(t17) ©Frans Lanting/Minden Pictures; (t18) ©Steve Gschmeissner/Photo Researchers, Inc.; (t19) ©Eye of Science/Photo Researchers, Inc.

; (inset) ©Ali Imam/Reuters/Corbis; (bg) mushrooms ©Szabolcs

Borbely/ShutterStock; lichen ©Sue Baugh; filaments, diatoms ©University of Wisconsin-Madison/SSEC

Unit 6

CHAPTER CHAPTER CHAPTER

a Virus
One on the Way?

Career  Epidemiologist
Technology  Dissecting
BioZine
HMDScience.com

Pandemics—Is the Next

17 The Tree of Life

19 Protists and Fungi

18 Viruses and Prokaryotes
and Diversity
Classification

483
 17 The Tree of Life
CHAPTER

17.1 The Linnaean System of

Classification
17.2 Classification Based on
Evolutionary Relationships
Data Analysis
transforming data

17.3 Molecular Clocks

17.4 Domains and Kingdoms

Online Biology
HMDScience.com

ONLINE Labs
■■ Creating a Dichotomous Key for Limpet Shells
■■ QuickLab  Construct a Cladogram

■■ Modeling DNA Hybridization

■■ Defining Species

■■ Constructing a Phylogenetic Tree

■■ Bioinformatics

■■ Video Lab  Dichotomous Keys

A ma T���’� z ing ! Premium Content

Video Inquiry
(t) ©Frans Lanting/Minden Pictures

Guitarfish  Australia is home to many

organisms that look like an evolutionary
mix-up. Can you figure out how to classify
the guitarfish?

484  Unit 6: Classification and Diversity

 Q How would you classify
this organism?
Pangolins, native to Africa and Asia, are not closely
related to any other living mammals. Their backs and
tails are covered with large scales similar in arrange-
ment to dinosaur bone plates. Pangolins do not have
teeth. Instead, they have an organ similar to a bird’s
gizzard. Due to these unique traits, pangolins are
classified into their own group within class Mammalia.

R E A D I N G T o o lb o x This reading tool can help you learn the material in the following pages.

USING LANGUAGE Your Turn

Mnemonics  Mnemonic devices are tools that help you Create mnemonic devices that could help you remember
remember lists or parts in their proper order. Use the first all of the parts of the following groups of items.
letter of every word that you want to remember as the 1. the names of all of your teachers
first letter of a new word in a memorable sentence. You 2. the 12 months of the year
may be more likely to remember the sentence if the
sentence is funny.

Chapter 17: The Tree of Life  485

 17.1 The Linnaean System of Classification
Key Concept  Organisms can be classified based
VOCABULARY
taxonomy
on physical similarities.
taxon Main Ideas
binomial nomenclature Linnaeus developed the scientific naming system still used today.
genus
Linnaeus’ classification system has seven levels.
The Linnaean classification system has limitations.

Connect to Your World 

  >  The pangolin shown on the previous page may not look like any other animal that
you are familiar with. However, scientists classify pangolins as mammals—the same
group of animals that includes dogs, cats, mice, and humans. All female mammals
have the ability to produce milk. Unlike pangolins, most mammals have hair. Scientists
use key characteristics such as these to classify all living things.

MAIN IDEA
Linnaeus developed the scientific naming system
still used today.
R E A DIN G T O O L B o x Before Swedish botanist Carolus Linnaeus introduced his scientific naming
system, naturalists named newly discovered organisms however they wanted.
Taking notes
In fact, they often named organisms after themselves. Because they had no
Use a main idea web to take
notes about the Linnaean
agreed-upon way to name living things, it was difficult for naturalists to talk
system of classification. about their findings with one another. This all changed in the 1750s, when
binomial Linnaeus devised a system that standardized the way organisms are classified
taxonomy
nomenclature and named.
Linnaeus’ naming system
Taxonomy
Taxonomy is the science of naming and classifying organisms. Taxonomy
gives scientists a standard way to refer to species and organize the diversity of
living things. Linnaean taxonomy classifies organisms based on their physical
and structural similarities. Organisms are placed into different levels in a
hierarchy—a multilevel scale in which each level is “nested” in the next-higher
level. In other words, each level is included in a larger, more general level,
R E A DIN G T O O L B o x which in turn is included in an even larger, more general level.
VOCABULARY A group of organisms in a classification system is called a taxon (plural,
Taxonomy comes from the taxa). The basic taxon in the Linnaean system is the species. In this system,
Greek taxis, which means species are most commonly defined as a group of organisms that can breed
“arrangement,” and nomie,
which means “method.”
and produce offspring that can reproduce. Linnaeus’ system gives each species
a scientific name. With few changes, this method of naming is still used today.

486  Unit 6: Classification and Diversity

 Scientific Names
Binomial nomenclature (by-noh-mee-uhl NOH-muhn-klay-chuhr) is a
system that gives each species a two-part scientific name using Latin words.
The first part of the name is the genus.
VISUAL VOCAB
A genus (plural, genera) includes one or
more physically similar species that are Binomial nomenclature is a
standard naming system that gives
thought to be closely related. For exam- each species a two-part name using
ple, the genus Quercus includes more Latin words.
than 500 species of oak trees. Genus
two name naming system
names are always capitalized. They are
written in italics or underlined. bi nomial nomen clature
The second part of the name is the (1) Genus (2) species
species descriptor. It can refer to a trait
of the species, the scientist who first
described it, or its native location. Like the genus, the species descriptor is
written in italics or underlined. However, it is always lowercase. The species
descriptor is never written alone because, as figure 1.1 shows, the same word
may be used in different genera. Quercus alba is the scientific name for
white oak trees (alba means “white”), but Tyto alba is the scientific name FIGURE 1.1  The white oak
for barn owls. (Quercus alba) and the barn owl
(Tyto alba) belong to different
You may wonder why biologists use scientific names. It may seem easier to genera. The species parts of their
use terms such as white oak instead of remembering two-part Latin names. scientific names are both alba,
However, scientific names are helpful in a number of ways. First, genera such meaning “white.”
as Quercus contain hundreds of species. Many of these species have very
similar common names. Scientific names allow scientists to talk about par-
ticular species without confusion. Also, remember that biology is studied all
over the world. One species may have many different common names. In fact,
a species may have several different common names within a single country.
Armidillidium vulgare is the scientific name for pill bugs. However, this
species is also called roly-poly, sow bug, and potato bug. Scientific names
allow scientists around the world to communicate clearly about living things.
Contrast  Describe the difference between a genus and a species.
(tr) ©Larry Michael/Nature Picture Library; (br) ©Digital Vision/Robert Harding

figure 1.2  scientific and common names

Scientific Name
Common names
Genus species
Roly-poly, pill bug, sow bug, potato bug Armadillidium vulgare

