡ 2,
δ (2,4) ≡ 5 δ (1,5) ≡ 3
d (2,4) ≡ δ(2,4) = 5 d (1,5) ≡ δ(1,5) = 3

Dr. Nazir Ahmad Zafar | Virtual University of Pakistan


289 CS-702 Advanced Algorithms Analysis and Design

Applying Dijkstra’s Algorithm on vertex 4

 
 (4,1) ≡ 2,  (1,5) ≡ 2,
δ (4,1) ≡ 2 δ (1,5) ≡ -2
d (4,1) ≡ δ(4,1) = 2 d (1,5) ≡ δ(1,5) = -2
 
 (4,3) ≡ 0,  (3,2) ≡ 0,
δ (4,3) ≡ -5 δ (3,2) ≡ -1
d (4,3) ≡ δ(4,3) = -5 d (3,2) ≡ δ(3,2) = -1

Applying Dijkstra’s Algorithm on vertex 5

 
 (5,4) ≡ 2,  (4,3) ≡ 2,
δ (5,4) ≡ 6 δ (4,3) ≡ 1
d (5,4) ≡ δ(5,4) = 6 d (4,3) ≡ δ(4,3) = 1
 
 (4,1) ≡ 4,  (3,2) ≡ 2,
δ (4,1) ≡ 8 δ (3,2) ≡ 5
d (4,1) ≡ δ(4,1) = 8 d (3,2) ≡ δ(3,2) = 5

Dr. Nazir Ahmad Zafar | Virtual University of Pakistan


290 CS-702 Advanced Algorithms Analysis and Design

Lecture No. 38
Number Theoretic Algorithms
(Definitions and Some Important Results)

Today Covered
• Applications of Number Theory • GCD
• Divisibility • Partitioning of Integers
• Numbers • Congruency classes
• Prime Numbers • Proofs of some results
• Relatively Prime Numbers

Applications of number theoretic algorithms

Electronic commerce
• Electronic commerce enables goods and services to be negotiated and exchanged
electronically.
• The ability to keep information such as credit card numbers, passwords, bank
statements private is essential if electronic commerce is used widely.
• Public-key cryptography and digital signatures are among the core technologies used
and are based on numerical algorithms and number theory.

Congruency equations modulo n


• For example, if we are given an equation ax ≡ b (mod n), where a, b, and n are integers,
and we wish to find all the integers x, modulo n, that satisfy the equation.
• There may be zero, one, or more solution.
• Using brute force approach, we can simply try x = 0, 1, ..., n - 1 in order, and can find
the solution
• But our objective is not to find a solution only, in fact we want an efficient, of course this
problem can be solved using number theory.

Numbers
• Z = set of all integers = . . .,-3, -2, -1, 0, +1, +2 +3, . . .
• Set of all even integers = { 2k | k  Z }
• Set of all odd integers = { 2k + 1| k  Z }
• Q = Set of all rational numbers
– p/q
– p, q  Z
– q  0

• I = set of all irrational numbers: which are not irrationals i.e.


– ~p/q OR
– ~(p, q  Z) OR
– ~(q  0)

Dr. Nazir Ahmad Zafar | Virtual University of Pakistan


291 CS-702 Advanced Algorithms Analysis and Design

Divisibility
Let a, b  Z with a  0 then we say that
a|b  a divides b  c  Z : b = ac
It means that a|b if and only if there exists an integer c such that c times a equals b.

Example 1: 3(12), because if we assume that a = 3, b = -12 then there exists c = -4 such that
b = ac

Example 2: 3 does not divide 7, because if we assume that a = 3, b = 7 then there does not
exists any integer c such that b = ac

Some Facts

Statement: Prove that if a|b then a|(-b)

Proof:
• Since a|b hence there exist an integer x such that b = ax,
• Now -b = -ax = a(-x)
• Since if x  Z then (-x)  Z, Hence, a|(-b)

Note:
• Because of the above lemma why not choose divisors as only positive.
• Hence if d is a divisor of b, then 1 ≤ d ≤ |b|,

Example:
Only divisors of 24 are: 1, 2, 3, 4, 6, 8, 12,and 24.

Statement: Prove that a|0  a  Z

Proof:
• As we know that a|b means there is an integer s such that b = as, and
• Since 0 = a.0, where 0 is an integer, hence a|0

Statement: If a|b, a|c then a | (b + c)  a, b, c  Z

Proof:
• As we know that a|b means there is an integer s such that b = as, and
• a|c means that there is a t such that c = at,
• Now b + c = as + at = a(s + t), and hence a|(b + c).

Statement: If a|b, a|c then a | (b - c)  a, b, c  Z

Dr. Nazir Ahmad Zafar | Virtual University of Pakistan


292 CS-702 Advanced Algorithms Analysis and Design

Proof:
• If a|b means then there is an integer s such that b = as, and
• If a|c then there is an integer t such that c = at,
• Now b - c = as - at = a(s - t),
• Since if s, t  Z  s - t  Z
• Hence a|(b - c).

Statement: If a|b and b|a then prove that a =  b

Proof:
• Since a|b hence there is an integer x such that b = ax, (1)
• Since we are given that b|a therefore there is an integer t such that a = bt, (2)
• From (1) and (2), a = axt  xt = 1
• Since x and t are both integers hence x = t =  1
• Hence a = b

Generalized Result

Statement: Prove that if a|b then a|bc  a, b, c  Z


Proof:
• As we know that a|b means there is an integer s such that b = as, and
• Now bc = asc = a(sc) and hence a|bc

Statement: Prove that if a|b, b|c then a|c,  a, b, c  Z

Proof:
• Since a|b, it means  s  Z such that b = as, and
• Since b|c, it means  t  Z such that c = bt
• Now c = bt = ast = a(st) and hence a|c

Statement:
•  a, b, c  Z, if a|b and a|c then
• a | (bx + cy),  x, y  Z
Proof:
• As we know that a|b means there is an integer s such that b = as  bx = asx, and
• And if a|c means that there is a t such that c = at  cy = aty
• Now bx + cy = asx + aty = a(sx + ty), and hence a|(bx + cy), this is because (sx + ty)  Z

Statement:
•  a, b, c  Z, if a|b and a|c then
• a | (bx - cy),  x, y  Z

Dr. Nazir Ahmad Zafar | Virtual University of Pakistan


293 CS-702 Advanced Algorithms Analysis and Design

Proof:
• As we know that a|b therefore there is an integer s such that b = as  bx = asx, and
• Since a|c therefore there is an integer t such that
c = at  cy = aty
• Now bx - cy = asx - aty = a(sx - ty), and hence a|(bx - cy), this is because (sx - ty)  Z

Prime Numbers
Definition:
• A number p is prime if and only if it is divisible 1 and itself. OR
• A number p is prime if it can not be written as
p = x.y where x, y  Z and x, y > 1.
Note:
1 is prime, but is generally not of interest so we do not include it in set of primes

Examples
• 2, 3, 5,7 etc. are all prime

Examples
• 4, 6, 8, 9, 10 are not primes
• Prime numbers are central to number theory
• We will study some algorithms on prime numbers
• List of prime number less than 200
• 2, 3, 5, 7, 11, 13, 17, 19, 23, 29, 31, 37, 41, 43, 47, 53, 59, 61, 67, 71, 73, 79, 83, 89, 97,
101, 103, 107, 109, 113, 127, 131, 137, 139, 149, 151, 157, 163, 167, 173, 179, 181,
191, 193, 197, 199
• There are infinitely many primes.
• Any positive integer that is not prime is composite.
• 1 is the “unit” for multiplication and we assume that it is neither prime nor composite.

The Division Algorithm


Statement:
• For any integer dividend a and divisor d ≠ 0, there is a unique quotient q and remainder r
 N such that
a = dq + r, where 0  r < |d|
• In other way:  a, d  Z, d > 0,  q, r  Z such that 0  r < |d|, and a = d.q + r
• We can find q by: q = ad, and
• We can find r by: r = (a mod d) = a  dq

Example:
• a = 21; d = 4 then
q = ad = 214 = 5, and r = a - dq = 21 - 4.5 = 1

Dr. Nazir Ahmad Zafar | Virtual University of Pakistan


294 CS-702 Advanced Algorithms Analysis and Design

Classification of Integers
When an integer is divided by 2 remainder is 0 or 1
1. C1 = { 2k | k  Z } and
2. C2 = { 2k + 1| k  Z }

When an integer is divided by 3 remainder is 0, 1 or 2


1. C1 = { 3k | k  Z },
2. C2 = { 3k + 1 | k  Z } and
3. C3 = { 3k + 2 | k  Z }

When an integer divided by 4 remainder, 0, 1, 2 or 3


1. C1 = { 4k | k  Z },
2. C2 = { 4k + 1 | k  Z }
3. C3 = { 4k + 2 | k  Z }
4. C4 = { 4k + 3 | k  Z } ...

Congruencies and Remainder


Remainder
• When a is divided by n then we can write (a mod n) as remainder of this division.
• If, remainder when a is divisible by n = remainder when b is divisible by n then
(a mod n) = (b mod n) e.g. (8 mod 3) = (11 mod 3)
Congruency
• If (a mod n) = (b mod n) we write it as a ≡ b (mod n)
“a is equivalent to b modulo n.”
• Thus, a and b have same remainder, w.r.t. n then
a = qan + r, for some qa  Z
b = qbn + r, for some qb  Z

Lemma: If a ≡ b (mod n) then prove that n|(b − a)

Proof:
• Since a ≡ b (mod n) hence (a mod n) = (b mod n)
• Let (a mod n) = (b mod n) = r
• By division theorem,  q1, q2  Z such that
o a = q1n + r, 0 r <n
• b = q2n + r, 0 r <n
• Now, b − a = (q2 − q1)n + r − r = (q2 − q1)n
• Hence, n|(b − a) because (q2 − q1)  Z
• The equivalence of b class modulo n: bn  {b  kn : k  Z}, e. g.
[3]7 = {...,−11, −4, 3, 10, 17, ...}
[−4]7 = . . .
[17]7 = . . .
• Zn = {[a]n : 0 ≤ a ≤ n − 1} and we often write

Dr. Nazir Ahmad Zafar | Virtual University of Pakistan


295 CS-702 Advanced Algorithms Analysis and Design

Example
Z4 = {[0]4, [1]4, [2]4, [3]4}
Usually we write Z4 = {0, 1, 2, 3}
Zn = {0, 1, 2, 3, ..., n − 1}, we associate a with [a]n.

Prime Factorization
• By factorization of a number n, we mean that n = a × b × c, where a, b, c  Z
• By a prime factorization of a number n, we mean that n = a × b × c, where a, b, c  Z
and all factors are prime number
Example:
• 3600 = 24 × 32 × 52 factorization
• 3600 = 210 × 31 × 131 prime factorization
• 91 = 7×13 prime factorization
k
n  p1m1 . p2m2 ... pkmk   pimi
i 1

Relatively Prime Numbers


Definition
• Two numbers a, b are relatively prime if they have no common divisors except 1

Example
15, 23 are relatively prime, this is because
• Factors of 15 are 1, 3, 5, 15 and
• Factors of 23 are 1, 23 and
• Common factor is only 1
• Hence 15 and 23 are relatively prime

Some More Results


Definition: The greatest common divisor of a and b, not both zero, is the largest common divisor
of a and b

Some elementary gcd properties


• gcd(a, b) = gcd(b, a), gcd(a, b) = gcd(-a, b)
• gcd(a, b) = gcd(|a|, |b|), gcd(a, 0) = |a|

Examples
• gcd(24, 30) = 6, gcd(5, 7) = 1
• gcd(0, 9) = 9, gcd(0, 0) = 0 by definition
• gcd(a, ka) | a | for any k  Z.

Note: 1 ≤ gcd(a, b) ≤ min(|a|, |b|)

Dr. Nazir Ahmad Zafar | Virtual University of Pakistan


296 CS-702 Advanced Algorithms Analysis and Design

Example: Greatest Common Divisor


• GCD of two integers can be obtained by comparing their prime factorizations and using
least powers

Example
• 600 = 2 x 2 × 2 x 3 × 5 x 5 = 23 x 31 x 52
• 36 = 2 x 2 × 3 x 3 = 22 x 32
• Rearrange the factorization of 600 and 36
• 600 = 2 x 2 × 2 x 3 × 5 x 5 = 23 x 31 x 52
• 36 = 2 x 2 × 3 x 3 = 22 x 32 x 50
• GCD(36, 600) = 2min(3,2) x 3min(1,2) x 5min(2,0) = 22 x 31 x 50 = 4 x 3 = 12

Brute Force Approach Finding GCD


Statement:
• Given two integers a and b. Find their greatest common divisor
Method:
• Compute prime factorization of a
k
a  p1m1 . p2m2 ... pkmk   pimi
i 1

• Compute prime factorization of b


l
b  p1n1 . p2n2 ... plnl   pini
i 1

• Let p1, p2, . . ., pt be the set of all prime numbers both in the factorization of a and b
• Now the prime factorization of a is rearranged as
t
a  p1m1 . p2m2 ... ptmt   pimi , where p1  p2  ...  pt
i 1

• Similarly the prime factorization of b is rearranged as


t
b  p1n1 . p2n2 ... ptnt   pini , where p1  p2  ...  pt
i 1

• Finally GCD of a and b can be computed as


gcd(a, b)  p1min( m1,n1 ) . p2
min( m2 ,n2 )
.... ptmin( mt ,nt )
t
gcd(a, b)   pimin( mi ,ni ) .
i 1

Methods of Proof
Direct Method:
• Express the statement to be proved in the form:
 x  D, P(x)  Q(x)
• Suppose that P(x) is true for an arbitrary element x of D
• Prove that Q(x) is true for the supposed above value x of D.

Parity:
Two integers have same parity if both are either odd or even, otherwise opposite parity.

