http://betterexplained.

com/articles/developing-your-intuition-for-math/
Developing Your Intuition For Math
Our initial exposure to an idea shapes our intuition. And our intuition impacts how much we enjoy a subject. What do I mean?

Suppose we want to define a “cat”:

 Caveman definition: A furry animal with claws, teeth, a tail, 4 legs, that purrs when happy and hisses when angry…
 Evolutionary definition: Mammalian descendants of a certain species (F. catus), sharing certain characteristics…
 Modern definition: You call those definitions? Cats are animals sharing the followingDNA: ACATACATACATACAT…

(Illustration courtesy Common Craft)

The modern definition is precise, sure. But is it the best? Is it what you’d teach a child learning the word? Does it give better insight into the
“catness” of the animal? Not really. The modern definition is useful, but after getting an understanding of what a cat is. It shouldn’t be our starting
point.
Unfortunately, math understanding seems to follow the DNA pattern. We’re taught the modern, rigorous definition and not the insights that led up to
it. We’re left with arcane formulas (DNA) but little understanding of what the idea is.
Let’s approach ideas from a different angle. I imagine a circle: the center is the idea you’re studying, and along the outside are the facts describing it.
We start in one corner, with one fact or insight, and work our way around to develop our understanding.Cats have common physical traits leads
to Cats have a common ancestor leads to A species can be identified by certain portions of DNA. Aha! I can see how the modern definition evolved
from the caveman one.
But not all starting points are equal. The right perspective makes math click — and the mathematical “cavemen” who first found an idea often had an
enlightening viewpoint. Let’s learn how to build our intuition.

What is a Circle?
Time for a math example: How do you define a circle?
There are seemingly countless definitions. Here’s a few:

 The most symmetric 2-d shape possible

 The shape that gets the most area for the least perimeter (see the isoperimeter property)
 All points in a plane the same distance from a given point (drawn with a compass, or a pencil on a string)
 The points (x,y) in the equation x2 + y2 = r2 (analytic version of the geometric definition above)
 The points in the equation r * sin(t), r * cos(t), for all t (really analytic version)
 The shape whose tangent line is always perpendicular to the position vector (physical interpretation)
The list goes on, but here’s the key: the facts all describe the same idea! It’s like saying 1, one, uno, eins, “the solution to 2x + 3 = 5″ or “the number
of noses on your face” — just different names for the idea of “unity”.

But these initial descriptions are important — they shape our intuition. Because we see circles in the real world before the classroom, we understand
their “roundness”. No matter what fancy equation we see (x 2 + y2 = r2), we know deep inside that a circle is “round”. If we graphed that equation and
it appeared square, or lopsided, we’d know there was a mistake.
As children, we learn the “caveman” definition of a circle (a really round thing), which gives us a comfortable intuition. We can see that every point
on our “round thing” is the same distance from the center. x 2 + y2 = r2 is the analytic way of expressing that fact, using the Pythagorean theorem for
distance. We started in one corner, with our intuition, and worked our way around to the formal definition.
Other ideas aren’t so lucky. Do we instinctively see the growth of e, or is it an abstract definition? Do we realize the rotation of i, or is it an artificial,
useless idea?
A Strategy For Developing Insight
I still have to remind myself about the deeper meaning of e and i — which seems as absurd as “remembering” that a circle is round or what a cat
looks like! It should be the natural insight we start with.

Missing the big picture drives me crazy: math is about ideas — formulas are just a way to express them. Once the central concept is clear, the
equations snap into place. Here’s a strategy that has helped me:
 Step 1: Find the central theme of a math concept. This can be difficult, but try starting with its history. Where was the idea first used?
What was the discoverer doing? This use may be different from our modern interpretation and application.
 Step 2: Explain a property/fact using the theme. Use the theme to make an analogy to the formal definition. If you’re lucky, you can
translate the math equation (x2 + y2 = r2) into a plain-english statement (“All points the same distance from the center”).
 Step 3: Explore related properties using the same theme. Once you have an analogy or interpretation that works, see if it applies to
other properties. Sometimes it will, sometimes it won’t (and you’ll need a new insight), but you’d be surprised what you can discover.
Let’s try it out.

A Real Example: Understanding e

Understanding the number e has been a major battle. e appears all of science, and has numerous definitions, yet rarely clicks in a natural way. Let’s
build some insight around this idea. The following section will have several equations, which are simply ways to describe ideas. Even if the equation
is gibberish, there’s a plain-english idea behind it.
Here’s a few popular definitions of e:
The first step is to find a theme. Looking at e’s history, it seems it has something to do with growth or interest rates. e was discovered when
performing business calculations (not abstract mathematical conjectures) so “interest” (growth) is a possible theme.
Let’s look at the first definition, in the upper left. The key jump, for me, was to realize how much this looked like the formula for compound interest.
In fact, it is the interest formula when you compound 100% interest for 1 unit of time, compounding as fast as possible.
 Definition 1: Define e as 100% compound growth at the smallest increment possible.
The article on e describes this interpretation.
Let’s look at the second definition: an infinite series of terms, getting smaller and smaller. What could this be?