Dandelion, Irish daisy, lion’s tooth Taraxacum officinale

House sparrow, English sparrow Passer domesticus

Mountain lion, cougar, puma Puma concolor

Red maple, scarlet maple, swamp maple Acer rubrum

Chapter 17: The Tree of Life  487

 MAIN IDEA
Linnaeus’ classification system has seven levels.
CONNECT TO The Linnaean system of classification has seven levels, or taxa. From the most
Domains general to the most specific, these levels are kingdom, phylum (the term
The tree of life has been updated division is often used instead of phylum for plants and fungi), class, order,
since Linnaeus’ time. Scientists family, genus, and species. Each level in Linnaeus’ system is nested, or included,
now classify organisms into an in the level above it. A kingdom contains one or more phyla, a phylum contains
even broader category, called the
domain, above the kingdom level. one or more classes, and so forth. The classification of the gray wolf, Canis
You will learn more about domains lupis, is shown in Figure 1.3. Moving down, the levels represent taxa that become
and kingdoms in Section 4. more and more specific, until you reach the species level at the bottom.

FIGURE 1.3  The Linnaean Classification System

Linnaean taxonomy classifies living things into a hierarchy of groups called taxa.
The classification of the gray wolf is illustrated here.

KINGDOM: Animalia

PHYLUM: Chordata

CLASS: Mammalia

ORDER: Carnivora

FAMILY: Canidae

GENUS: Canis

SPECIES: Canis lupis

Analyze  Based on the taxonomy shown here, are bats or cats more closely related to gray wolves?

488  Unit 6: Classification and Diversity

 The top level represents all of the species in kingdom Animalia. As you
move down, the levels show examples of species from phylum Chordata, class
Mammalia, order Carnivora, family Canidae, genus Canis, and the species
Canis lupis. Each level is included in all of the more general levels above it.
Notice that gray wolves are in the same genus, Canis, as dogs and coyotes.
Because the Linnaean system is a nested hierarchy, wolves, dogs, and coyotes
also belong to the same family, order, class, phylum, and kingdom. Foxes do
not belong to the Canis genus, but they do belong to Canidae—the same
family as wolves, dogs, and coyotes. Therefore, foxes also belong to the same
order, class, phylum, and kingdom as wolves, dogs, and coyotes.
Apply  If two species belong to the same order, what other levels in the Linnaean FIGURE 1.4  This red panda
(Ailurus fulgens) is more
system must they have in common? closely related to raccoons
than to giant pandas.
MAIN IDEA
The Linnaean classification system has
limitations.
Linnaeus created his classification system before technology allowed us to CONNECT TO
study organisms at the molecular level. His system focuses on physical simi-
Classification
larities alone. Remember that physical similarities between two species are not
Refer to Appendix A for a
always a result of the species’ being closely related. Unrelated species can complete list of the kingdoms
evolve similar traits through convergent evolution. Linnaeus’ system does not and their phyla.
©Sohns, Juergen and Christine/Animals Animals - Earth Scenes

account for similarities that evolved this way. So today, scientists use genetic
research to help classify living things. Genetic similarities between two species
are more likely than physical similarities to be due to a common ancestor.
For example, the giant panda and the raccoon have similar ears and snouts.
Because of these similarities, they have been placed in the same family in the
Linnaean system. However, molecular biologists have found that the giant
panda is more closely related to members of the bear family than it is to
raccoons. Furthermore, the red panda, shown in Figure 1.4, is more closely
related to the raccoon than to the giant panda.
Infer  Why is the common name red panda misleading in terms of classification
based on relatedness?

Self-check Online
HMDScience.com
17.1 Formative Assessment Premium Content

Reviewing    Main Ideas Critical thinking CONNECT TO

1. What is binomial nomenclature? 4. Compare  How is a scientific name History of Science

2. Name each taxon in the Linnaean similar to an address that includes 6. During his voyages, Darwin
system of classification, from most city and state? collected thousands of organ-
general to most specific. 5. Apply  Which two species are more isms, which he classified using
closely related: Ursus maritimus, the Linnaean classification
3. What are some limitations of the
Ursus americanus, or Bufo ameri- system. How did this system
Linnaean classification system?
canus? Explain your answer help him share his findings
with other naturalists?

Chapter 17: The Tree of Life  489

 G On l i n e!

Sort It
Out
Web
BIOLOGY
Using a Key to Classify  Classify a Sea Cucumber Build a Cladogram  Find
Use a dichotomous key to out how crocodiles are
L earn about the evolutionary history
©Photoshot Holdings Ltd/Alamy

classify animals based on related to birds by building

of an animal that looks like a water
their descriptions. a cladogram.
balloon, and discover how it fits into
the tree of life.

490  Unit 6: Classification and Diversity

 Fitting

BIOLOGY
BIOZINE Biology
VIDEO C L I P
Molecular Clock  Find out Pandemics—Is the Next Taxonomy and
how scientists use mutation Classification  Learn about
rates to measure evolution-
One on the Way? the career of a taxonomist.
 atch the latest headlines about the
C
©Ali Imam/Reuters/Corbis

ary time.
diversity of life, including stories about
contagious diseases that can jump
between species.

online biology 491

HMDScience.com
 17.2 Classification Based on Evolutionary
Relationships
Key Concept  Modern classification is based on evolutionary
VOCABULARY
phylogeny
relationships.
cladistics Main Ideas
cladogram Cladistics is classification based on common ancestry.
derived character
Molecular evidence reveals species’ relatedness.