Dr. Nazir Ahmad Zafar | Virtual University of Pakistan


297 CS-702 Advanced Algorithms Analysis and Design

Direct Proof
Lemma:
• Prove that m + n and m – n have same parity, for all m, n  Z

Proof: There are three cases


Case 1:
• Both m, n are even i.e.,
• m = 2k1 and n = 2k2 for some k1, k2  Z
• Now, m + n = 2k1 + 2k2 = 2(k1 + k2) an even
• And, m - n = 2k1 - 2k2 = 2(k1 - k2) an even

Case 2:
• Both m, n are odd i.e.,
• m = 2k1 + 1 and n = 2k2 + 1 for some k1, k2  Z
• Now, m + n = 2k1 + 1 + 2k2 + 1 = 2(k1 + k2 + 1) = 2k‟
• And, m - n = 2k1 + 1 - 2k2 – 1 = 2(k1 - k2) = 2k‟‟
• Hence m + n and m - n both are even

Case 3:
• m is even and n is odd i.e.,
• m = 2k1 and n = 2k2 + 1 for some k1, k2  Z
• Now, m + n = 2k1 + 2k2 + 1 = 2(k1 + k2) + 1 = 2k‟ + 1, odd
• And, m - n = 2k1 - 2k2 – 1 = 2(k1 - k2 – 1) +1 = 2k‟‟ + 1, odd
• Hence m + n and m - n both have the same parity.

An Alternate Method of Direct Proof


We can formulate the same problem as
Notations
• Let S-EVEN (m, n)  m + n is even
• Let S-ODD (m, n)  m + n is odd
• Let D-EVEN (m, n)  m - n is even
• Let D-ODD (m, n)  m - n is odd

Mathematical Statement of the problem


• S-EVEN (m, n)  D-EVEN (m, n),  m, n  Z
• S-ODD (m, n)  D-ODD (m, n),  m, n  Z

Proof
Case 1
• Suppose that S-EVEN (m, n),  m, n  Z
• Now, m – n = m + n – 2n = even - even = even integer
• Hence D-EVEN (m, n),  m, n  Z

Dr. Nazir Ahmad Zafar | Virtual University of Pakistan


298 CS-702 Advanced Algorithms Analysis and Design

Case 2
• Suppose that D-EVEN (m, n),  m, n  Z
• Now, m + n = m - n + 2n = even + even = an even integer,  m, n  Z
• Hence S-EVEN (m, n),  m, n  Z
Case 3
• Suppose that S-ODD (m, n),  m, n  Z
• Now, m – n = m + n – 2n = odd – even = odd
• D-ODD (m, n),  m, n  Z
Case 4
• Suppose that D-ODD (m, n),  m, n  Z
• Now, m + n = m - n + 2n = odd + even = odd
• S-ODD (m, n),  m, n  Z
Hence
• S-EVEN (m, n)  D-EVEN (m, n),  m, n  Z
• S-ODD (m, n)  D-ODD (m, n),  m, n  Z

Disproof by Counter Example

To disprove a statement of the form:


 x  D, P(x)  Q(x)
• Find a value of x in D for which P(x) is true and Q(x) is false.
• Such an example is called counter example.

Example : Prove or disprove


 a, b  Z, a2 = b2  a = b
Disproof:
Let P(a, b)  a2 = b2, Q(a, b)  a = b,
Now P(1, -1)  (1)2 = (-1)2 true but Q(1, -1)  1  -1

Method of Proof by Contradiction


Steps in proving by contradiction
• Suppose the statement to be proved is false
• Show that this supposition leads logically to a contradiction
• Conclude that the statement to be proved is true

Example:
• Prove that sum of an irrational and a rational number is irrational

Proof
• Suppose a is a rational, b is an irrational number and their sum is also rational
• Since a is rational, a = p/q, p, q  Z and q  0
• Now according to our supposition a + b is rational and hence it can be written as
a + b = m/n, where m, n  Z and n  0

Dr. Nazir Ahmad Zafar | Virtual University of Pakistan


299 CS-702 Advanced Algorithms Analysis and Design

• Now consider
a + b = m/n
 b = m/n – a = m/n – p/q = (mp – nq)/nq = r/s,
where r, s  Z and s  0
 b is a rational number, which is contradiction.
 Hence sum of an irrational and a rational number is always irrational.

Proof by Contradiction
Lemma
• For any integer n and any prime number p, if p divides n then p does not divide n + 1
Proof
• Express the statement in the form:
 x  D, P(x)  Q(x)
• Let, Z = set of all integers, and
• P = set of all primes
• D(p, n)  p divides n
• DN(p, n)  p does not divide n
• Now our problem becomes
 n  Z, p  P, D(p, n)  DN(p, n + 1)
• Suppose that for some integer n and prime p, p divides n  D(p, n)
• Now we have to prove that p does not divide n + 1
• On contrary we suppose that p divide n + 1
• It means that there exists an integer q1 such that n + 1 = pq1
• Since p divides n. Hence there exists an integer q2 such that n = pq2
• Now, n + 1 – n = pq1 – pq2
1 = pq1–pq2 = p(q1– q2)  p = 1 or -1 contradiction
• Hence p does not divide n + 1  DN(p, n)

Dr. Nazir Ahmad Zafar | Virtual University of Pakistan


300 CS-702 Advanced Algorithms Analysis and Design

Lecture No. 39
Number Theoretic Algorithms
(Theorems and Algorithms)

Today Covered
• Some More Proofs
• GCD as a Linear Combination
• Finding GCD, a Recursive Theorem
• Euclid‟s Algorithm
• Extended Euclid‟s Algorithm
• Time Complexity of Euclid‟s Algorithm
• Residues and Reduced set of Residues
• Groups and Rings

Method of Proof by Contraposition


Steps in proving by contraposition
• Express the statement to be proved in the form:
 x  D, P(x)  Q(x)
• Rewrite the statement in the contrapositive form
 x  D,  Q(x)   P(x)
• Prove the contrapositive by direct proof
– Suppose that x is an arbitrary but particular element of D such that Q(x) is false
– Show that P(x) is false

Examples: Proof by Contraposition


Example 1
Prove that for all integers n, if n2 is even then n is also even
Proof
• Express the above statement in the form:
 x  D, P(x)  Q(x)
• Suppose that
D = Z,
Even(n, 2)  n2 is even
Even(n)  n is even
• We have to prove that
 n  Z, Even(n, 2)  Even(n)
• Contraposition of the above statement
 n  Z,  Even(n)   Even(n, 2) is even
• Now we prove above contrapositive by direct proof
• Suppose that n is an arbitrary element of Z such that,  Even(n) (n is not even) i.e., n is
odd
• n2 = n.n = odd. odd = odd
• n2 is odd

Dr. Nazir Ahmad Zafar | Virtual University of Pakistan


301 CS-702 Advanced Algorithms Analysis and Design

•  Even(n, 2) is even
• Hence,  n  Z,  Even(n)   Even(n, 2) is even
• Therefore,  n  Z, Even(n, 2)  Even(n) is even
• Hence  n  Z, if n2 is even then n is even

Example 2
Prove that for all integers n, if n2 is divisible by 7 then n is divisible by 7.
Proof
• Express the above statement in the form:
 x  D, P(x)  Q(x)
• Suppose that
D = Z,
Div(n, 2, 7)  n2 is divisible by 7
Div(n, 7)  n is divisible by 7
• We have to prove that
 n  Z, Div(n, 2, 7)  Div(n, 7)
• Contraposition of the above statement
 n  Z,  Div(n, 7)   Div(n, 2, 7)
• Now we prove above contrapositive by direct proof
• Suppose that n is an arbitrary element of Z such that,  Div(n, 7) (n is not divisible by 7)
• n does contain any factor of 7
• n2 does contain any factor of 7
• Hence,  n  Z,  Div(n, 7)   Div(n, 2, 7)
• Therefore,  n  Z, Div(n, 2, 7)  Div(n, 7)
• Hence,  n  Z, if n2 is divisible by 7 then n is divisible by 7.

Lemma 1
Statement : The square of an odd integer is of the form 8m + 1 for some integer m.
Proof:
• Suppose n is an arbitrary odd integer.
• By quotient remainder theorem any integer has the form
4m, 4m + 1, 4m + 2 OR 4m+3
• Now since n is an odd integer, hence n can be represented as
4m + 1 OR 4m+3
• Now we have to prove that squares of 4m + 1 and 4m + 3 are of the form 8m + 1.
Case 1
Square of 4m + 1
(4m + 1)2 = 16m2 + 8m + 1 = 8(2m2 + m) + 1
= 8m‟ + 1, where m „ = (2m2 + m)

Case 2
Square of 4m + 3
(4m + 3)2 = 16m2 + 24m + 9 = 8(2m2 + 3m + 1) + 1

Dr. Nazir Ahmad Zafar | Virtual University of Pakistan


302 CS-702 Advanced Algorithms Analysis and Design

= 8m‟‟ + 1, where m‟‟ = (2m2 + 3m + 1)


• Hence any odd integer has the form 8m + 1 for some m

Theorem 1
Statement:
• If a and b are any integers, not both zero, then gcd(a, b) is the smallest positive element
of the set {ax + by : x, y  Z} of linear combinations of a and b.
Proof
Let s be the smallest positive such linear combination of a and b, i.e.
s = ax + by, for some x, y  Z
By quotient remainder theorem
a = qs + r = qs + a mod s, where q = ⌊a/s⌋.
a mod s = a – qs = a - q(ax + by) = a (1 - qx) + b(-qy)
• Hence a mod s is a linear combination of a and b.
• But, since a mod s < s, therefore, a mod s = 0
• Now a mod s = 0  s | a
• Similarly we can prove that, s | b.
• Thus, s is a common divisor of both a and b,
• Therefore, s  gcd(a, b) (1)
• We know that if d | a and d | b then d | ax + by for all x, y integers.
• Since gcd(a, b)| a and gcd(a, b) | b, hence gcd(a, b) | s and s > 0 imply that
gcd(a, b) ≤ s. (2)
• By (1) and (2), gcd(a, b) = s

Corollary
Statement;
• For all integers a and b and any nonnegative integer n, gcd(an, bn) = n gcd(a, b).
Proof
• If n = 0, the corollary is trivial.
• If n > 0, then gcd(an, bn) is the smallest positive element of the set {anx + bny}, i.e.
gcd(an, bn) = min {anx + bny} = min{n.{ax + by}} = n. min{ax + by}
n times smallest positive element of set {ax + by}.
• Hence gcd(an, bn) = n.gcd(x, y)

Relatively Prime Integers


• Two integers a, b are said to be relatively prime if their only common divisor is 1, i. e, if
gcd(a, b) = 1.

Generalized Form of Relatively Prime Integers


• We say that integers n1, n2, ..., nk are pairwise relatively prime if, whenever i ≠ j, we
have gcd(ni, nj) = 1.

Dr. Nazir Ahmad Zafar | Virtual University of Pakistan


303 CS-702 Advanced Algorithms Analysis and Design

Lemma 2
• For any integers a, b, and p, if both gcd(a, p) = 1 and gcd(b, p) = 1, then gcd(ab, p) = 1.

Proof
• As, gcd(a, p) = 1, there exist integers x, y such that
ax + py = 1 (1)
• gcd(b, p) = 1, there exist integers x‟, y‟ such that bx‟ + py‟ = 1 (2)
• Multiplying equations (1) and (2) and rearranging, ab(x x′) + p(ybx′ + y′ax + pyy′) = 1,
abx‟‟ + py‟‟ = 1
• Since 1 is a positive linear combination of ab and p,
• Hence gcd(ab , p) = 1,which completes the proof

Lemma 3
• For all primes p and all integers a, b, if p | ab, then p | a or p | b (or p divides both and b).

Proof
• Let P = set of all primes; Z = set of all integers
• P(p, ab)  p | ab; Q(p, a, b)  p | a or p | b
• Express above statement to be proved in the form:
 a, b, p, P(p, ab)  Q(p, a, b)
•  p  P, a, b  Z, p | ab  (p | a or p | b)
• Assume for the purpose of contradiction that p | ab but that p ∤ a and p ∤ b.
• Now p ∤ a  gcd(a, p) = 1
• And, p ∤ b  gcd(b, p) = 1
• Since only divisors of p are 1 and p, and by assumption p divides neither a nor b.
• Above Lemma 2, states that for any integers a, b, and p, if both gcd(a, p) = 1 and gcd(b,
p) = 1, then gcd(ab, p) = 1.
• Now, gcd(ab,p)=1, contradicts our assumption that p | ab, since p | ab ↔ gcd(ab, p) = p
• This contradiction completes the proof.

Theorem 2: GCD Recursion Theorem


• For any nonnegative integer a and any positive integer b, gcd(a, b) = gcd(b, a mod b).

Proof
• If we will be able to prove that gcd(a, b) and gcd(b, a mod b) divide each other, It will
complete the proof of the theorem. This is because both are nonnegative.
Case 1
• We first show that gcd(a, b) | gcd(b, a mod b).
• If we let d = gcd(a, b).
• By quotient remainder theorem:
(a mod b) = a - qb, where q = ⌊a/b⌋.

Dr. Nazir Ahmad Zafar | Virtual University of Pakistan


304 CS-702 Advanced Algorithms Analysis and Design

• Now d = gcd(a, b) 
– d | a and
– d | b,
• Hence, d | (a – qb),
(this is because, a – qb is a linear combination of a and b, where x = 1, y = -q)
• And consequently d | (a mod b),
this is because (a mod b = a – qb)
• Now, d | b and d | (a mod b), implies that:
d | gcd(b, a mod b)
• Hence gcd(a, b) | gcd(a, a mod b). (A)

Case 2
• We now show that: gcd(a, a mod b) | gcd(a, b).
• If we let, d = gcd(b, a mod b), then
d | b and
d | (a mod b).
• By quotient remainder theorem
a = qb + (a mod b), where q = ⌊a/b⌋,
• a is a linear combination of b and a mod b,  d | a
• Now, d | a and d | b  d | gcd(a, b)
• Hence, gcd(a, a mod b) | gcd(a, b) (B)
• By (A) and (B):
gcd(a, b) = gcd(b, a mod b).