After noodling this over using the theme of “interest” we see this definitions shows the components of compound interest. Now, insights don’t come
instantly — this insight might strike after brainstorming “What could 1 + 1 + 1/2 + 1/6 + …” represent when talking about growth?”
Well, the first term (1 = 1/0!, remembering that 0! is 1) is your principal, the original amount. The next term (1 = 1/1!) is the “direct” interest you
earned — 100% of 1. The next term (0.5 = 1/2!) is the amount of money your interest made (“2nd level interest”). The following term (.1666 = 1/3!)
is your “3rd-level interest” — how much money your interest’s interest earned!

Money earns money, which earns money, which earns money, and so on — the sequence separates out these contributions (read the article on e to see
how Mr. Blue, Mr. Green & Mr. Red grow independently). There’s much more to say, but that’s the “growth-focused” understanding of that idea.

 Definition 2: Define e by the contributions each piece of interest makes

 Neato.

Now to the 3rd, and shortest definition. What does it mean? Instead of thinking “derivative” (which turns your brain into equation-crunching mode),
think about what it means. The feeling of the equation. Make it your friend.

It’s the calculus way of saying “Your rate of growth is equal to your current amount”. Well, growing at your current amount would be a 100%
interest rate, right? And byalways growing it means you are always calculating interest — it’s another way of describing continuously compound
interest!
 Definition 3: Define e as a function that always grows at 100% of your current value
Nice — e is the number where you’re always growing by exactly your current amount (100%), not 1% or 200%.

Time for the last definition — it’s a tricky one. Here’s my interpretation: Instead of describing how much you grew, why not say how long it took?
If you’re at 1 and growing at 100%, it takes 1 unit of time to get from 1 to 2. But once you’re at 2, and growing 100%, it means you’re growing at 2
units per unit time! So it only takes 1/2 unit of time to go from 2 to 3. Going from 3 to 4 only takes 1/3 unit of time, and so on.

The time needed to grom from 1 to A is the time from 1 to 2, 2 to 3, 3 to 4… and so on, until you get to A. The first definition defines the natural
log (ln) as shorthand for this “time to grow” computation.
ln(a) is simply the time to grow from 1 to a. We then say that “e” is the number that takes exactly 1 unit of time to grow to. Said another way, e is is
the amount of growth after waiting exactly 1 unit of time!

 Definition 4: Define the time needed to grow continuously from 1 to a as ln(a). e is the amount of growth you have after 1 unit of time.
Whablamo! These are four different ways to describe the mysterious e. Once we have the core idea (“e is about 100% continuous growth”), the crazy
equations snap into place — it’s possible to translate calculus into English. Math is about ideas!

What’s the Moral?

In math class, we often start with the last, most complex idea. It’s no wonder we’re confused — we’re showing DNA and expecting students to see
the cat.
I’ve learned a few lessons from this approach, and it underlies how I understand and explain math:

 Search for insights and apply them. That first intuitive insight can help everything else snap into place. Start with a definition that makes
sense and “walk around the circle” to find others.
 Develop mental toughness. Banging your head against an idea is no fun. If it doesn’t click, come at it from different angles. There’s
another book, another article, another person who explains it in a way that makes sense to you.
 It’s ok to be visual. We think of math as rigid and analytic — but visual interpretations are ok! Do what develops your understanding.
Imaginary numbers were puzzling until their geometric interpretation came to light, decades after their initial discovery. Looking at
equations all day didn’t help mathematicians “get” what they were about.
Math becomes difficult and discouraging when we focus on definitions over understanding. Remember that the modern definition is the most
advanced step of thought, not necessarily the starting point. Don’t be afraid to approach a concept from a funny angle — figure out the plain-English
sentence behind the equation. Happy math.

Other Posts In This Series

1. How to Develop a Mindset for Math
2. Developing Your Intuition For Math (This post)
3. Brevity Is Beautiful
4. Learning To Learn: Embrace Analogies
5. Learning To Learn: Pencil, Then Ink
6. Intuition, Details and the Bow/Arrow Metaphor
7. Finding Unity in the Math Wars
8. Why Do We Learn Math?
22

Posted January 8, 2009 in Guides, Math -   Print This Post

Share what worked: Aha moments & FAQ
Let's create a living reference for how best to understand this topic.
 Technique: Start with the "caveman" definition and advance to the modern one.  (More...)  ❤ 11
   

Post feedback

84 thoughts on “Developing Your Intuition For Math”

1. Peter on January 8, 2009 at 2:47 pm said:

First of: I really, really like your posts.