Connect to Your World 

  >  If you’ve ever observed bats in a zoo or in the night sky, you’ve likely noticed that
they have several features in common with birds, such as wings. However, bats are
actually more closely related to rodents and primates than they are to birds. Today,
scientists agree that species should be classified based on evolutionary relationships
rather than just physical similarities.

MAIN IDEA
Cladistics is classification based on
common ancestry.
Similar traits between species are often the result of sharing a common ances-
tor, such as the ancestor shared by dogs and wolves. However, scientists now
know that similar traits, such as the wings of bats and birds, can also evolve in
species that are adapting to similar environmental conditions. As you have
learned, this process is called convergent evolution.
To classify species according to how they are related, scientists must look at
more than just physical traits. Modern classification is based on figuring out
evolutionary relationships using evidence from living species, the fossil record,

(bl) ©The Natural History Museum; (br) ©Pontier, John/Animals Animals - Earth Scenes
and molecular data. The evolutionary history for a group of species is called a
phylogeny (fy-LAHJ-uh-nee).
Phylogenies can be shown as branching tree diagrams. In a way, these
diagrams are like family trees. The branches of a family tree show how family
members are related to each other. The branches of an evolutionary tree show
how different groups of species are related to each other.

figure 2.1  The glyptodon Glyptodon Armadillo

(Glyptotherium arizonae),
illustrated here, was the size of a
small car and lived more than
10,000 years ago. It is the common
ancestor to about 20 modern
armadillo species, including the
nine-banded armadillo (Dasypus
novemcinctus).

492  Unit 6: Classification and Diversity

Cladistics
The most common method used to make evolutionary trees is called cladis-
tics. Cladistics (kluh-DIHS-tihks) is classification based on common ancestry.
The goal of cladistics is to place species in the order in which they descended
from a common ancestor. A cladogram is an evolutionary tree that proposes
how species may be related to each other through common ancestors.
At the root of the words cladistics and cladogram is the word clade. A
clade is a group of species that shares a common ancestor. For example, the
glyptodon in Figure 2.1 is the common ancestor of about 20 modern species of
armadillos. Together, the glyptodon and all of its descendants form a clade.
Through the course of evolution, certain traits change in some species of a
clade but stay the same in other species. Therefore, each species in a clade has R E A DIN G T O O L B o x
some traits that have not changed from its ancestors, such as the similar shells
of glyptodons and modern armadillos. However, each species also has traits VOCABULARY
The word derived comes from
that have changed over evolutionary time.
the Latin de-, meaning “from,”
The traits that can be used to figure out evolutionary relationships among and rivus, meaning “stream.”
a group of species are those that are shared by some species but are not Therefore, derived refers to
something that has “flowed”
present in others. These traits are called derived characters. As you will soon from a source. The term
see, cladograms are made by figuring out which derived characters are shared derived characters refers to
by which species. The more closely related species are, the more derived characters that have evolved
in a species since sharing a
characters they will share. A group of species that shares no derived charac- common ancestor.
ters with the other groups being studied is called an outgroup.

Q U IC K LA B classifying
Construct a Cladogram
You can think of a cladogram as an evolutionary family tree in which things that are more closely related share
more characteristics. As an analogy, processes that have evolved due to new technologies can be organized
using cladistics. In this lab, you will fill in a cladogram for methods of transportation.
PROBLEM  How can methods of transportation be organized
using a cladogram? label label label label label
Procedure
wings
1. Copy the cladogram axes on the right into your notebook.
2. Think about the characteristics of the following methods of passengers
transportation: bicycle, car, motorcycle, airplane, and on foot. enclosed
3. Complete your cladogram by filling in each method of transpor- motor
tation listed in step 2 on the appropriate line at the top.
wheels
Analyze and Conclude
1. Identify  What “derived characters” are used in this cladogram?
2. Analyze  Which mode of transportation may be considered an
“outgroup”—a group that has none of the characteristics labeled
on the cladogram?
3. Connect  A species that has evolved a new trait is not better than a
species without that trait. Each species is just adapted to a certain
way of life. When might riding a bike have an advantage over flying
in an airplane?

Chapter 17: The Tree of Life  493

 Interpreting a Cladogram
The main features of a cladogram are shown in Figure 2.2. Tetrapods are
Biology vertebrates that have four limbs—amphibians, reptiles, birds, and mammals.
HMDScience.com
Some tetrapods, such as snakes and marine mammals, no longer have the four
Premium Content
limbs that their known ancestors had. However, they are still members of the
Build a Cladogram tetrapoda clade because they share a common ancestor.
Derived characters  In a cladogram, groups of species are placed in order by

A ma T���’� z ing ! the derived characters that have added up in their lineage over time. This
order is hypothesized to be the order in which they descended from their
Video Inquiry common ancestor. Derived characters are shown as hash marks between the
HMDScience.com branches of the cladogram. All species above a hash mark share the derived
Premium Content character it represents.
Guitarfish Nodes  Each place where a branch splits is called a node. There are five nodes
on the tetrapod cladogram. The first node is where the amphibian branch
splits off from the rest of the cladogram. Nodes represent the most recent
common ancestor shared by a clade. Therefore, the first node of the tetrapod
cladogram represents a common ancestor for the whole tetrapod clade.
Identifying clades  You can identify clades by using the “snip rule.” Whenever
you “snip” a branch under a node, a clade falls off. In this cladogram, if you
were to “snip” below the node where turtles and tortoises branch off, you
would be left with the reptilia clade. This clade includes turtles and tortoises,
lizards and snakes, crocodiles and alligators, and birds. As you can see,
each clade is nested within the clade that forms just before it. There are five
clades in the tetrapod cladogram. Crocodiles, alligators, and birds belong
to all five clades.