Example: Compute gcd (1970, 1066)

a = 1970, b = 1066
• 1970 = 1 x 1066 + 904 = gcd(1066, 904), R = 904
• 1066 = 1 x 904 + 162 = gcd(904, 162), R = 162
• 904 = 5 x 162 + 94 = gcd(162, 94), R = 94
• 162 = 1 x 94 + 68 = gcd(94, 68), R = 68
• 94 = 1 x 68 + 26 = gcd(68, 26), R = 26
• 68 = 2 x 26 + 16 = gcd(26, 16), R = 16
• 26 = 1 x 16 + 10 = gcd(16, 10), R = 10
• 16 = 1 x 10 + 6 = gcd(10, 6), R=6
• 10 = 1 x 6 + 4 = gcd(6, 4), R=4
• 6=1x4+2 = gcd(4, 2), R=2
• 4=2x2+0 = gcd(2, 0), R=0

Hence gcd(1970, 1066) = 2

Dr. Nazir Ahmad Zafar | Virtual University of Pakistan


305 CS-702 Advanced Algorithms Analysis and Design

Euclid’s Algorithm
EUCLID(a, b)
1 if b = 0
2 then return a
3 else return EUCLID(b, a mod b)

Example
• Compute the gcd of 30 and 21

Solution
• EUCLID(30, 21) = EUCLID(21, 9) = EUCLID(9, 3)
= EUCLID(3, 0) = 3
• Here, there are three recursive invocations of EUCLID.
• The correctness of EUCLID follows from Theorem 2
• And the fact that if the algorithm returns a in line 2, then b = 0, and so gcd(a, b) = gcd(a,
0) = a

Note:
• The algorithm cannot recurse indefinitely
• This is because the second argument strictly decreases in each recursive call
• And this second argument is also always nonnegative.
• Hence it must be 0 after some number of calls
• Therefore, EUCLID always terminates with the correct answer.

Running Time of Euclid’s Algorithm


• We analyze the worst-case running time of EUCLID as a function of the size of a and b.
• We assume without loss of generality that a > b ≥ 0.
• This assumption justified because if b > a ≥ 0, then EUCLID(a, b) makes recursive call
EUCLID(b, a).
• That is, if first argument is less than second one, EUCLID spends one recursive call
swapping a, b
• Similarly, if b = a > 0, the procedure terminates after one recursive call, since a mod b =
0.
• The overall running time of EUCLID is proportional to the number of recursive calls it
makes.
• Our analysis makes use of the Fibonacci numbers Fk, defined earlier in the first part of
our course

Statement
• If a > b ≥ 1 and the invocation EUCLID(a, b) takes k ≥ 1 recursive calls, then a ≥ Fk+2
and b ≥ Fk+1.

Dr. Nazir Ahmad Zafar | Virtual University of Pakistan


306 CS-702 Advanced Algorithms Analysis and Design

Proof
The proof is by induction on k.

Case 1
• For base case, let k = 1. Then, b ≥ 1 = F2, and since a > b, we must have a ≥ 2 = F3.
• Hence the statement is true for k = 1
• Please note that, b > (a mod b), in each recursive call, i.e., first argument is strictly larger
than the second and hence the assumption that a > b therefore holds for each recursive
call.
Case 2
• Now suppose that the lemma is true for k – 1 i.e., if a > b ≥ 1 and invocation EUCLID(a,
b) takes k-1 ≥ 1 recursive calls, then a ≥ Fk+1 and b ≥ Fk.
Case 3
• Now we have to prove that statement is true for k i.e. if a > b ≥ 1 and invocation
EUCLID(a, b) takes k ≥ 1 recursive calls, then a ≥ Fk+2 and b ≥ Fk+1.
• Since k > 0, and b > 0, and EUCLID(a, b) calls EUCLID(b, a mod b) recursively, which in
turn makes k - 1 recursive calls.
• Since we know that statement is true for k-1, hence b ≥ Fk+1, and (a mod b) ≥ Fk.
• Now we have
b + (a mod b) = b + (a - ⌊a/b⌋ b) (1)
• Since, a > b > 0, therefore, ⌊a/b⌋ ≥ 1
 ⌊a/b⌋ b ≥ b
 b - ⌊a/b⌋ b  0
 a + b - ⌊a/b⌋ b  0 + a
 b + (a - ⌊a/b⌋ b)  a
• By (1), b + (a mod b) = b + (a - ⌊a/b⌋ b) ≤ a
• b + (a mod b) ≤ a
• Thus, a ≥ b + (a mod b) ≥ Fk+1 + Fk = Fk+2 .
• Hence, a ≥ Fk+2, It completes proof of the theorem

Extended Euclid’s Algorithm


EXTENDED-EUCLID(a, b)
1 if b = 0
2 then return (a, 1, 0)
3 (d‟, x‟, y‟)  EXTENDED-EUCLID(b, a mod b)
4 (d, x, y)  (d‟, y‟, x‟ -  a/b y‟)
5 return (d, x, y)

Proof of Correctness
d‟ = bx‟+ (a mod b)y‟
d = bx‟+ (a -  a/bb)y‟ gcd(a, b) = gcd(b, a mod b)
d = ay‟ + b(x‟ -  a/by‟)

Dr. Nazir Ahmad Zafar | Virtual University of Pakistan


307 CS-702 Advanced Algorithms Analysis and Design

Reduced set of residues mod n


• Complete set of residues is: 0 . . . n-1
• Reduced set of residues consists of all those numbers (residues) which are relatively
prime to n
• And it is denoted by
Zn* = {k : gcd(k, n) = 1, 0  k < n}
• The number of elements in reduced set of residues is called the Euler Totient Function
(n)

Example
• For n = 10, find reduced list of residues of n
• All residues: {0, 1, 2, 3, 4, 5, 6, 7, 8, 9}
• Reduced residues (primes) = {1, 3, 7, 9}, (n) = 4

Group
Definition of a Group: Group is a set, G, together with a binary operation : G * G  G, usually
denoted by a*b, such that the following properties are satisfied :
• Associativity :
(a*b)*c = a*(b*c) for all a, b, c  G
• Identity :
 e  G, such that e*g = g = g*e for all g  G.
• Inverse :
For each g  G, there exists the g‟, inverse of g, such that g‟*g = g*g‟ = e

The Multiplicative Group Z*n

Zn* = {k : gcd(k, n) = 1, 1 k < n}


For any positive integer n, Zn* forms a group under multiplication modulo n.

Proof:
• Binary Operation
Let a, b Zn*, gcd(a, n) = 1; gcd(b, n) = 1
gcd(ab, n) = gcd(a, n)*gcd(b,n) = 1*1 = 1
• Associativity holds,
• 1 is the identity element.
• inverse of each element exits
Hence (Zn* ,*) forms a group.

Dr. Nazir Ahmad Zafar | Virtual University of Pakistan


308 CS-702 Advanced Algorithms Analysis and Design

Rings
Definition: A ring is a set R with two binary operations + : R × R → R and · : R × R → R (where
× denotes the Cartesian product), called addition and multiplication, such that:
• (R, +) is an abelian group with identity element 0
1. (a + b) + c = a + (b + c)
2. 0 + a = a + 0 = a
3. For every a in R, there exists an element denoted −a,
such that a + −a = −a + a = 0
4. a + b = b + a

Definition (Contd..)
• (R, ·) is a monoid with identity element 1:
1. (a·b)·c = a·(b·c)
2. 1·a = a·1 = a
• Multiplication distributes over addition:
1. a·(b + c) = (a·b) + (a·c)
2. (a + b)·c = (a·c) + (b·c)
Note
• Ring addition is commutative so that a + b = b + a
• But ring with multiplication is not required to be commutative i.e. a·b need not equal b·a.
• Rings that satisfy commutative property for multiplication are called commutative rings.
• Not all rings are commutative.
• Rings need not have multiplicative inverses either.
• An element a in a ring is called a unit if it is invertible with respect to multiplication
• An element a is called invertible under multiplication if there is an element b in the ring
such that a·b = b·a = 1,
• This b is uniquely determined by a and we write a−1 = b.

Lemma
• The set of all units in R forms a group under ring multiplication

Example
Prove that Z (+, *) ( the set of integers) is a ring.

Solution
+ and * are binary operation on Z because sum and product of two integers are also an integer
• Now, a, b, c  Z
1. (a + b) + c = a + (b + c),
2. 0 + a = a + 0 = a
3. a + (−a) = (−a) + a = 0
4. a + b = b + a
Hence (Z, +) is an abelian group with identity element 0

Dr. Nazir Ahmad Zafar | Virtual University of Pakistan


309 CS-702 Advanced Algorithms Analysis and Design

• Since, a, b, c  Z
1. (a·b)·c = a·(b·c)
2. 1·a = a·1 = a
Hence (Z, ·) is a monoid with identity element 1
• Finally a, b, c  Z
1. a·(b + c) = (a·b) + (a·c)
2. (a + b)·c = (a·c) + (b·c)
i.e., multiplication is distributive over addition
Hence we can conclude that Z (+, *) is a ring

Dr. Nazir Ahmad Zafar | Virtual University of Pakistan


310 CS-702 Advanced Algorithms Analysis and Design

Lecture No. 40
Chinese Remainder Theorem
RSA Cryptosystem

Addition: Modulo 8

Dr. Nazir Ahmad Zafar | Virtual University of Pakistan


311 CS-702 Advanced Algorithms Analysis and Design

Reduced set of residues mod n


• Complete set of residues is Zn = {0, 1, . . ., n-1}
• Reduced set of residues consists of all those numbers (residues) which are relatively
prime to n
• And it is denoted by
Zn* = {k : gcd(k, n) = 1, 0  k < n}
• The number of elements in reduced set of residues is called the Euler Totient Function
(n)

Example 1
• For n = 10, find reduced list of residues of n
• All residues: {0, 1, 2, 3, 4, 5, 6, 7, 8, 9}
• Reduced residues (primes) = {1, 3, 7, 9}, (n) = 4

Group
Group is a set, G, together with a binary operation : G * G  G, usually denoted by a*b, such
that the following properties are satisfied :
• Associativity :
(a*b)*c = a*(b*c) for all a, b, c  G
• Identity :
 e  G, such that e*g = g = g*e for all g  G.
• Inverse :
For each g  G, there exists the g‟, inverse of g, such that g‟*g = g*g‟ = e

Result: The Multiplicative Group Zn*


Statement: Zn* = {k : gcd(k, n) = 1, 1 k < n}. For any positive integer n, Zn* forms a group
under multiplication modulo n.
Proof:
• Binary Operation
– Let a, b Zn*, gcd(a, n) = 1; gcd(b, n) = 1
– gcd(ab, n) = gcd(a, n)*gcd(b,n) = 1*1 = 1
• Associativity holds,
– 1 is the identity element.
• inverse of each element exits
– Hence (Zn* ,*) forms a group.

Rings
A ring is a set R with two binary operations + : R × R → R and · : R × R → R (where × denotes
the Cartesian product), called addition and multiplication, such that:
• (R, +) is an abelian group with identity element 0
1. (a + b) + c = a + (b + c)
2. 0 + a = a + 0 = a
3. For every a in R, there exists an element denoted −a, such that a + −a =−a+a=0

Dr. Nazir Ahmad Zafar | Virtual University of Pakistan


312 CS-702 Advanced Algorithms Analysis and Design

4. a + b = b + a
• (R, ·) is a monoid with identity element 1:
1. (a·b)·c = a·(b·c)
2. 1·a = a·1 = a
• Multiplication distributes over addition:
1. a·(b + c) = (a·b) + (a·c)
2. (a + b)·c = (a·c) + (b·c)

Definition: An element a in a ring R is called unit if there exists b in R such that a·b = b·a = 1

Lemma
• Set of all units in R forms a group under ring multiplication

Example 2: Prove that Z (+, *) ( the set of integers) is a ring.

Solution: + and * are binary operation on Z because sum and product of two integers are also
an integer
• Now, a, b, c  Z
1. (a + b) + c = a + (b + c),
2. 0 + a = a + 0 = a
3. a + (−a) = (−a) + a = 0
4. a + b = b + a
Hence (Z, +) is an abelian group with identity element 0

Example 2: Rings
• Since, a, b, c  Z
1. (a·b)·c = a·(b·c)
2. 1·a = a·1 = a
Hence (Z, ·) is a monoid with identity element 1
• Finally a, b, c  Z
1. a·(b + c) = (a·b) + (a·c)
2. (a + b)·c = (a·c) + (b·c)
i.e., multiplication is distributive over addition
Hence we can conclude that Z (+, *) is a ring
Modular Arithmetic
• Modular arithmetic for integer n:
Zn = {0, 1, . . ., n-1}
forms a commutative ring for addition with a multiplicative identity

Lemma 1
For a, b, c  Z
If (a + b) ≡ (a + c) mod n then b ≡ c mod n

Dr. Nazir Ahmad Zafar | Virtual University of Pakistan


313 CS-702 Advanced Algorithms Analysis and Design

Lemma 2
For a, b, c  Z
If (a*b) ≡ (a*c) mod n then b ≡ c mod n only if a is relatively prime to n i.e. gcd(a, n) = 1.

Solving Modular Linear Equations


Definition: A congruence of the form ax ≡ b (mod m) is called a linear congruence.

Solving:
• To solve this congruence, objective is to find the x that satisfy the given equation.
• An inverse of a, modulo m is any integer a′ such that, a′a ≡ 1 (mod m).
• If we can find such an a′, then we can solve ax ≡ b by multiplying throughout by it, giving
a′ax ≡ a′b,
• Thus, 1·x ≡ a′b,  x ≡ a′b (mod m).

Theorem
• If gcd(a, m) = 1 and m > 1, then a has a unique inverse a′ (modulo m).
Proof:
• Since gcd(a, m) = 1,
hence  s, t such that, sa + tm = 1
• So, sa + tm ≡ 1 (mod m).
• Since tm ≡ 0 (mod m), sa ≡ 1 (mod m).
• Thus s is an inverse of a (mod m).
• Hence this Theorem guarantees that if ra ≡ sa ≡ 1 then r ≡ s, thus this inverse is unique
mod m.