I do explain e from the derivative point of view. We encounter it when we’re searching for a formula for derivating exponential functions.
We first investigate using a computer and numerical aproximation what the derivative of a^x is. We easily see that this is a^x times a given constant
(c_a). Different a’s yield different constants.
Using the right questions, we come to the point where pupils ask if there’s an a which constant is 1. Meaning de derivative of the function is the
function itself.
We first approximate it (trial and error). And then try to find a proper,formal definition (yielding the limit definition)

2. Kalid on January 8, 2009 at 10:14 pm said:

@Peter: Thanks for the comment!

I think the approach of starting with the rate of change works too. Pretty much any corner is good, though I’ve yet to see a nice, intuitive explanation
starting from the natural log definition and working its way around to e — it just seems too indirect a starting point.

The key is seeing that exponential functions are linked because they change proportional to their current amount. e is like the unit circle where the
radius is 1 — other functions are a scaled version of it.

Thanks for leading students through a path that helps build an understanding.

3. Prateek Sharma on January 8, 2009 at 11:33 pm said:

Hey Kalid,

Great article! Sometimes I think I should find out all my math teachers from Senior School & Engineering School and make them read your articles. I
wish you were one of my teachers! Though now you definitely are!

I really relish your posts and I think you are my first virtual math teacher!   … Will definitely like to meet you sometime!

Thanks. Keep up the good work.

4. jehan on January 9, 2009 at 6:17 am said:

I like that explanation of e, but the notion of developing an intuitive idea behind mathematical concepts isn’t new (perhaps it’s because I have a
different sense of intuition from most people).
The first thing that young children learn is counting from 1. They start at 1 instead of 0 because it’s considered more intuitive to think of something
that’s there rather than something that isn’t. After that, basic arithmetic is taught by the notion of incrementing until students get a ‘feel’ for how
much any given number of increments affects a particular number.
I could be wrong about that last part. I think it was that intuition that pushed me to studying math in college, and I definitely know people who never
developed that intuition!
But, even when we studied concepts such as derivation- we didn’t just write down the limit definition. We made calculations of slope for very small
steps.
 Idunno, just something to mull over…

5. Samson on January 9, 2009 at 7:54 am said:

I am a math major and this is right on the dot. There are so many facets of math that unless you do something like this to connect them all, you forget
most of it very quickly.

6. Kalid on January 9, 2009 at 6:54 pm said:

@Prateek: Thanks for the note! Heh, if your old teachers would enjoy it, feel free to send the articles along   . And sure, feel free to drop me an
email if you’re ever in the Seattle area.

@Jehan: Nope, the idea of using an intuitive approach isn’t new, but I wanted to spread the word. You’re lucky that you were able to start with
slopes and work to the limit definition — some people just have limits, epsilons and deltas just thrown at them without any context.

@Samson: Thanks! I agree, if you learn a subject as a set of disconnected facts it becomes easy to forget.

7. Kenny on January 10, 2009 at 8:40 pm said:

I am a second year math teacher and your post help me to better understand the purpose of mathematics and why I strive to teach this way.

8. Kalid on January 12, 2009 at 8:15 pm said:

@Kenny: Thanks for the comment!

9. nanotürkiye on January 15, 2009 at 1:49 pm said:

Thanks for article.

Actually this is not valid only in math, but in all other topics. As an example, we learn forecasting in our production planning course, if you study the
history of invention of the theorem, you can understand topic easier.

Cheers.

10. Kalid on January 16, 2009 at 12:54 pm said:

@nanotürkiye: Thanks for the comment! Yes, I very much agree — nearly any subject can be understood at a more intuitive level by looking at its
context.

11. misanthropope on January 17, 2009 at 2:07 am said:

determining whether a property of an object is “if and only if”, ie sufficient to define that object, is an important habit to build for a mathematician.
however, all of these terms have “canonical” definitions. For example, the set of all points equally distant from a common center was what the term
“circle” was invented to refer to.

“we know what a circle is, but how do we define it?” is actually kind of dishonest, viewed in this context. if you know what it is, that knowledge IS
the definition.

my two cents, anyway.

12. anon on January 17, 2009 at 9:35 am said:

Is there a “plain English” way to explain e^(i*pi) = -1? To me, this is the most mystifying formula. No amount of staring at De Moivre’s theorem, the
series expansion, etc seems to offer any real clarity.

– anon

13. matt on January 19, 2009 at 1:01 am said:

Its always good to see things being explained from a practical point of view; however, if you intend to study math, such a luxury is not always
available and so it may not be a good habit to get into.