1 All of the organisms in this cladogram belong to the tetrapoda clade

(brown). They all share the derived character of four limbs.
CONNECT TO 2 An embryo protected by a fluid-filled sac is a derived character for all
Animals organisms in the amniota clade (blue). Because amphibians do not
The amniotic sac is a key produce an amniotic sac, the amphibian branch splits off from rest of the
characteristic of amniotes, branches before the mark that represents this trait.
animals that are fully adapted for
life on land. The amniotic sac 3 Organisms in the reptilia clade (yellow) have a common ancestor that
allows amniotes to reproduce on had four legs, produced protected eggs, and had a skull with openings
land; non-amniotes must return behind the eyes. The third node in the cladogram represents this com-
to the water to reproduce. You
will learn much more about mon ancestor. Because mammal skulls do not have these openings, they
amniotes in the chapter A Closer are not part of the reptilia clade.
Look at Amniotes. 4 Organisms in the diapsida clade (green) have openings in the side of the
skull. The skulls of turtles and tortoises do not have these openings, so
they are not part of the diapsida clade.
5 Lizards and snakes branch off of the cladogram next. Their skulls do not
have certain openings in the jaw that are found in crocodiles, alligators,
and birds. This is the derived character shared by all organisms in the
archosauria clade (pink). Feathers and toothless beaks separate croco-
diles and alligators from birds within the archosauria clade.
Contrast  What is the difference between a clade and a taxon?

494  Unit 6: Classification and Diversity

 FIGURE 2.2  Cladogram for Tetrapods
A cladogram presents hypothesized evolutionary
relationships among a group of species based on
common ancestry and derived characters. clade
A clade is a group of organisms that share certain traits
derived from a common ancestor. In this cladogram, a clade
looks like the letter V, including all the branches that extend
from the right end of the V. The diapsida clade includes liz-
ards and snakes, crocodiles and alligators, and birds.

1 Tetrapoda clade
2 Amniota clade

3 Reptilia clade
4 Diapsida clade

5 Archosauria clade
amphibians mammals turtles/tortoises lizards/snakes crocodiles/alligators birds

FEATHERS AND
TOOTHLESS
BEAKS

SKULL OPENINGS IN
FRONT OF THE EYE
AND IN THE JAW

OPENINGS IN THE SIDE OF

THE SKULL

SKULL OPENINGS BEHIND

THE EYE

EMBRYO PROTECTED BY
Node
AMNIOTIC FLUID
In a cladogram, a node is the intersection
of two branches. This node represents
the most recent common ancestor FOUR LIMBS WITH DIGITS
shared by the entire tetrapoda clade.
Derived character
Organisms that branch off after a hash mark share the
derived character represented by the hash mark. An
embryo protected by amniotic fluid is a derived character
shared by all organisms in the amniota clade. Amphibians
do not have this derived character.

CRITICAL Which groups of animals belong to the amniota clade? Which

VIEWING belong to the archosauria clade?

Chapter 17: The Tree of Life  495

 MAIN IDEA
Molecular evidence reveals species’ relatedness.
You have learned how physical characteristics, such as protected eggs, can be
figure 2.3  Based on structural used to build evolutionary trees. In this example, a protected egg is a derived
similarities, scientists previously
classified segmented worms and character shared by all species in the amniota clade. Today, new technology
arthropods as sister taxa. The dis- allows biologists to compare groups of species at the molecular level. Molecu-
covery of a hormone found only lar evidence, such as a certain DNA sequence, can be used as a derived charac-
in roundworms and arthropods
has led scientists to propose a ter if it is shared among certain groups of species.
new phylogeny for these taxa. In many cases, molecular data agree with classification based on physical
similarities. In other cases, this type of data leads scientists to classify species
BEFORE
in a different way. An evolutionary tree is always a work in progress. With new
flatworms
evidence, trees can be changed to show how species are likely related.
roundworms For example, based on physical traits, most biologists considered seg-
mented worms and arthropods (crabs, lobsters, insects, and their relatives) to
mollusks be more closely related to each other than to any other group of species.
segmented worms
However, the discovery of a certain hormone has provided new information.
This hormone affects molting, and it is found only in arthropods and round-
arthropods worms. Biologists have now proposed a new evolutionary tree, shown in
figure 2.3. In this tree, roundworms and arthropods are grouped closer to-
gether. This tree is based on the idea that the hormone evolved only once,
AFTER
in an ancestor shared by arthropods and roundworms.
flatworms
Proteins and genes are also used to help learn about evolutionary relation-
mollusks ships. In fact, DNA is considered by many scientists to have the “last word”
when figuring out how related two species are to each other. After all, any
segmented worms
traits that can get passed on to offspring must have a genetic basis. The more
roundworms similar to each other the genes of two species are, the more closely related the
species are likely to be. In the next section, you will see how DNA and protein
arthropods sequences can be used to measure evolutionary time itself.
Analyze  Why does DNA often have the “last word” when scientists are
constructing evolutionary relationships?

Self-check Online
HMDScience.com
17.2 Formative Assessment Premium Content

Reviewing    Main Ideas Critical thinking CONNECT TO

1. What is the goal of cladistics? 3. Compare and Contrast  Discuss Scientific Method
2. What role does molecular evidence some similarities and differences 5. Recall that a hypothesis is a
play in determining how closely two between the Linnaean system of possible explanation for a set
species are related to each other? classification and cladistics. of observations. Why are
4. Analyze  Describe the relationship cladograms considered
between clades and shared to be hypotheses?
derived characters.

496  Unit 6: Classification and Diversity

 D ATA A N A LY S I S
Transforming Data HMDScience.com
Premium Content

Create animated charts and

Researchers rarely publish raw data by itself. Instead, data are usually graphs using Smart Grapher.
analyzed in some way. This is because certain types of observations
and patterns can be made clearer when data are presented in different
ways. For example, data that show change or difference may be best
represented as percentage difference.