Chinese Remainder Theorem


Theorem:
• Let m1,…,mk > 0 be relatively prime. Then the system of equations:
x ≡ a1 (mod m1)
x ≡ a2 (mod m2)
.
x ≡ ak (mod mk)
has a unique solution modulo m = m1·…·mk.

Proof:
• We are given that, m = m1·…·mk.
• Let Mi = m/mi. for i = 1, . . . , k
• Since gcd(mi, Mi) = 1, hence by above Theorem,
 yi = Mi′ such that yiMi ≡ 1 (mod mi) for i = 1, . . . , k
• Let x = a1y1M1 + a2y2M2 + . . .+ akykMk = ∑ aiyiMi
• Now m1 does don‟t divide M1
• But m2|M1, m3|M1, . . ., mk|M1
• Similarly m2 does don‟t divide M2

Dr. Nazir Ahmad Zafar | Virtual University of Pakistan


314 CS-702 Advanced Algorithms Analysis and Design

• But m1|M2, m3|M2, m4|M2, . . ., mk|M2 and so on


• Hence mi does don‟t divide Mi,  i  {1, 2, . . . , k}
• But mi|Mj,  i  j, i, j  {1, 2, . . . , k}
• Therefore, Mj ≡ 0 (mod mi) j ≠ i,
• Now we show that x is simultaneous solution
• x ≡ a1 (mod m1)
• Since x = a1y1M1 + a2y2M2 + . . .+ akykMk
• Hence x ≡ a1y1M1 ≡ 1.a1 = a1 (mod m1).
• x ≡ a2y2M2 ≡ 1.a2 = a2 (mod m2).
• ...
• x ≡ akykMk ≡ 1.ak = ak (mod mk).
• Thus, x is the solution

Application: Example 3
Solve the given system of linear modular equations using Chinese Remainder Theorem.
x ≡ 2 (mod 3), a1 = 2
x ≡ 3 (mod 5), a2 = 3
x ≡ 2 (mod 7) , a3 = 2
Solution
• As m1 = 3, m2 = 5, m3 = 7, hence m = 3.5.7 = 105
• Now M1 = m/m1 = 105/3 = 35, M2 = m/m2 = 105/5 = 21 and M3 = m/m3 = 105/7 = 15
• Inverse of M1 (modulo 3) = y1 = 2
• Inverse of M2 (modulo 5) = y2 = 1
• Inverse of M3 (modulo 7) = y3 = 1
• Now, x, solution to this systems is
x ≡ a1y1M1 + a2y2M2 + a3y3M3
= 2.35.2 + 3.21.1 + 2.15.1 = 233 (mod 105)
≡ 23 (mod 105)
• Thus 23 is the smallest positive integer that is a simultaneous solution.

Verification
23 ≡ 2 (mod 3)
23 ≡ 3 (mod 5)
23 ≡ 2 (mod 7)

Unique Representation of a Number by CRT


• Let m1,…,mk are pair-wise relatively prime integers, let m = m1·…·mk. Then by CRT it
can be proved that any integer a, 0 ≤ a ≤ m can be uniquely represented by n-tuple
consisting of its remainders upon division by mi (i = 1, 2, . . ., k). That is we can
uniquely represent a by
(a mod m1, a mod m2, . . . , a mod mk) = (a1, a2 ,…, ak )

Dr. Nazir Ahmad Zafar | Virtual University of Pakistan


315 CS-702 Advanced Algorithms Analysis and Design

Example 4
• Pairs to represent non-negative integers < 12, first component is result of division by 3,
second by 4
0 = (0, 0); 1 = (1, 1); 2 = (2, 2); 3 = (0, 3);
4 = (1, 0); 5 = (2, 1); 6 = (0, 2); 7 = (1, 3);
8 = (2, 0); 9 = (0, 1); 10 = (1, 2); 11 = (2, 3)

Example 5
• Compute (1, 2) if m1 = 3 and m2 = 4
Solution
• x ≡ 1 (mod 3)
• x ≡ 2 (mod 4)
• m1 = 3, m2 = 4, hence m = 12
• Now M1 = m/m1 = 4, M2 = m/m2 = 3
• Inverse of M1 (modulo 3) = y1 = 1
• Inverse of M2 (modulo 4) = y2 = 3
• Now x ≡ a1y1M1 + a2y2M2 = 1.1.4 + 2.3.3 = 22 mod 12 = 10

Example 6: Chinese Remainder Theorem


• Let m1 = 99, m2 = 98, m3 = 97 and m4 = 95
• Now any integer < 99.98.97.95 = 89,403,930 can be uniquely represented by its
remainders when divided by 99, 98, 97 and 95 respectively.
• If a = 123,684, b = 413,456 then compute a + b.

Solution
• Now 123,684 mod 99 = 33; 123,684 mod 98 = 8
• 123,684 mod 97 = 9; 123,684 mod 95 = 89
• Hence a = 123,684 = (33, 8, 9, 89)
• Similarly
• 413,456 mod 99 = 32; 413,456 mod 98 = 92
• 413,456 mod 97 = 42; 413,456 mod 95 = 16
• Hence b = 413,456 = (32, 92, 42, 16)
• Now a + b = 123,684 + 413,456
= (33, 8, 9, 89) + (32, 92, 42, 16)
= (65 mod 99, 100 mod 98, 51 mod 97, 105 mod 99)

Now we want to find a number x satisfying following


x ≡ 65 (mod 99) x ≡ 2 (mod 98) x ≡ 51 (mod 97) x ≡ 10 (mod 95)
This can be solved using CRT, Answer = 537,140

The RSA Public Key Cryptosystem


• RSA involves a public key and a private key.
• The public key can be known to everyone and is used for encrypting messages.
• Messages encrypted with the public key can only be decrypted using the private key.

Dr. Nazir Ahmad Zafar | Virtual University of Pakistan


316 CS-702 Advanced Algorithms Analysis and Design

• The keys for the RSA algorithm are generated by the following way:
1. Choose two distinct large random prime numbers p and q such that p  q
2. Compute n by the equation n = pq, n is used as the modulus for both the public and
private keys
3. Compute the totient function (n)
4. Choose an integer e such that 1 < e < (n) and e and (n) share no factors other
than 1 (co-prime), e is released as the public key exponent
5. Compute d to satisfy the congruence relation;
de ≡ 1 mod (n) i.e.
de = 1 + k(n) for some integer k
d is kept as the private key exponent
6. Publish the pair P =(e, n) as his RSA public Key
7. Keep secret pair S =(d, n) as his RSA secret Key

Property: Totient Function


Prove that
• (p.q) = (p-1).(q-1), where p and q are prime numbers
Proof
• If n = p, a prime number, then (p) = (p-1); e.g., ((7) = 6 because 7 is prime)
• If n = p * q where p and q are both prime then (n) = (p*q)
• As above (p) = p - 1
• Similarly (q) = q - 1
• For (n) = (p*q), the residues will beS1 = {0, 1, 2,. . ., (pq-1)}
• Out of S1, residues that are not relatively prime to n:
S2 = {p, 2p, ….(q-1)p}, S3 = {q, 2q,……(p-1)q}, S4 = {0}
• The number of elements of S1 = pq
• The number of elements of S2 = q-1
• The number of elements of S3 = p-1
• The number of elements of S4 = 1
• Hence number of relatively prime elements in S1 is
• (n) = pq – [(q-1)+(p-1)+1]
= pq – q + 1 – p + 1 -1
= pq – q – p + 1 = (p-1)(q-1) = (p) * (q)

Dr. Nazir Ahmad Zafar | Virtual University of Pakistan


317 CS-702 Advanced Algorithms Analysis and Design

Lecture No. 41
RSA Cryptosystem
String Matching

Fermat Theorem
• If p is prime, a is positive integer not divisible by p,
ap-1 = 1 mod p OR ap = a mod p
Proof
• Consider the set, Zp = {0,1,…, p –1}
• Multiplying each element of Zp by “a mod p”, the result is a set, A, of all the elements of
Zp with a different sequence, where A = Zp
A = {0, a mod p, 2a mod p……(p-1)a mod p}
• {0, a mod p, 2a mod p……(p-1)a mod p} = {0,1,…, p –1} Since A = Zp
• If all the elements are multiplied together, except 0, on both sides we should
• {a mod p * 2a mod p… *(p-1) a mod p} mod p = 1.2. . . .(p-1) mod p OR
p-1
a (p-1)! mod p = (p-1)! mod p
• Since (p-1)! is relatively prime to p. So It can be cancelled from both sides
• ap-1 mod p ≡ 1 OR
p-1
• a ≡ 1 mod p OR
• ap ≡ a mod p

Euler’s Theorem: Generalization of Fermat’s


Statement
• If a and n are relatively prime then
a(n) + 1 = a mod n OR a(n) = 1 mod n
Proof
• If n = prime, then (n) = n – 1
• By Fermat‟s Theorem an-1 = a(n) = 1 mod n
• If n is a positive integer, then (n) = number of positive integers less than n, relatively
prime to n.
• Consider such positive integers as follows:
S1 = {x1, x2, . . ., x(n) }
• Now multiply each element with a mod n
S2 = {a x1 mod n, a x2 mod n, . . ., a x(n) mod n}

Euler’s Theorem
• The set S2 is a permutation of S1 because:
1. a is relatively prime to n.
2. xi is relatively prime to n.
3. Therefore axi is also relatively prime to n.
• Hence each axi mod n has value less than n
• Hence every element of S2 is relatively prime to n and less than n.
• The number of elements of S2 equal to that of S1

Dr. Nazir Ahmad Zafar | Virtual University of Pakistan


318 CS-702 Advanced Algorithms Analysis and Design

• Moreover S2 contains no duplicates. It is because if axi mod n = axj mod n, then xi = xj


• But S1 has no duplicates
• On multiplying the terms of S1 and S2
 ( axi mod n) =  xi OR
 (axi) = (  xi ) mod n OR
a = 1 mod n OR a = a mod n, Proved
Corollary:
• Given primes p and q. Let m and n are integers such that n = p*q and 0 < m < n then
m(n)+1 = m mod n OR m(n) = 1 mod n

RSA Cryptosystem
Encryption:
• Any number m, (m < n), can be encrypted.
• ciphertext c = me mod n

Decryption:
• cd mod n gives us back m.

Proof
• To prove that cd mod n is equal to m:
• cd mod n = (me)d mod n
= mde mod n
• Since de = 1 mod (n)  de = k(n) + 1
cd = mde = mk(n) +1
• By the above corollary to Euler‟s theorem,
cd = mde = mk(n) +1 = m mod n = m, since m < n

Example: RSA Cryptosystem


• Encrypt message STOP using RSA cryptosystem with p = 43, q = 59 and e = 13, n = pq
= 2537,
Solution
• gcd(e, (p-1)(q-1)) = 1, encryption can be done
• Translate STOP in numerical values, blocks of 4
1819 1415
• Encrypt
C = Me mod 2537 = M13 mod 2537
• After computing using fast modular multiplication
• 181913 mod 2537 = 2081;141513 mod 2537 = 2181
• The encrypted message is: 2081 2182

Dr. Nazir Ahmad Zafar | Virtual University of Pakistan


319 CS-702 Advanced Algorithms Analysis and Design

Example: RSA Cryptosystem


• Decrypt 0981 0461 if encrypted using RSA
• Public key = (e, n) = (13, 43.59 = 2537)
Solution
• p = 43, p-1 = 42, q = 59, q-1 = 58, e = 13
• d = e-1 mod (p-1).(q-1) = 13-1 mod 42.58 = 937
• Decrypt
M = C937 mod 2537 = C937 mod 2537
• After computing using fast modular multiplication
• 0981937 mod 2537 = 0704;0461937 mod 2537 = 1115
• The decrypted message is: 0704 1115
• Translating back to English: HELP

String Matching Problem


• We assume that the text is an array T [1 .. n] of length n and that the pattern is an array
P[1 .. m] of length m ≤ n.
• We further assume that the elements of P and T are characters drawn from a finite
alphabet Σ.
– For example, we may have Σ = {0, 1} or Σ = {a, b, . . . , z}.
• The character arrays P and T are often called strings of characters
• We say that pattern P occurs with shift s in text T (or, equivalently, that pattern P
occurs beginning at position s + 1 in text T) if
0 ≤ s ≤ n - m and T [s + 1 .. s + m] = P[1 .. m] i.e. T
[s + j] = P[ j], for 1 ≤ j ≤ m).
– If P occurs with shift s in T, we call s a valid shift;
– otherwise, we call s an invalid shift.

String Matching Problem


• The string-matching problem is “finding all valid shifts with which a given pattern P
occurs in a given text T”.

Dr. Nazir Ahmad Zafar | Virtual University of Pakistan


320 CS-702 Advanced Algorithms Analysis and Design

Definitions and Notations

Notation Terminology
Σ* The set of all finite-length strings formed using characters from
the alphabet Σ.
ε The zero-length empty string, also belongs to Σ*.
|x| The length of a string x.
xy The concatenation of two strings x and y has length |x| + |y| and
consists of the characters from x followed by the characters from
y.
w x A string w is a prefix of a string x, if x = wy for some string y  Σ*.
If w x, then |w| ≤ |x|.
w↖x String w is a suffix of a string x, if x = yw for some y  Σ*. If w ↖ x
that |w| ≤ |x|.

Naive Approach
• The idea is based on Brute Force Approach.
• The naive algorithm finds all valid shifts using a loop that checks the condition P[1 .. m] =
T[s + 1 .. s + m] for each of the n - m + 1 possible values of s.
• It can be interpreted graphically as sliding a “template“ containing the pattern over the
text, noting for which shifts all of the characters on the template equal the corresponding
characters in the text.