Instead I believe what is just as instructive as studying an intuitive approach–in terms of insight gained–is showing that a number of definitions are
indeed equal by whatever tools are available to you–yes that means epsilon-delta proofs may be necessary. In fact, I would opt for rigorous
arguments over intuitive ones as often intuition can be just as damaging as it can be helpful in mathematics.

Instead of teaching intuition I think its much more productive to teach the logic behind the argument.

14. Kalid on January 19, 2009 at 1:47 am said:

@misanthropope: Interesting point, thanks for the comment. Yes, sometimes a given property can be described as the definition of an item. However,
sometimes the reason for picking that particular property can be obscured. In the circle example, I imagine it’s inventor focused on the
roundness/symmetry before noticing that all points were the same distance from the center. A better way to phrase “We know what a circle is, but
how do we define it” may be “We understand the concept that a circle conveys, but how is it described in math?”

@anon: I think that De Moivre’s/Euler’s identity can be understood intuitively — I’m planning on getting that one eventually   .

@matt: Thanks for the note. I think there’s a balance between intuition and rigor. Unfortunately, I think math education has skewed too far on the
rigor side (symbol manipulation) while losing the deeper meaning of the meaning of what the equations are trying to convey.

I think it is a cycle though — you use intuition to formulate ideas, rigor to refine and clarify them, intuition to formulate more detailed ideas, rigor to
refine those, and so on.

15. Nobody on January 19, 2009 at 1:58 pm said:

Great article. In the chemistry course that I’m taking, for example, no one can understand what is being taught because the teacher rarely explains
why certain things are true. The only reason why I’m doing well in the class is I take some time to understand what I’ve been told.

For example the order in which electron orbitals fill was simply given to us. I never memorized the order as if it was a new alphabet… I learned the
reason why it follows a certain order and produced that sequence to see that indeed I was taught correctly.

Finally, I agree that it is intuition that produces one’s love for a subject. I don’t like mathematics simply because I solve a bunch of problems for
homework. I enjoy the subject because I learn more of its secrets with each question that I answer.

16. Kalid on January 22, 2009 at 5:43 pm said:

@Nobody: Thanks for the comment. I totally agree — many subjects come together, and are even fun when understood at an intuitive level.

17. anonymous on February 1, 2009 at 5:47 pm said:

 Nice post! One problem is that as a math teacher, one’s instinct is to only say true things… which ironically can get you into real trouble with
exposition.

Case in point: me. I read your definition of a circle as the most symmetric 2D shape possible, and immediately started thinking, “but wait, a set of
concentric circles is just as symmetric. As is a point. And hey, the entire plane has even more symmetries.”

Then I realized, wow, I shouldn’t be a jerk. Pedantry like mine is exactly the problem you’re complaining about! Thanks for making me take a look
at myself.

18. Kalid on February 3, 2009 at 2:45 am said:

@anonymous: Thanks for the insightful comment! Yes, sometimes the nitty gritty is useful to focus on, but often it can be a hurdle to beginners.

In this context, word “shape” means something along the lines of “a smooth, unbroken convex curve in 2d” which should hopefully eliminate the
plane itself and a single point   .

Thanks for the comment.

19. J on March 9, 2009 at 7:31 am said:

Hi Kalid,

Thank you kindly for your clear and unobstructed definition of e and ln. Learning basic principles is often very frustrating for maths inept individuals
such as myself. I certainly benefit from a simple yet useful explication of what are, at first, abstract topics. Website such as yours have inspired and
enabled me to teach myself the very topics from which I once shyed away. Heck, I’m even finding derivatives of complex functions! haha

Thanks again, and please continue to add to your website.

20. Kalid on March 11, 2009 at 11:01 pm said:

@J: Thanks for the note! Glad you found it helpful and have moved onto doing crazy things like differentiating complex functions   . I’ll try to
keep the articles coming.

21. seyed amirreza mircheraghi on March 13, 2009 at 1:23 pm said:

hello.im from iran but im human an i have some idea in mathemtic symetry and i play with some formula but i cant now relate theme to a thing
please send for me some article about all basic in math please.because i want to study phyzics in the best university with all instrooment for this
situation that i want it i most improve very well me math because the mathematics is the base of physics.i read in the petroliom ingeneering in iran in
scine and research university but i dont like it im in the end of third year.i want read math in the best university and then study quantom physics in
the best univerrsity .here when we say an idea, they laugh.thanks alot and goodbye

22. chaos6174 on April 15, 2009 at 1:54 am said:

simple object,great idea!