Model
Cytochrome C is a protein that functions in cellular respiration. A sequence of 104
amino acids make up the cytochrome C protein. Scientists have compared this
sequence of amino acids in humans with the sequence in a variety of other
species. The number of amino acid differences between cytochrome C in humans
and in other species has been used to help determine species’ relatedness.
Look at the data table at the right. Notice that the cytochrome C of
chimpanzees most closely resembles that of humans, while the cytochrome Lampreys such as this one are jawless
fish with a round sucking mouth.
C of lampreys, a type of jawless fish, has more differences. To more
clearly represent how different they are, these data can be Table 1. Amino Acid Differences
transformed into percentage differences. To calculate the percentage Compared with Human
cytochrome c
difference of cytochrome C between humans and lampreys, follow
this procedure. Organism Number of Differences
Chimpanzee 0
1. First, transform the number of amino acid differences into
a fraction of the total number of amino acids that make Rhesus monkey 1
up the cytochrome C protein (104). Whale 10
​ _______
20 differences
       ​
104 total amino acids
Turtle 15
Bullfrog 18
2. Next, perform the division.
Lamprey 20
20 4 104 5 0.1923
Tuna 21

3. Transform this number into a percentage by multiplying by 100. Source: M. Dayhoff, Atlas of Protein
Sequence and Structure
0.1923 3 100 5 19.23% difference

Practice  Transform Data

1. Calculate  Use the procedure outlined above to find percentage differences in cytochrome C between
©Gary Meszaros/Photo Researchers, Inc.

humans and the following animals: tunas, bullfrogs, turtles, whales, rhesus monkeys, and chimpanzees.

2. Apply  What do the transformed data suggest about how related each type of animal is to humans?

3. Infer  What percentage of the human cytochrome C protein is the same as that of whales?
Hint: 100 percent 2 percentage difference 5 percentage similarity.

Chapter 17: The Tree of Life  497

 17.3 Molecular Clocks
Key Concept Molecular clocks provide clues to
VOCABULARY
molecular clock
evolutionary history.
mitochondrial DNA Main Ideas
ribosomal RNA Molecular clocks use mutations to estimate evolutionary time.
Mitochondrial DNA and ribosomal RNA provide two types of molecular clocks.

Connect to Your World 

Have you ever played the game telephone? One person whispers a message to
another person, who repeats it to yet another person, and so on. By the time it
reaches the final person, the message has changed. In a similar way, DNA changes
slightly each time it is passed from generation to generation.

MAIN IDEA
Molecular clocks use mutations to estimate
evolutionary time.
In the early 1960s, biochemists Linus Pauling and Emile Zuckerkandl pro-
posed a new way to measure evolutionary time. They compared the amino
acid sequences of hemoglobin from a wide range of species. Their findings
show that the more distantly related two species are, the more amino acid
CONNECT TO differences there are in their hemoglobin. Using this data, they were able to
Human Biology calculate a mutation rate for part of the hemoglobin protein.
Hemoglobin is an oxygen-
carrying protein that is found in Molecular Evolution
the blood cells of all vertebrates, Molecular clocks are models that use mutation rates to measure evolutionary
including humans. You will learn time. Recall that mutations are nucleotide substitutions in DNA, some of
more about hemoglobin in
Respiratory and Circulatory which cause amino acid substitutions in proteins. Pauling and Zuckerkandl
Systems. found that mutations tend to add up at a constant rate for a group of related
species. As shown in Figure 3.1, the rate of mutations is the “ticking” that powers
a molecular clock. The more time that has passed since two species have
diverged from a common ancestor, the more mutations will have built
up in each lineage, and the more different the two species will be at the
molecular level.

Figure 3.1  Molecular Evolution

Mutations add up at a fairly Ten million years later— Another ten million years later—
constant rate in the DNA of species one mutation in each lineage one more mutation in each lineage
that evolved from a common ancestor.
G T A C G T A T T C G T A A G T A T T C

The DNA sequences from two The mutation rate of this

G A A C G T A T T C descendant species show muta- sequence equals one mutation
tions that have accumulated (black). per ten million years.
DNA sequence from a
hypothetical ancestor G A A C G T A T G C G A A C C T A T G C

498  Unit 6: Classification and Diversity

 Linking Molecular Data with Real Time
To estimate mutation rates, scientists must find links between molecular data
and real time. Often this link comes from the timing of a geologic event that Biology
HMDScience.com
is known to have separated the species they are studying. If scientists know
Premium Content
when the species began to diverge from a common ancestor, they can find the
Molecular Clock
mutation rate for the molecule they are studying. For example, scientists
know that marsupials of Australia and those of South America diverged about
200 million years ago, when these two continents split.
A link can also come from fossil evidence. Pauling and Zuckerkandl
compared their molecular data with the first appearance of each type of
organism in the fossil record. Using these dates, they confirmed that the
number of amino acid differences increases with the evolutionary time
between each group of species. The number of amino acid differences
between human hemoglobin and the hemoglobin of several other types
of organisms is shown in Figure 3.2. Human hemoglobin is most different
from species that diverged earliest in evolutionary time.
Infer  Why is the hemoglobin of humans more different from that of sharks than
that of birds?

Figure 3.2  linking molecular and fossil data

Animal species that evolved longer ago compared with humans have
more amino acid differences in the beta chain of their hemoglobin.

AMINO ACID Differences Appearance in Fossil

animal
Compared with humans Record (millions of years ago)
Mouse 16 70

Horse 18 70

Bird 35 270

Frog 62 350

Shark 79 450

Analyze  Which two animals in this table are least related to humans?

Frogs and humans have 62

MAIN IDEA differences in the beta
chain of hemoglobin.
Mitochondrial DNA and ribosomal RNA provide
two types of molecular clocks.
©Michael Durham/Minden Pictures

Different molecules have different mutation rates. For example, some

sequences of DNA accumulate mutations relatively quickly in a lineage, while
others have very low mutation rates. Depending on how closely two species
are related, scientists choose a molecule with an appropriate mutation rate to
use as a molecular clock.

Chapter 17: The Tree of Life  499

 Mitochondrial DNA
Figure 3.3 Inheritance of Mitochondrial DNA Mitochondrial DNA (mtDNA) is DNA found
grandparents only in mitochondria, the energy factories of
mitochondrial cells. The mutation rate of mtDNA is about ten
DNA
times faster than that of nuclear DNA, which
nuclear DNA
makes mtDNA a good molecular clock for
closely related species. Furthermore, as shown
parents Mitochondrial DNA is in figure 3.3, mtDNA is always inherited from
passed down only from
the mother of each gen- the mother because the mitochondria in a
eration, so it is not sub- sperm cell are lost after fertilization. This type
ject to recombination. of inheritance is different from that of nuclear
child DNA, which is a combination of DNA from
Nuclear DNA is inherited from both both parents. Scientists use the fact that
parents, making it more difficult to mtDNA is passed down unshuffled to trace
trace back through generations.
mutations back through many generations in a
single species. In fact, mutations in mtDNA
have been used to study the migration routes
of humans over the past 200,000 years.