NAIVE-STRING-MATCHER(T, P)
1 n ← length[T]
2 m ← length[P]
3 for s ← 0 to n - m
4 do if P[1 .. m] = T[s + 1 .. s + m]
5 then print "Pattern occurs with shift" s

• Worst case Running Time


– Outer loop: n – m + 1
– Inner loop: m
– Total O((n - m + 1)m)
• Best-case: n-m

Note
• Not an optimal procedure for String Matching problem.
• It has high running time for worst case.
• The naive string-matcher is inefficient because information gained about the text for one
value of s is entirely ignored in considering other values of s.

Dr. Nazir Ahmad Zafar | Virtual University of Pakistan


321 CS-702 Advanced Algorithms Analysis and Design

The Rabin-Karp Algorithm


• Let us assume that Σ = {0, 1, 2, . . . , 9}, so that each character is a decimal digit.
• A string of k consecutive characters is viewed as representing a length-k decimal
number.
• Given a pattern P[1 .. m], let p denote its corresponding decimal value and a text T [1 ..
n], we let ts denotes the decimal value of the length-m substring T[s + 1 .. s + m], for s =
0, 1, ..., n - m.
• Now, ts = p if and only if T [s + 1 .. s + m] = P[1 .. m];
thus, s is a valid shift if and only if ts = p.
• We can compute p in time Θ(m) using Horner's rule
p = P[m] + 10 (P[m - 1] + 10(P[m - 2] + · · · + 10(P[2] + 10P[1]) )).

Example: Horner's rule:

“345” = 5 + 10(4 + 10(3)) = 5 + 10(4 + 30) = 5 + 340 = 345

• The value t0 can be similarly computed from T [1 .. m] in time Θ(m).


• To compute the remaining values t1, t2, . . . , tn-m in time Θ(n - m), it suffices to observe
that ts+1 can be computed from ts in constant time.
• Subtracting 10m-1 T[s + 1] removes the high-order digit from ts, multiplying the result by
10 shifts the number left one position, and adding T [s + m + 1] brings in the appropriate
low-order digit.
ts+1 = (10(ts – T[s + 1] 10m-1 ) + T[s + m + 1])
• The only difficulty with this procedure is that p and ts may be too large to work with
conveniently.
• Fortunately, there is a simple cure for this problem compute p and the ts's modulo a
suitable modulus q.

Dr. Nazir Ahmad Zafar | Virtual University of Pakistan


322 CS-702 Advanced Algorithms Analysis and Design

Lecture No. 42
String Matching

String Matching Problem


• Given a text T [1 .. n] of length n, a pattern P[1 .. m] of length m ≤ n, both as arrays.
• Further assume that elements of P and T are characters drawn from a finite set of
alphabets Σ.
• Now for 0 ≤ s ≤ n - m if
T [s + j] = P[ j],  j {1, 2,. . ., m}
• then p occurs in T with shift s, and we call s as a valid shift; otherwise, s an invalid shift.
• Now our objective is “finding all valid shifts with which a given pattern P occurs in a text
T”.

Naive String Matching Algorithm


NAIVE-STRING-MATCHER(T, P)
1 n ← length[T]
2 m ← length[P]
3 for s ← 0 to n - m
4 do if P[1 .. m] = T[s + 1 .. s + m]
5 then print "Pattern occurs with shift" s

• Worst case Running Time


– Outer loop: n – m + 1
– Inner loop: m
– Total O((n - m + 1)m)
• Best-case: n-m

Example: Naive String Matching Algorithm

n ← length[T] = 6
m ← length[P] = 3
for s ← 0 to n – m (6 - 3 = 3)
P[1] = T[s + 1]
P[1] = T[1] (As a = a)

P[2] = T[s + 2]
But P[2] ↖ T[2] (As a ↖ c)

Dr. Nazir Ahmad Zafar | Virtual University of Pakistan


323 CS-702 Advanced Algorithms Analysis and Design

for s ← 1
P[1] = T[s + 1]
But P[1] ↖ T[2] (As a ↖ c)

for s ← 2
P[1] = T[s + 1]
P[1] = T[3] (As a = a)

P[2] = T[s + 2]
P[2] = T[4] (As a = a)
P[3] = T[s + 3]
P[3] = T[5] (As b = b)

for s ← 3
P[1] = T[s + 1]
P[1] = T[4] (As a = a)

P[2] = T[s + 2]
But P[2] ↖ T[5] (As a ↖ b)

The Rabin-Karp Algorithm


Special Case
• Given a text T [1 .. n] of length n, a pattern P[1 .. m] of length m ≤ n, both as arrays.
• Assume that elements of P and T are characters drawn from a finite set of alphabets Σ.
• Where Σ = {0, 1, 2, . . . , 9}, so that each character is a decimal digit.
• Now our objective is “finding all valid shifts with which a given pattern P occurs in a text
T”.
Notations:
Let us suppose that
• p denotes decimal value of given a pattern P[1 .. m]
• ts = decimal value of length-m substring T[s + 1 .. s + m], of given text T [1 .. n], for s = 0,
1, ..., n - m.

Dr. Nazir Ahmad Zafar | Virtual University of Pakistan


324 CS-702 Advanced Algorithms Analysis and Design

• It is very obvious that, ts = p if and only if


T [s + 1 .. s + m] = P[1 .. m];
thus, s is a valid shift if and only if ts = p.
• Now the question is how to compute p and ts efficiently
• Answer is Horner‟s rule

Horner’s Rule
Example: Horner‟s rule
[3, 4, 5] = 5 + 10(4 + 10(3)) = 5 + 10(4 + 30) = 5 340 = 345
p = P[3] + 10 (P[3 - 1] + 10(P[1])).

Formula
• We can compute p in time Θ(m) using this rule as
p = P[m] + 10 (P[m-1] + 10(P[m-2] + … + 10(P[2] + 10P[1]) ))
• Similarly t0 can be computed from T [1 .. m] in time Θ(m).
• To compute t1, t2, . . . , tn-m in time Θ(n - m), it suffices to observe that ts+1 can be
computed from ts in constant time.

Computing ts+1 from ts in constant time


• Text = [3, 1, 4, 1, 5, 2]; t0 = 31415
• m = 5; Shift = 0
• Old higher-order digit = 3
• New low-order digit = 2
• t1 = 10.(31415 – 104.T(1)) + T(5+1)
= 10.(31415 – 104.3) + 2
= 10(1415) + 2 = 14152
• ts+1 = 10(ts – T[s + 1] 10m-1 ) + T[s + m + 1])
• t1 = 10(t0 – T[1] 104) + T[0 + 5 + 1])
• Now t1, t2, . . . , tn-m can be computed in Θ(n - m)

Procedure: Computing ts+1 from ts


1. Subtract T[s + 1]10m-1 from ts, removes high-order digit
2. Multiply result by 10, shifts the number left one position
3. Add T [s + m + 1], it brings appropriate low-order digit.
ts+1 = (10(ts – T[s + 1] 10m-1 ) + T[s + m + 1])

Another issue and its treatment


• The only difficulty with the above procedure is that p and ts may be too large to work with
conveniently.

Dr. Nazir Ahmad Zafar | Virtual University of Pakistan


325 CS-702 Advanced Algorithms Analysis and Design

• Fortunately, there is a simple cure for this problem, compute p and the ts modulo a
suitable modulus q.

Computing ts+1 from ts Modulo q = 13


• A window of length 5 is shaded.
• The numerical value of window = 31415
• 31415 mod 13 = 7

Spurious Hits and their Elimination


• m = 5.
• p = 31415,
• Now, 31415 ≡ 7 (mod 13)
• Now, 67399 ≡ 7 (mod 13)
• Window beginning at position 7 = valid match; s = 6
• Window beginning at position 13 = spurious hit; s = 12
• After comparing decimal values, text comparison is needed

The Rabin-Karp Algorithm


Generalization
• Given a text T [1 .. n] of length n, a pattern P[1 .. m] of length m ≤ n, both as arrays.
• Assume that elements of P and T are characters drawn from a finite set of alphabets Σ =
{0, 1, 2, . . . , d-1}.
• Now our objective is “finding all valid shifts with which a given pattern P occurs in a text
T”.

Dr. Nazir Ahmad Zafar | Virtual University of Pakistan


326 CS-702 Advanced Algorithms Analysis and Design

Note
• ts+1 = (d(ts – T[s + 1]h) + T[s + m + 1]) mod q where h = dm-1 (mod q) is the value of the
digit “1” in the high-order position of an m-digit text window.

Sequence of Steps Designing Algorithm


1. Compute the lengths of pattern P and text T
2. Compute p and ts under modulo q using Horner‟s Rule
3. For any shift s for which ts ≡ p (mod q), must be tested further to see if s is really valid
shift or a spurious hit.
4. This testing can be done by checking the condition: P[1 .. m] = T [s + 1 .. s + m]. If these
strings are equal s is a valid shift otherwise spurious hit.
5. If for shift s, ts ≡ p (mod q) is false, compute ts+1 and replace it with ts and repeat the step
3.

Note
• As ts ≡ p (mod q) does not imply that ts = p, hence text comparison is required to find
valid shift

RABIN-KARP-MATCHER(T, P, d, q)
1 n ← length[T]
2 m ← length[P]
3 h ← dm-1 mod q
4 p←0
5 t0 ← 0
6 for i ← 1 to m Preprocessing.
7 do p ← (dp + P[i]) mod q
8 t0 ← (dt0 + T[i]) mod q
9 for s ← 0 to n - m Matching.
10 do if p = ts
11 then if P[1 .. m] = T [s + 1 .. s + m]
12 then print "Pattern occurs with shift" s
13 if s < n - m
14 then ts+1 ← (d(ts - T[s + 1]h) + T[s + m + 1]) mod q

Analysis: The Rabin-Karp Algorithm


• Worst case Running Time
– Preprocessing time: Θ(m)
– Matching time is Θ((n – m + 1)m)
• If P = am, T = an, verifications take time Θ((n - m + 1)m), since each of the n - m + 1
possible shifts is valid.
• In applications with few valid shifts, matching time of the algorithm is only O((n - m + 1) +
cm) = O(n + m), plus the time required to process spurious hits.

Dr. Nazir Ahmad Zafar | Virtual University of Pakistan


327 CS-702 Advanced Algorithms Analysis and Design

String Matching with Finite Automata

• A finite automaton M is a 5-tuple (Q, q0, A, Σ, δ), where


– Q is a finite set of states,
– q0  Q is the start state,
– A Q is a distinguished set of accepting states,
– Σ is a finite input alphabet,
– δ is a function from Q × Σ into Q, called the transition function of M.
• String-matching automata are very efficient because it examines each character exactly
once, taking constant time.
• The matching time used-after preprocessing the pattern to build the automaton-is
therefore Θ(n).

Some Results
1. Empty string is both a suffix and a prefix of every string.
2. For any strings x and y and any character a, we have x ↖ y if and only if xa ↖ ya.
3. Also it can be proved that and ↖ are transitive relations.

Proof :Property 3
• Suppose that x y and y z, we have to prove that x z.
• x y   w1  Σ* such that y = xw1 (A)
• y z   w2  Σ* such that z = yw2 (B)
• From (A) and (B)
z = yw2 = xw1w2

Example: Transition Table and Finite Automata


• Q = {0, 1}, = {a, b} and transition function is shown below
• A simple two-state finite automaton which accepts those strings that end in an odd
number of a‟s.

Dr. Nazir Ahmad Zafar | Virtual University of Pakistan


328 CS-702 Advanced Algorithms Analysis and Design

Final State Function φ


• A finite automaton M induces a function φ, called the final-state function, from Σ* to Q
such that φ(w) is the state of M that ends up in after scanning the string w.
• Thus, M accepts a string w if and only if φ(w)  A.
• The function φ is defined by the recursive relation
φ(ε) = q0,
φ(wa) = δ(φ(w), a) for w  Σ*, a  Σ.
• There is a string-matching automaton for every pattern P; constructed in a preprocessing
step.

Suffix Function ζ
• An auxiliary function ζ, called the suffix function is defined corresponding to given
pattern P.
• Function ζ is a mapping from Σ* to {0, 1, . . . , m} such that ζ(x) is length of the longest
prefix of P that is a suffix of x i.e. ζ(x) = max {k : Pk ↖ x}.
• The suffix function ζ is well defined since the empty string P0 = ε is a suffix of every
string.
• For a pattern P of length m, we have ζ(x) = m if and only if P ↖ x.
• It follows from the definition of the suffix function that if x ↖ y, then ζ(x) ≤ ζ(y).

String Matching Automata


• The string-matching automaton that corresponds to a given pattern P[1.. m] is defined as
• The state set Q is {0, 1, . . . , m}. The start state q0 is state 0, and state m is the only
accepting state.
• The transition function δ is defined by the following equation, for any state q and
character a: δ (q, a) = ζ(Pqa)
• The machine maintains as an invariant of its operation φ(Ti) = ζ(Ti)

String Matching Automata for given Pattern

• Pattern string P = ababaca.


• Edge towards right shows matching
• Edge towards is fro failure
• No edge for some for state and
some alphabet means that edge hits
initial state

Dr. Nazir Ahmad Zafar | Virtual University of Pakistan


329 CS-702 Advanced Algorithms Analysis and Design

String Matching using Finite Automata

• Finite Automata for Pattern


– P = ababaca
– Text T = abababacaba.

Dr. Nazir Ahmad Zafar | Virtual University of Pakistan


330 CS-702 Advanced Algorithms Analysis and Design

FINITE-AUTOMATON-MATCHER(T, δ, m)
1 n ← length[T]
2 q←0
3 for i ← 1 to n
4 do q ← δ(q, T[i])
5 if q = m
6 then print "Pattern occurs with shift" i - m

• Matching time on a text string of length n is Θ(n).


• Memory Usage: O(m|Σ|),
• Preprocessing Time: Best case: O(m|Σ|).