23. Saman on April 22, 2009 at 2:03 pm said:

Great articles you have written. They help me a lot in my quest for understandning mathematics not just “doing it”. Keep up the good work!
24. Kalid on April 23, 2009 at 12:21 am said:

@Seyed: Glad to see you’re interested in education — the articles on the site are what I have now, but Wikipedia and other resources are good
jumping off points for more details and references, especially for an area like quantum physics. Good luck.

@Saman: Thanks! Really glad they were useful to you.

25. Frank Delano on April 28, 2009 at 9:06 pm said:

I sumbled upon your site not too long ago but the superb comments made about your posts forced me to read through your posts. You definitely
explain things really we’ll. Many people can understand things but cannot explain them well. You understand things very well and you also explain
those things very well!

26. Kalid on April 28, 2009 at 11:06 pm said:

@Frank: Thank you! I try to explain things as I wish they were taught to me when I was first learning. I’m happy you’re finding the site useful   .

27. BAReFOOt on October 16, 2009 at 12:18 am said:

Sorrym but there are some bad grammar errors in the text, which makes it hard to understand certain things, because first, you have to guess what
you could have meant. One example is »We then say that “e” is the number that takes exactly 1 unit of time to grow to.«. To what? The sentence
makes no sense.
There are many more such “bugs”. I think your article is pretty nice, but please proofread your texts before posting them. 

28. BAReFOOt on October 16, 2009 at 12:19 am said:

Sorry, but there are some bad grammar errors in the text, which makes it hard to understand certain things, because first, you have to guess what you
could have meant. One example is »We then say that “e” is the number that takes exactly 1 unit of time to grow to.«. To what? The sentence makes
no sense.
There are many more such “bugs”. I think your article is pretty nice, but please proofread your texts before posting them. 

29. BAReFOOt on October 16, 2009 at 12:20 am said:

See, that’s the difference between proofreading, and not proofreading. 

30. RF_Guy on October 17, 2009 at 10:13 am said:

Thank you very much for creating this site and for sharing your ideas. I find them very-very helpful. Being a Radio Designer I have to use
math/calculus to solve problems every day. Dry/rigorous approach never worked for me. I was “lucky” enough to go through university in very
competitive class and our teachers seemed to abuse the idea to explain as little as possible to “make you think” let alone trying to come up with
intuitive explanation. The only way to succeed was to come up with my own “theory”. But I have to admit that yours are way better. That’s why I
find your articles invaluable. And yes, e bothered me forever, but not anymore   .

31. Kalid on October 20, 2009 at 10:22 am said:

@RF_Guy: Thanks for the note and encouragement! I’m working through my notes & would love to make a calculus book one day. I’m going back
and revisiting concepts I thought I understood, and seeing more and more insights that I completely missed the first time around.

I really agree with you about the need for rigor — it has its place, but more important is to nurture an enthusiasm/enjoyment for the subject. I’ll
definitely keep contributing to the site!
32. Hank on December 16, 2009 at 11:40 am said:

I totally agree with your POV as a struggling math undergrad.

In particular, in the area of Analysis, pedagogy is lacking in the majority of texts.

33. hitendra on December 18, 2009 at 5:01 am said:

Hi kalid,

This is a bit long and you may find it amusing or funny but I wrote it straight as i was thinking; I hope you would pardon me and please pardon me!!!
If you recall I had posted a comment earlier mentioning that I go blank while trying to find relationships etc.

Same thing happened again with higher concepts, but one day I recalled that I was doing same thing long time ago while I was in primary school.

(Pardon me coz this may sound childish)

I had rote learned this particular formula :
(a+b)2=a2 + b2 + 2ab (a2 as in a square).

I thought about going to basic and start from top down.. i.e. from formula to history using my imagination.

First que: How does it help? if i know 3 square = 9 & 4 square equals 16.. will this help in getting to know 7 square?

Sec que: How did they arrive at it in first place?

all i could envision (gaphically) was two square boxes. one of length 3 & other of length 4.
Now I moved on to bigger box of length 7 & now I was thinking of relating it to formula & I divided it into two lengths of 3 & 4.

Within this bigger box i could draw area of 3 square & 4 square with there edges meeting at a point inside the 7 square box.

left over areas were two recangles, one had length 3 & breadth 4 while the other had opposite figures… so i could think of graphicall division in
terms of area in a plane.

But now I want some input regarding how am I doing and if my directin is correct at all I would to know how ancient engineers could have used
these equations to solve what kind of problem?
(BTW i don’t how to post my drawings here so i had to explain them sorry for inconvenience)

Thanks & Regards

hitendra

34. Kalid on December 19, 2009 at 2:16 am said:

@hitendra: Thanks for writing! Yes, I like visualizing the multiplication with the diagram — I think I know what you mean. You can take a square of
side 7 (3 + 4) and break it into a 3×3, a 4×4, and two 3×4 rectangles.