Ribosomal RNA
R E A DIN G T O O L B o x Ribosomes, the organelles that manufacture proteins in cells, contain
ribosomal RNA (rRNA). Ribosomal RNA is useful for studying distantly
VOCABULARY related species, such as species that are in different kingdoms or phyla.
In this context, the word
When studying the relationships among species over longer time scales, it is
conservative means “resistant
to change.” Because ribosomes best to use a molecule that has a lower mutation rate. Ribosomal RNA has
play such a crucial role in cell conservative regions that accumulate mutations at a low rate relative to most
function, even small changes DNA. Over long periods of geologic time, mutations that do build up in the
can be very disruptive and
damaging to the cell. Therefore, rRNA of different lineages are relatively clear and can be compared. American
most mutations in rRNA do not microbiologist Carl Woese first used rRNA to establish that archaea diverged
accumulate within the genome. from the common ancestor they share with bacteria almost 4 billion years ago.
As you will learn in the next section, these findings supported a restructuring
of the tree of life at its highest level.
Summarize  Why is rRNA useful for studying more distantly related species?

Self-check Online
HMDScience.com
17.3 Formative Assessment Premium Content

Reviewing    Main Ideas Critical thinking CONNECT TO

1. How are molecular clocks used to 3. Explain  How do rates of mutation History of Life
measure evolutionary time? “power” molecular clocks? 5. The theory of endosymbio-
2. What are the benefits of 4. Apply  What molecular clock might sis explains how eukaryotic
mitochondrial DNA and be useful to examine the evolution- cells may have evolved from
ribosomal RNA as molecular clocks? ary relationship between several prokaryotic cells. According
phyla in the kingdom Plantae? Explain to this theory, explain why
your answer. mitochondria have their
own DNA, separate from
nuclear DNA.

500  Unit 6: Classification and Diversity

 17.4 Domains and Kingdoms
Key Concept The current tree of life has three domains.
VOCABULARY
Bacteria Main Ideas
Archaea Classification is always a work in progress.
Eukarya The three domains in the tree of life are Bacteria, Archaea, and Eukarya.

Connect to Your World 

  >  Have you ever swum in a pond? Every drop of pond water is teeming with single-
celled organisms. At one time, scientists classified these organisms as either plants or
animals. However, classification schemes change. Single-celled eukaryotes such as
these pond dwellers now have a kingdom of their own.

MAIN IDEA
Classification is always a work in progress.
The tree of life is a model that shows the most current understanding of how
living things are related. Some new discoveries confirm parts of the tree that
were once based on similarities in form alone. But as figure 4.1 shows, new
findings can also lead scientists to change how they classify certain organisms.
• The two-kingdom system was accepted by biologists until 1866, when
German biologist Ernst Haeckel proposed moving all single-celled organ-
CONNECT TO isms to the kingdom Protista.
Fungi • In 1938, American biologist Herbert Copeland argued that the prokaryotes
Fungi are heterotrophs that feed deserved their own kingdom, called Monera. Prokaryotes are single-celled
by absorbing dead organic organisms that do not have membrane-bound nuclei or organelles.
materials from the environment. • In 1959, American ecologist Robert Whittaker proposed that because of
This is one characteristic that
distinguishes fungi from plants, how they feed, fungi should be placed into their own kingdom apart from
which are autotrophs, or plants. The kingdom Fungi includes molds and mushrooms.
organisms that make their own • In 1977, rRNA research by Carl Woese revealed two genetically different
food. You will learn more about
fungi in Protists and Fungi.
groups of prokaryotes. His findings led scientists to split the kingdom
Monera into two kingdoms, called Bacteria and Archaea.

Figure 4.1  History of the kingdom system

1753  Two kingdoms 1866  Three kingdoms 1938  Four kingdoms 1959  Five kingdoms 1977  Six kingdoms
Plantae Plantae Plantae Plantae
Plantae
Animalia Animalia Animalia Animalia
Animalia Protista Protista Protista Protista

Monera Monera Archaea

Fungi Bacteria
Fungi

Chapter 17: The Tree of Life  501

 Woese’s discovery did more than split the kingdom Monera. The two
groups of prokaryotes that he studied have very different cell wall chemistry.
In terms of genes, these two groups are more different from each other than
animals are from plants, fungi, and protists. Based on these differences, Woese
proposed that all life be divided into three domains. These domains are above
the kingdom level.
Analyze  Why did Woese propose classifying bacteria and archaea into separate
domains, rather than just separate kingdoms?

MAIN IDEA
The three domains in the tree of life are Bacteria,
Archaea, and Eukarya.
Most biologists now accept Woese’s domain system. This system more clearly
shows the great diversity of prokaryotes in the tree of life by dividing them
into two domains. These domains are called Bacteria and Archaea. All eukary-
otes are placed into a third domain, called Eukarya.

R E A D ING T O O L B o x Bacteria
The domain Bacteria includes single-celled prokaryotes in the kingdom
TAKING NOTES
Bacteria. The domain Bacteria is one of the largest groups of organisms on
Use a three-column chart to
take notes about the three Earth. In fact, there are more bacteria in your mouth than there are people
domains and six kingdoms in the that have ever lived! Bacteria can be classified by many traits, such as their
modern classification of life. shape, their need for oxygen, and whether they cause disease.
Domain Kingdoms
Name
Characteristics
Included Archaea
Like bacteria, organisms in the domain
Archaea (ahr-KEE-uh) are single-celled
prokaryotes. However, the cell walls of
archaea and bacteria are chemically differ-
ent. Archaea, like those in figure 4.2, are
known for their ability to live in extreme
environments, such as deep sea vents,
hot geysers, Antarctic waters, and salt
lakes. All archaea are classified in the
kingdom Archaea.