COMPUTE-TRANSITION-FUNCTION(P, Σ)
1 m ← length[P]
2 for q ← 0 to m
3 do for each character a  Σ
4 do k ← min(m + 1, q + 2)
5 repeat k ← k - 1
6 until Pk ↖ Pqa
7 δ(q, a) ← k
8 return δ
Running Time = O(m3 |Σ|)

Summary
Algorithm Preprocessing Time Matching Time
Naïve 0 O((n-m+1)m)
Rabin-Karp O(m) O((n-m+1)m)
Finite Automaton O(m| |) O(n)

Dr. Nazir Ahmad Zafar | Virtual University of Pakistan


331 CS-702 Advanced Algorithms Analysis and Design

Lecture No. 43
Polynomials and Fast Fourier Transform

Definitions
A Field is a set F with two binary operations + : F × F → F and * : F × F → F such that
1. (F, +) is an abelian group with identity element 0
2. (F\{0}, *) is an abelian group with identity element 1
3. Multiplication distributes over addition
– a*(b + c) = (a*b) + (a*c)
– (a + b)*c = (a*c) + (b*c)

Polynomial
• A polynomial in the variable x over an algebraic field F is a representation of a function
A(x) as a formal sum
A(x) = a0 + a1x1 + a2x2 + . . .+ anxn
Coefficients
• Values a0, a1,..., an are coefficients of polynomial, and drawn from a field F, typically set
of complex numbers.
Degree
• A polynomial A(x) is said to have degree n if its highest coefficient an is nonzero
Degree Bound
• Any integer strictly greater than the degree of a polynomial is a degree-bound of that
polynomial.

Addition of two Polynomials: Brute Force


Addition of two polynomials of degree n takes Θ(n) time,
Example 1
A (x) = a0 + a1x1 + a2x2 + . . .+ anxn
B (x) = b0 + b1x1 + b2x2 + . . .+ bnxn
C (x) = (a0 + b0) + (a1 + b1) x1 + . . .+(an + bn)xn

Multiplication of Two Polynomial: Brute Force


Multiplication of two polynomials of degree n takes Θ(n2)
Example 2
A (x) = a0 + a1x1 + a2x2 + . . .+ anxn
B (x) = b0 + b1x1 + b2x2 + . . .+ bnxn
a0b0 + a1b0x1 + . . .+ (anb0)xn
a0b1x1 + a1b1x2 + . . .+ (anb1)xn+1
...
a0bn xn + a1bnxn+1 + . . .+ (anbn)xn+n
C (x) = (a0b0) + (a1b0 + a0b1)x1 + . . . + (anbn)xn+n

Dr. Nazir Ahmad Zafar | Virtual University of Pakistan


332 CS-702 Advanced Algorithms Analysis and Design

Polynomial Representation
1. The Coefficient Representation
2. Point Value Presentation

Note
• The method for multiplying polynomials equations as above take (n2) time when the
polynomials are represented in coefficient form
• But (n) time when represented in point value form
• We can multiply using coefficient representation in only (n log n) time converting
between two forms
• This lecture make much use of complex numbers, the symbol i has same meaning, you
know sqr(-1)

1. Coefficient Representation
• A coefficient representation of a polynomial degree bound n is a vector of coefficients: a
= (a0, a1,…, an-1)

Vectors as Column
• In this lecture, we will treat vector as column vector

Convenient Way
• The coefficients representation is convenient for certain operations on polynomials

Example: Computing A(x) at x0


• Operation of evaluating polynomials A(x) at given point x0 consists of computing value of
A(x0).
• Evaluation takes time (n) using Horner‟s rule

Evaluation and Addition using Coefficient Form


• Operation 1: Horner‟s Rule
A(x0)= a0 + x0( a1 + x0( a2 +…x 0(an-2 +x0(an-1))… )
• Operation 2: Addition of Two Polynomials
Similarly adding two polynomials represented by the coefficient vectors:
a = (a0, a1 ,…, an-1 ) and
b = (b0, b1, … ,bn-1) takes (n) times
• We just produce the coefficient vector:
c = (c0, c1,…, c n-1) where cj = aj + bj,  j = 1 ,…, n – 1
• Operation 3: Multiplication of Two Polynomials
– Consider multiplication of A(x) and B(x), with degree bounds n, represented in
coefficient form
– If we use the method described above polynomials multiplication takes time O(n2).
– Since each coefficient in vector a must be multiplied by each coefficients in the
vector b.

Dr. Nazir Ahmad Zafar | Virtual University of Pakistan


333 CS-702 Advanced Algorithms Analysis and Design

– Operation of multiplying polynomials in coefficient form seems to be considerably


more difficult than that of evaluating or adding two polynomials.
– The resulting coefficient vector c, also called the convolution of the input vectors a
and b.

2. Point–value Representation
• A point value representation of a polynomial A(x) of degree bound n is a set of n point
value pairs. { (x0, y0), (x1, y1),. . . ,(x n-1, y n-1) },
all of the x k are distinct and y k = A(x k), for k = 0,1, . . ., n-1.
• Polynomial has various point value representations, since any set of n distinct points
x0 ,x1 ,…,x n-1 can be used as a basis for the representation.

Conversion: From a Coefficient Form to Point Value Form


• Computing a point value representation for a polynomials given in coefficient form is in
principle straight forward ,
• This is because select n distinct points x0 ,x1 ,…,x n-1 and then evaluate A(x k)
for k = 0,1 ,…, n-1.
• With Horner‟s rule, n-point evaluation takes q(n2).
• This is because for x = x0, evaluation cost is q(n). And since there are n number of
points, hence there will be q(n2) cost for evaluating all of the n number of points using
Horner‟s rule.
Clever Choose of xk
• We shall see that if we choose xk cleverly, this computation can be accelerated to run in
q(n log n)
• Inverse of evaluating coefficient form of polynomial from point value representation
called interpolation.

Theorem: Uniqueness of an interpolating polynomial


• For any set { (x0, y0),(x1, y1),. . ., (x n-1, y n-1) } of n point–value pairs such that all xk values
distinct, there is a unique polynomial A(x) of degree bound n such that yk = A(xk) for k =
0,1, . . ., n-1.
Proof
• Proof is based on existence of inverse of a matrix.
• Let us suppose that A(x) is required polynomial
A(x) = a0 + a1x1 + a2x2 +. . .+ anxn
• Equation: yk = A(xk) is equivalent to the matrix equation given in the next slide.
1 x0 x02 ..... x0n1   a0   y0 
 
1 x1 x12 ..... x1n1   a1   y1 
. . . ..... .   .    . 
     
. . . ..... .   .   . 
1 xn1 xn21 ..... xnn11   an1   yn1 
     

Dr. Nazir Ahmad Zafar | Virtual University of Pakistan


334 CS-702 Advanced Algorithms Analysis and Design

• This matrix on the left side is called vander-monde matrix and is denoted
V(x0, x1, …..xn-1)
– The determinant of this this matrix is  ( xk  x j )
0 j k n1

• If xk are distinct then it is nonsingular. The coefficient aj can be uniquely determined


a = V(x0, x1, …..xn-1)-1 y

Solving The Equation in Proof of Theorem


• Using LU decomposition algorithms, we can solve these equation in O(n3)
• A faster algorithm, in Θ(n2), for n-point interpolation is based on Lagrange's formula:
n1  (x  xj )
 yk
j k

k 0
 ( xk  x j )
j k

Addition using Point Value Form


• The point-value representation is quite convenient for many operations on polynomials.
• For addition:
C(x) = A(x) + B(x)  C(xk) = A(xk) + B(xk)
• More precisely, if point value representation for A
– {(x0, y0), (x1, y1),. . ., (xn-1, yn-1)},
• And for B: {(x0, y‟0), (x1, y‟1),. . ., (xn-1, y‟n-1)},
• Then a point-value representation for C is
{(x0, y0+y‟0), (x1, y1+y‟1),. . ., (xn-1, yn-1+y‟n-1)},
• Thus, the time to add two polynomials of degree-bound n in point-value form is Θ(n).

Multiplication using Point Value Form


• Similarly, point-value representation is convenient for multiplying polynomials as well.
C(x) = A(x) B(x)  C(xk) = A(xk)B(xk) for any xk,
• We can multiply a point value representations for A and B to obtain a point-value
representation for C.
• A standard point-value representation for A and B consists of n point-value pairs for
each polynomial
• Multiplying these, we must extended point-value representations for A and B of 2n point-
value each.
• Given an extended point-value representation for A,
{(x0, y0), (x1, y1),..., (x2n-1, y2n-1)},

• And extended point-value representation for B,


{(x0, y‟0), (x1, y‟1),..., (x2n-1, y‟2n-1)},
• Then a point-value representation for C is
{(x0, y0 y‟0), (x1, y1 y‟1),..., (xn-1, yn-1 y‟n-1)}
• Finally, we consider how to evaluate a polynomial given in point-value form at a new
point.

Dr. Nazir Ahmad Zafar | Virtual University of Pakistan


335 CS-702 Advanced Algorithms Analysis and Design

• Apparently no simpler approach than converting polynomial to coefficient form, and then
evaluating it

Discrete Fourier Transform


• We can use any points as evaluation points, but by choosing evaluation points carefully,
we can convert between representations in only Θ(n lg n) time.
• If we take “complex roots of unity” evaluation points, we can produce a point-value
representation taking Discrete Fourier Transform of coefficient vector.
• The inverse operation, interpolation, can be performed by taking “inverse DFT” of point-
value pairs, yielding a coefficient vector.
• We will show how FFT performs the DFT and inverse DFT operations in Θ(n lg n)
• Multiplication procedure is shown in the next slide

Fast multiplication of polynomials in coefficient form

Procedure: Multiplication of Polynomials in n lg n


We assume n is a power of 2; this requirement can always be met by adding zero coefficients.
1. Double degree-bound:
– Create coefficient representations of A(x) and B(x) as degree bound 2n polynomials
by adding n high-order zero coefficients to each.

2. Evaluate:
– Compute point-value representations of A(x) and B(x) of length 2n through two
applications of FFT of order 2n. These representations contain the values of the two
polynomials at the (2n)th roots of unity.

Dr. Nazir Ahmad Zafar | Virtual University of Pakistan


336 CS-702 Advanced Algorithms Analysis and Design

3. Point wise multiply:


– Compute point-value form for polynomial C(x) = A(x)B(x) by multiplying these
together point wise. This representation contains the value of C(x) at each (2n)th root
of unity.

4. Interpolate:
– Create coefficient representation of C(x) through a single application of an FFT on 2n
point-value pairs to compute inverse DFT.

Steps (1) and (3) take time Θ(n), and steps (2) and (4) take time Θ(n lg n).

Complex Roots of Unity and Their Properties


• We claimed that if we use complex roots of unit we can evaluate and interpolate
polynomials in Θ(nlgn) time.
• Here, we define complex roots of unity and study their properties.
• Define the DFT,and then show how the FFT computes the DFT and its inverse in just
Θ(nlgn) time.
Complex root of unity
A complex nth root of unity is a complex
number ω such that ωn =1

There are exactly n complex nth roots of


unity: e2πik/n for k=0,1,…,n-1
eiu =cos(u) + isin(u).
Values of ω08 , ω18 ,. . ., ω78 in complex
plane are shown where ω8 = e2πi/8 is the
principal 8th root of unity.

Complex roots of unity form a cyclic group


Complex roots of unity have interesting
properties. Some of those are discussed in
the next

Properties: Complex Roots of Unity

Lemma 1 (cancellation lemma)


• For any integers n ≥ 0,k ≥0,and d > 0, ωdkdn = ωkn .

Proof:
• the lemma follows directly from ωn =e2πi/n ,since
– ωdkdn = (e2πi/dn)dk
– =(e2πi/n)k
– = ωkn

Dr. Nazir Ahmad Zafar | Virtual University of Pakistan


337 CS-702 Advanced Algorithms Analysis and Design

Corollary 1 (cancellation lemma)


• For any even integer n > 0,
ωn/2n = -1

Proof:
We know that ωn =e2πi/n
Now ωn/2n = ωn/22.n/2 = ω2 = ωn =e2πi/2 = ωn =eπi = -1

Lemma 2 (Halving Lemma)


• If n > 0 is even, then squares of n complex nth root of unity are the n/2 complex (n/2)th
root of unity.
Proof:
• By the cancellation lemma, we have: (ωnk )2 = ωkn/2
• For any nonnegative integer k, note that if we square all of complex nth root of unity,
then each (n/2)th root of unity is obtained exactly twice, since
(ωnk +n/2)2 = ω2k+nn/2
= ω2knωnn = ω2kn

Halving Lemma is Essential in Reducing Cost


• Thus ωkn and ωk+n/2n/2 have the same square.
• This property can also be proved using corollary,
ωnn/2 = ω2 = -1
• Since ωn/2n = -1 implies ωk+n/2n = - ωkn and thus
(ωnk +n/2)2 = (ωnk)2
• As we shall see, the halving lemma is essential to our divide-and-conquer approach of
converting between coefficient and point-value representation of polynomials
• Since it guarantees that the recursive sub problems are only half as large.

Lemma 3 (Summation Lemma)


For any integer n ≥ 1 and nonnegative integer k not divisible by n,
n-1
∑ (ωkn)j = 0
j=0

Proof:
n-1
• ∑ (ωkn)j = (ωnk)n-1
j=0
ωnk-1
(ωnn)k-1
=
ωnk-1
k
= (1) -1
ωnk-1
= 0
• Requiring that k not be divisible by n ensures that the denominator is not 0, since ωnk = 1
only when k is divisible by n.