In terms of use, it’s a neat algebraic property… some people might think that (3+4)^2 = 3^2 + 4^2 but clearly that is not the case. So when solving
any problem with area, it’s important to know the correct result of that equation. In terms of everyday use, let’s see… if you are marking off a square
plot of land, it’s better to make one big square (7×7) instead of two smaller ones (3×3 and 4×4), so the king can collect more taxes   . Or, if
arranging soldiers in a field, and you see an army approaching (7×7) you know your two squadrons (4×4 and 3×3) will not be enough to fight them.
I’m stretching here, but algebra is general is pretty useful   .
35. hitendra on December 27, 2009 at 11:24 pm said:

Hi kalid,
I have arrived at a conclusion that your approach towards learning maths basically encompasses these areas:
1. Philosophy : Observing world as it is without any bias would help us to see shapes, changes in figures that do not naturally tally with our innate
logical conclusions or calculations.
2. Abstraction : Once a person identifies a real world problem scenario then he can break it down to simpler and easier to tackle diagrams or figures
( for e.g. straight lines instead of actual continuosly changing landscape).
3. Pattern Finding : This would require collecting abstracts from multiple problem scenarios and finding common link or relationship.
4. Language : Finding or labelling abstractions,patterns and relationship with proper word, and best possible phrases with example for consumption
by other people.. i can say communication.
5. Symbolizing & Reduction: Replacing general language statments with symbols as much as possible to reduce ambiguity (Formalism).
6. Rigor : working with Formal methods on huge chunk of data or repeating above steps to make sure proof is strong and is factually correct.

But considering vast requirement of educating childern worldwide, plus geo-political turnmoils that we face; Providing such proper math education
seems overwhelmingly mammoth task and extremely difficult to plan and execute.

However, If we find historical concepts difficult to grasp or imagine me thinks that we can start rightway with following generalized method:
Listing out problems that we face today like social, political, infrastructural (we can easily get correct data which is in abundance these days) and
applying above listed methods on them.. may be that would bring in faster cognition for 14+ age students (even for adults like me who have missed
out an opportunity).

What do you think about that?

Thanks and Regards

hitendra

36. Seamus on January 14, 2010 at 9:31 pm said:

DNA: ACATACATACATACATACATACAT lol

37. Kalid on January 15, 2010 at 4:36 pm said:

@Seamus: Glad you liked it   .

38. Anonymous on January 22, 2010 at 7:04 pm said:

I just encountered this site tonight, in search of a way to convince a friend that the magic number ‘e’ essentially always represents proportionality
when it appears in physical equations, due to the fact that powers of ‘e’ are their own derivatives. Mission accomplished in that regard, but what I
found interesting, and that I’d never thought of before (and I’m fifty-something), is the connection of the individual terms in the infinite series for ‘e’
to the integrated compound interest mechanism. Thanks!!

39. Kalid on January 26, 2010 at 12:58 pm said:

@Anonymous: Awesome, glad you enjoyed it! There are so many things I’m just figuring out after visiting them a second time.

40. Vera on February 26, 2010 at 4:21 pm said:

I am a Math teacher and I like this site dearly. Reading it is like talking to a friend whom you you’ve known for long time. Thanks!
41. Kalid on February 27, 2010 at 1:10 am said:

@Vera: Wow, thank you for the kind words! I’m really happy the site comes across like that, I want it to be a conversation and not a lecture   .

42. Frank on February 27, 2010 at 10:06 pm said:

Thank you for succintly listing out a method to go about intuitively thinking about and understanding math

I’m taking a math senior seminar and I have to present on the Euler-Lagrange equation and give a short intro. into the history, derivation, and basics
of calculus of variations…I am pretty lost still but your site (though it doesn’t deal with the topic) has helped me immensely in better understanding
fundamental math ideas and helped me find a way to focus the paper I have to write too.

I especially like how you mention looking into the history of an idea to find its central theme, and your example with e. Seriously, this takes away at
least a little of the anxiety I’m feeling about the paper and the presentation.

43. Kalid on March 14, 2010 at 1:58 pm said:

@Frank: Awesome, glad it’s coming in useful! I don’t know much about the Euler Lagrange equation but it sounds intriguing   .

Yes, it’s funny how some historical context can really help get our heads around why / how an equation developed.

44. Parag Shah on April 23, 2010 at 10:22 pm said:

Thanks for the excellent post Kalid.

45. Whit Ford on April 25, 2010 at 5:08 pm said:

Great job with this site! I am delighted to see more people taking an intuitive/conceptual approach to explaining core topics in math.

46. Kalid on April 26, 2010 at 8:23 pm said:

@Whit: Thanks! I just checked out your site too, it looks interesting!