Eukarya
The domain Eukarya (yoo-kar-ee-uh) is FIGURE 4.2  This archaean
made up of all organisms with eukaryotic species, Pyrococcus furiosus, can
cells. Eukaryotic cells have a distinct be found in undersea hot vents and
©Eye of Science/Photo Researchers, Inc.

in the sand surrounding sulfurous

HMDScience.com nucleus and membrane-bound organelles. volcanoes. These organisms live
Premium Content
Eukarya may be single-celled, such as most without oxygen and can grow in
protists. They can also be colonial, such as temperatures higher than the
Using a Key to Classify boiling point of water.  (colored SEM;
some algae, or multicellular, like you. The
magnification 6500)
domain Eukarya includes the kingdoms
Protista, Plantae, Fungi, and Animalia.

502  Unit 6: Classification and Diversity

FIGURE 4.3 Tree of Life
The most recent classification system divides life into
three domains, which include six kingdoms. Kingdom:
Domain: Bacteria Domain: Archaea Domain: Eukarya Plantae
Kingdom:
Kingdom: Protista Fungi
Kingdom: Archaea
Kingdom:
Kingdom: Bacteria Animalia

Web
HMDScience.com
Premium Content

Classify a Sea Cucumber

Scientists constructed this evolutionary tree by comparing rRNA

CONNECT TO
sequences from species in each of the six recognized kingdoms. Kingdoms and Phyla
The distances between branches are proportional to the number
See Appendix A for a detailed
of differences in rRNA sequences among these species.
description of each kingdom and
Source: C. Woese, PNAS 97:15. its phyla.

Classifying Bacteria and Archaea

Some scientists think that bacteria and archaea have no true species. This is
because many of these organisms transfer genes among themselves outside of
typical reproduction. This sharing of genes blurs the lines between “species” as
we define them in the Linnaean system. One study found that almost a quarter
of the genes in the bacterium Thermotoga maritima are similar to archaean
genes. Our understanding of how to classify prokaryotes is just beginning.
Analyze  Why are protists, plants, fungi, and animals classified into the same
domain but into different kingdoms?

Self-check Online
HMDScience.com
17.4 Formative Assessment Premium Content

Reviewing    Main Ideas Critical thinking CONNECT TO

1. Why is the classification of life 3. Apply  If you come across an unusual History of Life
considered a work in progress? single-celled organism, what parts of 5. The Archaea lineage may
2. What kingdoms are included in each the cell would you study in order to include the first life on Earth,
of the three domains in the modern classify it into one of the three which began under much
tree of life? domains? different environmental
4. Analyze  Explain, using the traditional conditions from those
definition of species, why it is present today. What charac-
difficult to classify some bacteria and teristics of archaea help to
archaea at the species level. support this statement?

Chapter 17: The Tree of Life  503

 Interactive Review

17
HMDScience.com

Summary
CHAPTER

Premium Content

Review Games • Concept Map • Section Self‑Checks

Key Concepts
17.1 The Linnaean System of Classification 17.3 Molecular Clocks
Organisms can be classified GENUS: Canis Molecular clocks provide clues to evolutionary
based on physical similarities. SPECIES: Canis lupis history. Mutations tend to accumulate at a constant
The Linnaean system of clas- rate for a group of related species. The longer that
sification groups organisms two species are separated after diverging from a
based on shared physical or common ancestor, the more different the two
structural characteristics. This species will be at the molecular level. Biologists use
system is a nested hierarchy Common name: molecular clocks by linking molecular data to real
with seven taxa, or levels. The gray wolf time. They can then measure the rate of evolution
most specific level in this sys- for these species. Ribosomal RNA and mitochondrial
tem is a species. Species are named according to DNA provide two types of molecular clocks, used to
binomial nomenclature, which gives each species a measure evolution at different time scales.
two-part scientific name using Latin words.
17.4 Domains and Kingdoms
17.2 Classification Based on Evolutionary The current tree of life has three domains. The
Relationships domains are based on fundamental differences at the
Modern classification is based on evolutionary cellular level. Within these domains are a total of six
relationships. Cladistics is a common method used kingdoms. The Bacteria and Archaea domains include
to group species based on the order in which they all organisms in the Bacteria and Archaea kingdoms,
diverged from a common ancestor. These evolution- respectively. Bacteria and archaea are unicellular
ary relationships can be presented in a branching dia- prokaryotes, but the genetic and cellular differences
gram called a cladogram. Cladograms are constructed between these groups are greater than the differ-
by identifying which derived characters are shared ences between any other two kingdoms. The domain
by which species in the group being analyzed. Eukarya includes all organisms with eukaryotic cells—
kingdoms Protista, Fungi, Plantae, and Animalia.
Tree of life
Bacteria Archaea Eukarya

(bl) ©The Natural History Museum; (bc) ©Pontier, John/Animals Animals - Earth Scenes
Glyptodon Armadillo

RE ADING Toolbox Synthesize Your Notes

Main Idea Web  Use a main idea web to take notes Concept Map  Summarize what you know about taxon-
about cladograms. omy using a concept map.

phylogeny derived character scientific

names

cladogram
use include are important because

clade node

504  Unit 6: Classification and Diversity

 17 Review
CHAPTER

Chapter vocabulary

17.1 taxonomy 17.2 phylogeny 17.4 Bacteria

taxon cladistics Archaea
binomial nomenclature cladogram Eukarya
genus derived character
17.3 molecular clock
mitochondrial DNA
ribosomal RNA

Reviewing Vocabulary Reviewing  MAIN IDEAS

Vocabulary Connections 8. The scientific name for humans is Homo sapiens. What
For each group of words below, write a sentence or two genus do humans belong to?
to clearly explain how the terms are connected. For
9. Why is it important for biologists to include scientific
example, for the terms taxonomy and taxon, you could
names when reporting their research to other biologists
write “In Linnaean taxonomy, each level of classification
around the world?
is called a taxon.”
1. binomial nomenclature, genus, species 10. Name the seven levels of organization in Linnaean
taxonomy, from the most general to the most specific.
2. Bacteria, Archaea, Eukarya
3. molecular clock, mitochondrial DNA, ribosomal RNA 11. Current technology allows scientists to examine organ-
isms at the molecular level. How has this technology
exposed limitations in Linnaean taxonomy?
Write Your Own Questions
Think about the relationship between each pair of 1 2. What basic idea does cladistics use to classify groups
terms below. Then write a question about the first term of organisms?
that uses the second term as the answer. For the pair
taxonomy, taxon, the question could be “In Linnaean 13. Two species with similar adaptations are found to
taxonomy, what is each level of classification called?” have key differences at the molecular level. Scientists
Answer: taxon conclude that these species are not as closely related
as previously thought. Why should the molecular
4. phylogeny, cladistics evidence outweigh physical similarities that the
5. cladogram, derived characters species share?