Dr. Nazir Ahmad Zafar | Virtual University of Pakistan


338 CS-702 Advanced Algorithms Analysis and Design

The DFT
Recall that we wish to evaluate a polynomial
n-1
A(x) = ∑ ajxj
j=0

of degree-bound n at ωn0 ,ωn1, ωn2, ……..ωnn-1 ( that is, at the n complex nth roots of unity).
• Without loss of generality, we assume that n is a power of 2, since a given degree-bound
can always be raised we can always add new high-order zero coefficients as necessary.
• We assume that A is given in coefficient from a = ( a0, a1,. . ., an-1).
• Let us define the results yk for k = 0,1,. . ., n-1, by
yk = A(ωkn)
n-1
= ∑ aj ωk jn
j=0

• The vector y = (y0, y1,. . ., yn-1) is Discrete Fourier Transform (DFT) of the coefficient
vector a = ( a0, a1,. . ., an-1).
• We can also write y = DFTn(a)

The FFT

And hence  yk[0]  A[0] (kn /2 )


A ( x)  a0  a2 x  a4 x  .....  an  2 x
[0] 2 n /2 1 Let  [1]
 yk  A (n /2 )
[1] k

A[1] ( x)  a1  a3 x  a5 x 2  .....  an 1 x n /21 (A)


(*) A( x)  A[0] ( x 2 )  xA[1] ( x 2 ) yk  A(nk )  A[0] (n2 k )  n2 k A[1] (n2 k  n )
= A[0] (kn /2 )  kn A[1] (kn /2 )
Thus evaluating A(x) at 0n , 1n ,....., nn 1 reduce to
= yk[0]  nk yk[1]
1. evaluating A[0] ( x) and A[1] ( x) at
(0n )2 , (1n )2 ,....., (nn 1 )2
yk  n /2  A(nk  n /2 )  A[0] (n2 k  n )  nk  n /2 A[1] (2n k )
2. combining the results according to (*)
= A[0] (kn /2 )  kn  n /2 A[1] (kn /2 )
= yk[0]  nk  n /2 yk[1]  yk[0]  nk yk[1]

Dr. Nazir Ahmad Zafar | Virtual University of Pakistan


339 CS-702 Advanced Algorithms Analysis and Design

FFT Recursive Algorithm


Recursive-FFT(a)
{ n=length[a]; /* n: power of 2 */
if n=1 the return a;
n  e 2 i / n ;
=1
a [0]  (a0 , a2 ,....., an  2 );
a [1]  (a1 , a3 ,....., an 1 );
y[0]  Recursive-FFT(a [0] );
y[1]  Recursive-FFT(a [1] );
for k=0 to (n/2 - 1) do
{
y k  y[0]
k  y k ;
[1]

y k+n/2  y[0]
k  y k ;
[1]

=n ; }
}

T (n)  2T (n / 2)  (n)
=(nlog n)

Dr. Nazir Ahmad Zafar | Virtual University of Pakistan


340 CS-702 Advanced Algorithms Analysis and Design

Lecture No. 44
NP Completeness

Polynomial Time Algorithms


• On any inputs of size n, if worst-case running time of algorithm is O(nk), for constant k,
then it is called polynomial time algorithm
• Every problem can not be solved in polynomial time
• There exists some problems which can not be solved by any computer, in any amount of
time, e.g. Turing‟s Halting Problem
• Such problems are called un-decidable
• Some problems can be solved but not in O(nk)

Polynomial Time (Class P)


• These problems are solvable in polynomial time
• Problems in class P are also called tractable

Intractable Problems
• Problems not in P are called intractable
• These problems can be solved in reasonable amount of time only for small input size

Decision problems
• The problems which return yes or no for a given input and a question regarding the
same problem

Optimization problems
• Find a solution with best value, it can be maximum or minimum. There can be more than
one solutions for it
• Optimization problems can be considered as decision problems which are easier to
study.
• Finding a path between u and v using fewest edges in an un-weighted directed graph is
O. P. but does a path exist from u to v consisting of at most k edges is D. P.?

NP: Nondeterministic Problems

Class NP
• Problems which are verifiable in polynomial time.
• Whether there exists or not any polynomial time algorithm for solving such problems, we
do not know.
• Can be solved by nondeterministic polynomial
• However if we are given a certificate of a solution, we could verify that certificate is
correct in polynomial time
• P = NP?

Dr. Nazir Ahmad Zafar | Virtual University of Pakistan


341 CS-702 Advanced Algorithms Analysis and Design

Nondeterministic algorithm: break in two steps


1) Nondeterministic step generate a candidate solution called a certificate
2) Deterministic (verification) Step. It takes certificate and an instance of problem as input,
returns yes if certificate represents solution
– In NP problems, verification step is polynomial

Example: Hamiltonian Cycle


• Given: a directed graph G = (V, E),
determine a simple cycle that
contains each vertex in V, where
each vertex can only be visited once
• Certificate:
– Sequence: v1, v2, v3, …, vn
– Generating certificates
• Verification:
1. (vi, vi+1)  E for i = 1, …, n-1
2. (vn, v1)  E
It takes polynomial time

Reduction in Polynomial Time Algorithm


• Given two problems A, B, we say that A is reducible to B in polynomial time (A p B) if
1. There exists a function f that converts the input of A to inputs of B in polynomial
time
2. A(x) = YES  B(f(x)) = YES
where x is input for A and f(x) is input for B

Solving a decision problem A in polynomial time


• Use a polynomial time reduction algorithm to transform A into B
• Run a known polynomial time algorithm for B
• Use the answer for B as the answer for A

Dr. Nazir Ahmad Zafar | Virtual University of Pakistan


342 CS-702 Advanced Algorithms Analysis and Design

NP Complete
• A problem A is NP-complete if
1) A  NP
2) B p A for all B  NP
• If A satisfies only property No. 2 then B is NP-hard
• No polynomial time algorithm has been discovered for an NP-Complete problem
• No one has ever proven that no polynomial time algorithm can exist for any NP-
Complete problem

Reduction and NP Completeness


• Let A and B are two problems, and also suppose that we are given
– No polynomial time algorithm exists for problem A
– If we have a polynomial reduction f from A to B
• Then no polynomial time algorithm exists for B

Relation in Between P, NP, NPC


• P  NP (Researchers Believe)
• NPC  NP (Researchers Believe)
• P = NP (or P  NP, or P  NP) ???
• NPC = NP (or NPC  NP,
or NPC  NP) ???
• P  NP
• One of the deepest, most perplexing
open research problems in
theoretical computer science since
1971

Problem Definitions: Circuit Satisfiability


Boolean Combinational Circuit
• Boolean combinational elements wired together
• Each element takes a set of inputs and produces a set of outputs in constant number,
assume binary
• Limit the number of outputs to 1
• Logic gates: NOT, AND, OR
• Satisfying assignment: a true assignment causing the output to be 1.
• A circuit is satisfiable if it has a satisfying assignment.

Dr. Nazir Ahmad Zafar | Virtual University of Pakistan


343 CS-702 Advanced Algorithms Analysis and Design

Two Instances: Satisfiable and Un-satisfiable

Problem: Circuit Satisfiability


Statement
• Given a boolean combinational circuit composed of AND, OR, and NOT, is it stisfiable?
Intuitive solution
• For each possible assignment, check whether it generates 1.
• Suppose the number of inputs is k, then the total possible assignments are 2k.
• So the running time is (2k).
• When the size of the problem is (k), then the running time is not polynomial

Lemma 2: CIRCUIT-SAT is NP Hard


Proof:
• Suppose X is any problem in NP
• Construct polynomial time algorithm F that maps every instance x in X to a circuit C =
f(x) such that x is YES  C  CIRCUIT-SAT (is satisfiable).
• Since X  NP, there is a polynomial time algorithm A which verifies X.
• Suppose the input length is n and Let T(n) denote the worst-case running time.
• Let k be the constant such that T(n) = O(nk) and the length of the certificate is O(nk).

Circuit Satisfiability Problem is NP-complete


• Represent computation of A as a sequence of configurations, c0, c1,…,ci,ci+1,…,cT(n),
each ci can be broken into various components
• ci is mapped to ci+1 by the combinational circuit M implementing the computer hardware.
• It is to be noted that A(x, y) = 1 or 0.
• Paste together all T(n) copies of the circuit M. Call this as, F, the resultant algorithm
• Please see the overall structure in the next slide

Dr. Nazir Ahmad Zafar | Virtual University of Pakistan


344 CS-702 Advanced Algorithms Analysis and Design

• Now it can be proved that:


1. F correctly constructs reduction, i.e., C is satisfiable if and only if there exists a
certificate y, such that A(x, y) = 1.
2. F runs in polynomial time

(Left as an assignment)
• Construction of C takes O(nk) steps, a step takes polynomial time
• F takes polynomial time to construct C from x.

Dr. Nazir Ahmad Zafar | Virtual University of Pakistan


345 CS-702 Advanced Algorithms Analysis and Design

NP-completeness Proof Basis


Lemma 3
• If X is problem such that P„ p X for some P'NPC, then X is NP-hard. Moreover, X 
NP X NPC.
Proof:
• Since P‟ is NPC hence for all P” in NP, we have
P” p P‟ (1)
• And P„ p X given (2)
• By (1) and (2)
• P” p P‟ p X  P” p X hence X is NP-hard
• Now if X  NP X NPC

Formula Satisfiability: Notations and Definitions


• SAT Definition
– n boolean variables: x1, x2,…, xn.
– m boolean connectives: ,,,,, and
– Parentheses.
• A SAT  is satisfiable if there exists a true assignment which causes  to evaluate to 1.

In Formal Language
• SAT={< >:  is a satifiable boolean formula}.

SAT is NP Complete
Theorem:
• SAT is NP-complete.
Proof:
• SAT belongs to NP.
– Given a satisfying assignment
– Verifying algorithm replaces each variable with its value, and evaluates formula
in polynomial time.
• SAT is NP-hard
– Sufficient to show that CIRCUIT-SATp SAT
• CIRCUIT-SATp SAT, i.e., any instance of circuit satisfiability can be reduced in
polynomial time to an instance of formula satisfiability.
• Intuitive induction:
– Look at the gate that produces the circuit output.
– Inductively express each of gate‟s inputs as formulas.
– Formula for circuit is obtained by writing an expression that applies gate‟s
function to its input formulas.
• Unfortunately, this is not a polynomial time reduction
• This is because the gate whose output is fed to 2 or more inputs of other gates, cause
size to grow exponentially.

Dr. Nazir Ahmad Zafar | Virtual University of Pakistan


346 CS-702 Advanced Algorithms Analysis and Design

Example of Reduction of CIRCUIT-SAT to SAT

= x10(x10(x7 x8 x9))


(x9(x6  x7))
(x8(x5  x6))
(x7(x1 x2 x4))
(x6 x4))
(x5(x1  x2))
(x4x3)

INCORRECT REDUCTION: = x10= x7 x8 x9=(x1 x2 x4)  (x5  x6) (x6  x7)
=(x1 x2 x4)  ((x1  x2)  x4) (x4  (x1 x2 x4))=….

NPC Proof: 3 CNF Satisfiability

Definitions:
• A literal in a boolean formula is an occurrence of a variable or its negation.
• Clause, OR of one or more literals.
• CNF (Conjunctive Nornal Form) is a boolean formula expressed as AND of clauses.
• 3-CNF is a CNF in which each clause has exactly 3 distinct literals.
(a literal and its negation are distinct)
• 3-CNF-SAT: whether a given 3-CNF is satiafiable?

3-CNF-SAT is NP Complete
Proof:
3-CNF-SAT  NP
• 3-CNF-SAT is NP-hard.
• SAT p3-CNF-SAT?
– Suppose  is any boolean formula, Construct a binary „parse‟ tree, with literals as

Dr. Nazir Ahmad Zafar | Virtual University of Pakistan


347 CS-702 Advanced Algorithms Analysis and Design

leaves and connectives as internal nodes.


– Introduce yi for output of each internal node.
– Rewrite formula to „: AND of root and conjunction of clauses describing
operation of each node.
– In ', each clause has at most three literals.
• Change each clause into conjunctive normal form as:
– Construct a true table, (at most 8 by 4)
– Write disjunctive normal form for items evaluating 0
– Using DeMorgan law to change to CNF.
• Result: '' in CNF but each clause has 3 or less literals.
• Change 1 or 2-literal clause into 3-literal clause as:
– Two literals:
(l1 l2), change it to (l1 l2 p)  (l1 l2 p).
– If a clause has one literal l, change it to (lpq)(lpq) (lpq) (lpq).

Binary parse tree for =((x1 x2) ((x1 x3)  x4))x2

Example of Converting a 3-literal clause to CNF format

Dr. Nazir Ahmad Zafar | Virtual University of Pakistan


348 CS-702 Advanced Algorithms Analysis and Design

CLIQUE: NPC Proof


Definition:
• A clique in an undirected graph G = (V, E) is a subset V„  V, each pair of V‟ is
connected by an edge in E, i.e., clique is a complete subgraph of G.
• Size of a clique is number of vertices in the clique.
• Optimization problem: Find maximum size clique.
• Decision problem: whether a clique of given size k exists in the graph?
• CLIQUE = {<G, k>: G is a graph with a clique of size k.}
• Intuitive solution: ???

CLIQUE is NP Complete
• Theorem
– CLIQUE problem is NP-complete.
• Proof:
– CLIUEQE NP: given G = (V, E) and a set V„  V as a certificate for G. The
verifying algorithm checks for each pair of u, v  V', whether <u, v>  E. time:
O(|V'|2|E|).
– CLIQUE is NP-hard:
o Show 3-CNF-SAT pCLUQUE.
o Surprise: from boolean formula to graph.
• Reduction from 3-CNF-SAT to CLUQUE.
– Suppose  = C1 C2… Ck be a boolean formula in 3-CNF with k clauses.
– We construct a graph G = (V, E) as follows:
o For each clause Cr =(l1r l2r l3r), place triple of v1r, v2r, v3r into V
o Put edge between vertices vir and vjs when:
 r  s, i.e. vir and vjs are in different triples, and
 corresponding literals are consistent, i.e, lir is not negation of ljs .
– Then  is satisfiable  G has a clique of size k.