47. Kalid on April 26, 2010 at 8:25 pm said:

@Parag: You’re more than welcome, glad you liked it.

48. Dave on November 23, 2010 at 5:05 am said:

Kalid: thank you, so much, for writing this article.

I’m a second year university student in, gasp, the liberal arts.

As you may infer from that statement, I’m not exactly good at mathematics.

Thing is, I want to be good at mathematics. I want to be able to see a proof and be able to understand it and tell that it’s beautiful, or whether it’s not
elegant and so on.
 I think the approach here will be useful in my attempt to self-educate myself in mathematics. First thing I’m looking at is Euclid’s Elements;
hopefully, attempting to use the approach that you have here will help me in my understanding. Once I’ve got Euclid, I’m moving into trigonometry
and calculus, and so deeper and deeper until I’m at least competent in number theory, which is where I’m interested.

Who knows, I might end up as a Fermat- he didn’t put a lot of focus into his mathematics study until he was around my age; who knows?

49. Kalid on November 23, 2010 at 11:59 pm said:

@Dave: Thanks for the comment! Glad it was helpful.

To be honest, I don’t think many people who are “good at math” really have a grasp of the beauty and elegance. It’s a bit like saying some who aces
spelling bees would be a good writer, since they have a great vocabulary. Maybe, maybe not. Real understanding comes from seeing a lot of the
subtle connections, not mechanical techniques.

I think your interest in finding insights and real understanding will really help you — re-learning math now, I’m finally starting to see connections I
completely missed in college and high school. You’re lucky that you’re able to start so early   .

50. Dave on November 25, 2010 at 9:22 am said:

I can suggest a challenge for intuitive mathematical explanations- if you can put this onto an intuitive basis, you are a math-teacher god.

Set theory. And the existence of infinite infinities.

Remember, all infinities are infinite, but some are more infinite than others. =D

Cheers!

51. Anonymous on November 28, 2010 at 4:37 am said:

@Dave

Set theory: the abstraction of the “is an element of” operation.

52. Colby on January 20, 2011 at 5:57 pm said:

I’ve been extraordinarily fortunate to have had two math teachers in my high school (I’m currently a senior in AP Calc BC) who teach exactly the
same way, since for high school students our ability to conceptualize hasn’t completely developed yet. I have to say, that I’ve never learned more in
my life on any subject in so few words and so little time. I think that your approach on intuition is the only way that anything (that mathematicians
think they completely understand) should be taught when introducing new/abstract topics.

One of my math teachers has a mantra that sums it up perfectly:

“My job,” he says, “is to make the new stuff look like the old stuff.”

Before he blows our minds with some new info that leaves jaws on the floor, he states his motto, and he follows up with “So let’s start with what we
already know/have defined…”

That’s teaching. Thank you for blowing my mind.

53. Kalid on January 28, 2011 at 10:28 pm said:

 @Colby: Wow, thank you for the comment! I completely agree with that mantra of “making the new stuff look like the old stuff”. You really need to
start with the previous ideas (since that’s how most new ideas get developed — variations / combinations of existing ideas) and work your way up. If
done correctly, the new ideas almost seem “obvious” or “inevitable” — which is great, because it means they make sense! Thanks again for the note.

54. marisha on September 12, 2011 at 5:21 pm said:

I am a woman and I love the way you explained e. But I am confused on the derivative definition. I understand that e represents the fastest continuous
100% growth (at the end of an interest period). The derivative definition appears to be an “snapshot” which says that my current amount is equal to
my growth rate (100%) at this instance in time. My problem is that I don’t know how one would arrive at “e” (the value at the end of an interest
period) from an instaneous snapshot of a single point in time. In other words, how did this define “e”? Could you help me understand or correct my
misperceptions?
Marisha

55. Kalid on September 13, 2011 at 6:23 pm said:

@Marisha: Great question. The tricky thing about the derivative definition is it describes properties of e without saying what number it is! It’s like
telling someone “The number I’m thinking of is 3 more than half its value”. Technically, you’ve described what number you’re thinking of (x = 3 +
x/2, so x = 6) but you didn’t make it easy!

The derivative definition (d/dx e^x = e^x) is saying “Your rate of change at any time x (d/dx e^x), is exactly equal to your current amount at time x
(e^x).” That is, your _instantaneous growth rate (per unit time)_ is 100% of your current amount. If you’re at 10, you expect to grow 10 in the next
unit of time (but as you hit 11, you expect to grow 11 in a unit of time… and as you hit 12, you expect to grow 12 in a unit of time…).

This isn’t much to work with — we need to find some exponential function that equals its own growth curve. Trial and error it is.