1 4. A particular DNA sequence accumulated three muta-

RE ADING TOOLBOX Greek and Latin tions over 10,000 years. After how much time would you
Word Origins
expect this sequence to have accumulated six more
6. Klados is Greek for “branch,” and -gram is a suffix mutations? Explain.
meaning “something written or drawn.” Explain how
this meaning relates to cladogram. 1 5. Mutations accumulate more slowly in ribosomal RNA
than in mitochondrial DNA. Which of these molecules
7. The prefix archaeo- comes from the Greek word would provide a better molecular clock for studying the
arkhaio, which means “ancient” or “primitive.” Explain evolution of species from different kingdoms?
how this meaning relates to Archaea.
1 6. The original Linnaean system of classification had two
kingdoms. Biologists now use six kingdoms. What does
this change suggest about the nature of classification?

17. What distinguishes the three domains in the tree of life

from one another?

Chapter 17: The Tree of Life  505

 Critical Thinking
18. Apply  Are species in the same family more or less Analyzing Data  Transform Data
closely related than species in the same class? Explain The family Ursidae contains all bear species. The data
your answer. below show the number of species in each of the five
19. Synthesize  Scientists have used mtDNA as a molecular genera of this family. Use this data to answer the next
clock to trace human evolution and early migration three questions.
routes. Explain why mtDNA would be more useful in this
research than rRNA. genera of the family ursidae
Genus Names Number of Species
20. Apply  Refer to the cladogram in Figure 2.2 of Section
2. Are crocodiles and alligators more closely related to Ailuropoda 1
snakes or to birds? Explain your answer using the terms
common ancestor and derived characters. Helarctos 1

21. Compare and Contrast  What types of evidence are Melursus 1

used for classifying organisms in the Linnaean classifica- 1
Tremarctos
tion system? What types of evidence are used for
classifying organisms based on evolutionary relation- Ursus 4
ships?
Source: University of Michigan Museum of Zoology
22. Evaluate  What is the significance of grouping the six
kingdoms into three domains? How does the domain 26. Analyze  How many species belong to family Ursidae?
model more clearly represent the diversity of prokary-
otes than a system with the six kingdoms as its broadest 27. Transform Data  Transform the number of species in
divisions? each genus to a percent of the total number of bear
species in family Ursidae.
Interpreting Visuals
28. Analyze  What do the transformed data show that raw
Use the cladogram, which classifies species A, B, C, and
data do not show?
D, to answer the next three questions.

A B C D
Making Connections
4 29. Write a Letter  Imagine that you are a modern‑day
molecular biologist. Write a letter to Linnaeus explaining
3 how advances in technology have affected the way that
scientists classify living organisms. Describe the parts of
2 his classification system that are still used in the same
way today. Also describe the aspects of his system that
1 have changed over the years.

30. Compare and Contrast  The pangolin on the chapter

opener shares many physical traits, such as a long snout,
23. Apply  What represents the derived characters that with anteaters and aardvarks. However, these traits are
were used to construct this cladogram? known to have evolved separately in each of these
groups of species. Write a paragraph that compares how
24. Analyze  Where are the nodes in this cladogram, and Linnaeus and a modern taxonomist would likely classify
what do they represent? pangolins. Include in your paragraph the kinds of
additional information that a modern taxonomist might
25. Analyze  How many clades are represented in this
look for in order to classify the pangolin.
cladogram?

506  Unit 6: Classification and Diversity

 ❯ Standards-Based Assessment
TEST PREP & REMEDIATION
By Teacher Assignment
PREMIUM CONTENT

1. In the past 150 years, the classification of 4. Mammals are multicellular organisms with
life has changed through the addition and about 3 billion base pairs in their genome.
restructuring of kingdoms and domains. Yeasts are single-celled organisms with about
This system is always changing because 13 million base pairs in their genome. Both of
A scientific study keeps producing more data. these groups are classified as eukaryotes
because they
B evolution keeps producing unique organisms.
A have over one million base pairs.
C extinctions change evolutionary relationships.
B can reproduce sexually.
D humans increase the rate of speciation.
C utilize aerobic respiration.
2. Birds and snakes share a common ancestor D have a similar basic cellular structure.
from over 250 million years ago, but now they
show many physical differences. These THINK THROUGH THE QUESTION
differences are most directly the result of Do not get confused by extra information
A coevolution between species. provided in this question. Focus on the definition
of eukaryotes. The number of base pairs is not
B molecular clocks ticking at different rates. relevant to this question.
C the long-term accumulation of mutations.
D differences in the alleles of the ancestor. 5. Scientists notice very few differences in the
DNA sequences of individual cheetahs. This
3.
indicates that modern cheetahs likely
descended from only a few individuals
because
A smaller populations have less genetic variation.
B genetically different individuals are less fit.
C the mutation rate depends on population size.
D mutations do not affect small populations.

Scientists isolate this organism from marsh 6.

water. Based on this illustration, the organism
ginger atgcgccgatccttacgtcgaatcggaac
would most likely be classified as a
corn acgcaccgatacttacgtcgattcgggac
A protist.
orchid acgcgccgatacttacgtcgaatcgggac
B bacterium.
lily acgcgccgatacttccgtcgaatctggac
C plant.
D fungus. The DNA sequences above show a conserved
gene among four related plants. The
highlighted differences are most directly the
result of
A crossing over.
B adaptation.
C mutation.
D meiosis.

Chapter 17: The Tree of Life 507

Untitled-228 507 5/11/2011 10:16:44 AM