Dr. Nazir Ahmad Zafar | Virtual University of Pakistan


349 CS-702 Advanced Algorithms Analysis and Design

=(x1x2x3)(x1x2x3)(x1x2x3) and its reduced graph G

C1=x1x2 x3

NP-completeness proof structure

Dr. Nazir Ahmad Zafar | Virtual University of Pakistan


350 CS-702 Advanced Algorithms Analysis and Design

Lecture No. 45
Review Lecture

Lecture No 1: Model of Computation


• Analysis independent of the variations in machine, operating system, language,
compiler, etc.
• Our model was an abstraction of a standard generic single-processor machine, called a
random access machine RAM
– infinitely large random-access memory,
– instructions execute sequentially
• Every instruction, a basic operation taking unit time.
• We identified some weaknesses in our model of computation but finally we proved that
with all these weaknesses, our model is not so bad because it fulfils our needs in design
and analysis of algorithms

Lecture No 2, 3, 4 & 5: Mathematical Tools


A Sequence of Mathematical Tools
• Sets, Sequences, Cross Product, Relation, Functions, Operators over above structures
Logic and Proving Techniques
• Propositional Logic, Predicate Logic
• Proofs Logical Equivalences, Contradiction, Rule of Inference
Mathematical Induction
• Simple Induction
• Strong Induction

Lecture 6, 7, 8, & 9: Recursion


• Fibonacci Sequences
• Recursion? Recursive Mathematical Models
• First, second, higher order Linear Homogenous Recurrences with Constant Coefficients
• General Homogenous Recurrence when
– Roots distinct, repeated, multiplicity of root is k
– many roots with different multiplicities
• Non-homogenous Recurrence, Characteristics and solution
• Recursive Tree methods
• Substitution Method
• Proof of Master Theorem

Lecture 10 & 11: Asymptotic Notations


• Major Factors in Algorithms Design
• Complexity Analysis
• Growth of Functions
• Asymptotic Notations
• Usefulness of Notations

Dr. Nazir Ahmad Zafar | Virtual University of Pakistan


351 CS-702 Advanced Algorithms Analysis and Design

• Reflexivity, Symmetry, Transitivity Relations over , , O,  and o


• Relation between ,  and O
• Various Examples Explaining each concept

Lecture 12, 13 & 14


Brute Force Approach,
• Checking primality
• Sorting sequence of numbers
• Knapsack problem
• Closest pair in 2-D, 3-D and n-D
• Finding maximal points in n-D
Divide and Conquer?
• Merge Sort algorithm
• Finding Maxima in 1-D, and 2-D
• Finding Closest Pair in 2-D

Lecture 15 - 24: Dynamic Programming


Optimizations Problems and Dynamic Programming
1. Chain-Matrix Multiplication
2. Assembly Line Scheduling Problem
3. Generalization to n-Line Assembly Problem
4. 0-1 Knapsack Problem
5. Optimal Weight Triangulation
6. Longest Common sub-sequence problem
7. Optimal Binary Search Trees

1. Chain Matrix Multiplication

Statement: The chain-matrix multiplication problem can be stated as below:


• Given a chain of [A1, A2, . . . , An] of n matrices for i = 1, 2, . . . , n, matrix Ai has
dimension pi-1 x pi, find the order of multiplication which minimizes the number of scalar
multiplications.
Objective Function
• Let m[i, j] = minimum number of multiplications needed to compute Ai..j, for 1 ≤ i ≤ j ≤ n
• Objective function = finding minimum number of multiplications needed to compute A1..n
i.e. to compute m[1, n]
2. Assembly-Line Scheduling
• There are two assembly lines each with n stations
• The jth station on line i is denoted by Si, j
• The assembly time at that station is ai,j.
• An auto enters factory, goes into line i taking time ei
• After going through the jth station on a line i, the auto goes on to the (j+1)st station on
either line

Dr. Nazir Ahmad Zafar | Virtual University of Pakistan


352 CS-702 Advanced Algorithms Analysis and Design

• There is no transfer cost if it stays on the same line


• It takes time ti,j to transfer to other line after station Si,j
• After exiting the nth station on a line, it takes time xi for the completed auto to exit the
factory.
• Problem is to determine which stations to choose from lines 1 and 2 to minimize total
time through the factory.

Assembly-Line Scheduling Problem

• Let fi[j] = fastest time from starting point station Si, j


• Objective function = f* = min(f1[n] + x1, f2[n] + x2)
• l* = line no. whose nth station is used in fastest way.

3. n Line Assembly Scheduling Problem


• There are n assembly lines each with m stations
• The jth station on line i is denoted by Si, j
• The assembly time at that station is ai,j.
• An auto enters factory, goes into line i taking time ei
• After going through the jth station on a line i, the auto goes on to the (j+1)st station on
either line
• It takes time ti,j to transfer from line i, station j to line i‟ and station j+1
• After exiting the nth station on a line i, it takes time xi for the completed auto to exit the
factory.
• Problem is to determine which stations to choose from lines 1 to n to minimize total time
through the factory.

Dr. Nazir Ahmad Zafar | Virtual University of Pakistan


353 CS-702 Advanced Algorithms Analysis and Design

• Let fi[j] = fastest time from starting point to station Si, j


• li[j] = Line no. 1 to n, for station j-1 used in fastest way
• ti[j-1] = transfer time from station Si, j-1 to station Si,, j
• a[i, j] = time of assembling at station Si, j
• f* = is minimum time through any way
• l* = line no. whose mth station is used in a fastest way

4. 0-1 Knapsack Problem


Assumption
• Each item must be put entirely in the knapsack or not included at all that is why the
problem is called 0-1 knapsack problem
Remarks
• Because an item cannot be broken up arbitrarily, so it is its 0-1 property that makes the
knapsack problem hard.
• If an item can be broken and allowed to take part of it then algorithm can be solved using
greedy approach optimally

5. Optimal Weight Triangulation Problem


• A triangulation of a convex polygon is a maximal set T of pair-wise non-crossing chords.
• It is easy to see that such a set subdivides interior of polygon into a collection of
triangles, pair-wise disjoint
Problem Statement
• Given a convex polygon, determine a triangulation that minimizes sum of the perimeters
of its triangles

6. Longest Common Subsequence Problem


Statement:
• In the longest-common-subsequence (LCS) problem, we are given two sequences
X = <x1, x2, . . . , xm> and
Y = <y1, y2, . . . , yn>
• And our objective is to find a maximum-length common subsequence of X and Y.

Dr. Nazir Ahmad Zafar | Virtual University of Pakistan


354 CS-702 Advanced Algorithms Analysis and Design

Note:
• This LCS problem can be solved using brute force approach as well but using dynamic
programming it will be solved more efficiently.

Optimal Substructure of an LCS


• If X = (x1, x2,. . ., xm), and Y = (y1, y2, . . ., yn) be sequences and let us suppose that Z =
(z1, z2, . . ., zk) be a longest common sub-sequence of X and Y
1. if xm = yn, then zk = xm and Zk – 1 is LCS of Xm – 1, Yn-1.
2. If xm  yn, then zk  xm implies that Z is LCS of Xm – 1 and Y
3. If xm  yn then zk  yn implies Z is LCS of X and Yn – 1
0 if i  0 OR j  0

c(i, j )  c(i  1, j  1)  1 if i,j  0 and x i  y j
max(c(i  1, j ), c(i, j  1)) if i,j  0 and x i  y j

7. Optimal Binary Search Trees


A translator from English to, say, Urdu.
• Use a binary search tree to store all the words in our dictionary, together with their
translations.
• The word “the” is much more likely to be looked up than the word “ring”
• So we would like to make the search time for the word “the” very short, possibly at the
expense of increasing the search time for the word “ring.”
Problem Statement:
• We are given a probability distribution that determines, for every key in the tree, the
likelihood that we search for this key. Objective is to minimize expected search time of
tree.

Lecture 25-26: Greedy Algorithms


List of Greedy Algorithms discussed in this Course
1. Activity Selection Problem
2. Fractional Knapsack Problem
3. Coin Change Making Problem
4. Huffman Problem
5. Road Trip Problem

Steps Designing Greedy Algorithms


We went through the following steps in the above problem:
1. Determine the suboptimal structure of the problem.
2. Develop a recursive solution.
3. Prove that at any stage of the recursion, one of the optimal choices is the greedy choice.
Thus, it is always safe to make the greedy choice.
4. Show that all but one of the sub-problems induced by having made the greedy choice
are empty.

Dr. Nazir Ahmad Zafar | Virtual University of Pakistan


355 CS-702 Advanced Algorithms Analysis and Design

5. Develop a recursive algorithm that implements the greedy strategy.


6. Convert this recursive algorithm to an iterative one.

Huffman Codes
• In Huffman coding, variable length code is used
• Data considered to be a sequence of characters.
• Huffman codes are a widely used and very effective technique for compressing data
– Savings of 20% to 90% are typical, depending on the characteristics of the data
being compressed.
• Huffman‟s algorithm uses table of frequencies of occurrence of characters to build up an
optimal way of representing each character as a binary string.
• Objective in Huffman coding is to develop a code that represents given text as
compactly as possible

Lecture 27-37: Graph Theoretic Algorithms


Graph Theoretic Algorithms
• Graph Concepts and types of graphs
• Representation of graphs
• Searching Algorithms
• Backtracking, Branch and Bound Algorithms
• Applications of Searching Algorithm
• Minimal Spanning Tree Algorithms
– Kruskal‟s Algorithm
– Prim‟s Algorithm
• Shortest Path Algorithms

Minimum Spanning Tree


• Given a graph G = (V, E) such that
– G is connected and undirected
– w(u, v) weight of edge (u, v)
– T is a Minimum Spanning Tree (MST) of G if
– T is acyclic subset of E (T E)
– It connects all the vertices of G and
– Total weight, w(T) =  w(u, v) is minimized.
(u , v)  T

Shortest Path Problems


• Single-source shortest path
– The Bellman-Ford Algorithm
– Shortest Path in directed acyclic graphs
– Dijkstra‟s Algorithm
• Single-destination shortest path
• Single-pair shortest path
• All-pairs shortest-paths
– Matrix Multiplication

Dr. Nazir Ahmad Zafar | Virtual University of Pakistan


356 CS-702 Advanced Algorithms Analysis and Design

– The Floyd-Warshall Algorithm


– Johnson‟s Algorithm

The Bellman-Ford Algorithm

Total Running Time = O(V.E)

Algorithm: Shortest Path (dag)

Each iteration of for loop takes O(1)


Total Running Time = O (V+E)

Dijkstra‟s Algorithm

Input Given graph G(V, E) with source s, weights w

Assumption
• Edges non-negative, w(u, v) ≥ 0,  (u, v) E
• Directed, if (u, v)  E then (v, u) may or may not  E

Objective: Find shortest paths from s to every u V

Approach
• Maintain a set S of vertices whose final shortest-path weights from s have been
determined
• Repeatedly select, u V – S with minimum shortest path estimate, add u to S, relax all
edges leaving u.
• Greedy, always choose light vertex in V-S , add to S

Dr. Nazir Ahmad Zafar | Virtual University of Pakistan


357 CS-702 Advanced Algorithms Analysis and Design

Lecture 38-40: Number Theoretic Algorithms


• Applications of Number Theory
• Some Important Concepts and Fats useful in number theoretic Algorithms
• Modular Arithmetic
• Finding GCD
• Euclid‟s Algorithm
• Extended Euclid‟s Algorithm
• Residues and Reduced set of Residues
• Chinese Remainder Theorem
• RSA Cryptosystem

The RSA Public Key Cryptosystem


1. Choose two distinct large random prime numbers p and q such that p  q
2. Compute n by n = pq, n is used as modulus
3. Compute the totient function (n)
4. Choose an integer e such that 1 < e < (n) and e and (n) share no factors other than 1
5. Compute d to satisfy the congruence relation; de ≡ 1 mod (n) i.e.
de = 1 + k(n) for some integer k
6. Publish the pair P =(e, n) as his RSA public Key
7. Keep secret pair S =(d, n) as his RSA secret Key

Lecture 41-44: Further Topics


• String Matching Problem
– Naïve approach
– Rabin Karp algorithm
– String Matching using Finite automata
• Polynomials and Fast Fourier Transform
• NP Completeness

Lecture No. 45: Review Lecture

Dr. Nazir Ahmad Zafar | Virtual University of Pakistan


358 CS-702 Advanced Algorithms Analysis and Design

Final -Term 2015 Exam Questions

1. Steps of greedy algorithm design


2. Pseudo code of Huffman coding
3. Prove that circuit-sat is hard
4. Prove gcd(an,bn)=n.gcd(a,b)
5. Decrypted message (example in slides)
6. Backtracking to find maximum profit maximum weight is 8. see example in
backtracking)
7. In DFS if vi is en-queued before vj then prove that d[vi]<d[vj] 5makrs
8. Bellman ford algorithm 5marks
9. Prove that a|0 for all a belong to Z 5 marks
10. Naïve String Matching Algorithm 5 marks
11. For all primes p and all integers a, b, if p | ab, then p | a or p | b (or p divides both
and b)
12. Prime algorithm 10 marks
13. CNF-SAT is NP complete 10 marks
14. If X is problem such that 𝑃′≤𝑝𝑋for some 𝑃′∈𝑁𝑃𝐶, then X is NP-hard.
Moreover,𝑋∈𝑁𝑃⇒𝑋∈𝑁𝑃𝐶 15 marks
15. Write down pseudo code of longest common subsequence?
16. Write down pseudo code of Naive String Matching problem?
17. Write down pseudo code of optimal BST?
18. Write down pseudo code of transition function?
19. Write down prim‟s algorithm?
20. Write down Shortest Path (dag) algorithm?
21. If a > b ≥ 1 and the invocation EUCLID (a, b) takes k ≥ 1 recursive calls, then a ≥
Fk+2 and b ≥ Fk+1 ?
22. If p is prime, a is positive integer not divisible by p, ap-1 = 1 mod p OR ap = a
mod p
23. If gcd(a, m) = 1 and m > 1, then a has a unique inverse a′ (modulo m).
24. If X is problem such that P„≤ p X for some P'∈NPC, then X is NP-hard. Moreover,
X ∈ NP→X∈ NPC.
25. Why we use dynamic programming? Give limitations.....5 marks
26. Pseudo code for Johnson‟s algorithm....5 marks
27. How to print path in BFS algorithm...5 marks.
28. Prove that for a problem X and P' such that P' <p NPC , X is NP hard. ...
29. Extend Shortest Path algorithm.5 marks.

Dr. Nazir Ahmad Zafar | Virtual University of Pakistan

You might also like