We can say “Hrm, maybe e is 2″ and see — does d/dx 2^x = 2^x? It doesn’t… d/dx 2^x, the rate of change, grows too slowly (see graph). d/dx 2^x is
only about 70% of 2^x, not equal.
Ok, how about 3^x? Whoops, that grows a smidgen too fast! d/dx 3^x is about 110% of 3^x (graph). But now we can try 2.5 (too slow), 2.7 (really
close, 99%)… 2.71 (even closer!)… until we get a guess for “e” is satisfyingly close to 100%. (By the way, e goes on forever without repeating, so
we don’t really know the exact value… we just have a really good guess).
There are other ways of calculating e, even formulas for it (that have an infinite number of steps, but the more steps you take the closer you get). The
derivative definition sort of forces you to use trial and error to guess what number e might be. Hope this helps!

56. sabindra on September 27, 2011 at 7:27 pm said:

i always thought how Euler ,Newton got their formula ………..is that their intuition or their hard work ……..they have solved such problem that we
can see only through modern days computers……..

57. Stephen on November 29, 2011 at 8:17 am said:

Hey Kalid,

Great website!! Just a quick question….with regard to your interesting explanation of e’s Taylor series, could you maybe explain to me the math as to
why the interest of the interest is 1/2! and the interest of the interest of the interest is 1/3! and so on and so forth? I see the principal value and the
direct interest in the series, but after that, I’m a little lost as to why those next terms are the mathematical expressions of the subsequent interests…..

Thanks so much!!

Sincerely,
Stephen
58. kalid on November 30, 2011 at 4:08 am said:

@Stephen: Great question. The reason is we’re constantly computing integrals to find the interest, interest that the interest earned, etc. Breaking it
down:

* Original value: 1 (this is our starting amount, and can be written 1/0! = 1)
* First-level interest: 1 (this is our basic 100% return, and can be written 1/1! = 1)
* Second-level interest: 1/2! (this is the interest on our 100% return, which is the integral of “x”: 1/2 * x^2 where x = 1)
* Third-level interest: 1/3! (interest on our second-level interest (1/2 x^2) is 1/3 * 1/2 x^3 = 1/6 x^3 = 1/6)

and so on. Basically, e^x can be seen as

1 + x + x^2/2! + x^3/3! + x^4/4! + ….

and each term is computing the interest on the term before it by taking its integral. We plug in x = 1 to get e^1 = e. Hope this helps! (I should write a
follow up on this, it’s a good point). Also, see the article on sine to see another example of this “interest on interest”
pattern: http://betterexplained.com/articles/intuitive-understanding-of-sine-waves/

59. Stephen on November 30, 2011 at 1:10 pm said:

Thanks, Kalid! Makes perfect sense…please keep up the great work

60. kalid on November 30, 2011 at 2:42 pm said:

@Stephen: Glad it helped! Thanks for the encouragement   .

61. Siddartha Guttamaaa on April 18, 2012 at 2:35 am said:

I LOVE THIS

62. kalid on April 18, 2012 at 2:15 pm said:

@Siddartha: Thanks   .

63. Dan on August 16, 2012 at 1:50 am said:

So we start in a corner of a circle? You’ve lost me already 

64. kalid on August 16, 2012 at 10:49 pm said:

@Dan: Hah! Pick your favorite “corner” 

65. Mehdi on October 4, 2012 at 11:49 am said:

Hi, I totally agree with you kalid. In school they just go straight to the hard complicated bit without mentioning why e.g. x is x and what happens
when there is 2 in front of it. Thank you for these posts and also can you please tell me how to do/find the discriminant, completing the square,
solving and sketching graphs. Thanks.

66. kalid on October 4, 2012 at 5:33 pm said:

Thanks Mehdi — appreciate the suggestions. I’ll put them on my list   .

67. Anonymous on January 6, 2013 at 9:57 am said:

i love you.

this has been the holiest moment of my life thank you!

68. Niyas.A on March 9, 2013 at 9:19 am said:

I am on the same train as you are.. i’m re-learning my math. Im soooo happy to see your success.. I think all the great math wizards, scientists etc.
some how stumbled upon the intuitive way and they forgot how the layman felt about them. And you could produce these things , only because you
have been taught the wrong way and are courageous enough to take the long and arduous path of re-learning.

thanks and lots of hugs my dear brother

69. ml on March 15, 2013 at 9:45 am said:

This is so sexy! Beautiful!

70. sampath kumar.p on July 27, 2013 at 1:26 am said:

hi ! ur explanations are amazing. any dull headed …. wil also understand very well. i have no fear of math now, after browsing better explained
website. hats off. pl carry on ur mission.

71. kalid on July 28, 2013 at 3:27 pm said:

Hi Sampath, glad you enjoyed it! Thanks for the warm words   .