12

NAME:__________________________________________
GRADE/SECTION:______________________________

General Biology 2
Semester II – Week 1
Central Dogma and Genetic
Engineering

CONTEXTUALIZED LEARNING ACTIVITY SHEETS

SCHOOLS DIVISION OF PUERTO PRINCESA CITY
General Biology 2– Grade 12
Contextualized Learning Activity Sheets (CLAS)
Semester II - Week 1: Central Dogma and Genetic Engineering
First Edition, 2020
Republic Act 8293, Section 176 states that: No copyright shall subsist in any work
of the Government of the Philippines. However, prior approval of the government agency or
office wherein the work is created shall be necessary for the exploitation of such work for a
profit. Such agency or office may, among other things, impose as a condition the payment
of royalties.

Borrowed materials (i.e., songs, stories, poems, pictures, photos, brand names,
trademarks, etc.) included in this CLAS are owned by their respective copyright holders.
Every effort has been exerted to locate and seek permission to use these materials from
their respective copyright owners. The publisher and authors do not represent nor claim
ownership over them.

Published by the Schools Division of Puerto Princesa City

Development Team of the Contextualized Learning Activity Sheets

Writer: Brandon C. Manglapus

Content Editor: Brandon C. Manglapus

Language Editor: Antonieta C. Miguel

Proofreader: Antonieta C. Miguel

Reviewer:Rolando A. Taha Ed.D,EPS-Science

Illustrator: Brandon C. Manglapus

Layout Artist: Angela Mae G. Tacan

Management Team:
Servillano A. Arzaga, CESO V, SDS
Loida P. Adornado, PhD. ASDS
Cyril C. Serador, PhD. CID Chief
Ronald S. Brillantes, EPS-LRMS Manager
Rolando S. Taha,EdD. EPS-Science
Eva Joyce C. Presto, PDO II
Rhea Ann A. Navilla, Librarian II

Division LR Evaluators: Ronald S. Brillantes, Liezl O. Arosio, Carissa M. Calalin

Division of Puerto Princesa City-Learning Resource Management Section (LRMS)

Sta. Monica Heights, Brgy. Sta. Monica, Puerto Princesa City
Telephone No.: (048) 434 9438
Email Address: [email protected]
 Lesson 1
Central Dogma and Genetic Engineering
MELC: Outline the process involved in genetic engineering. STEM_BIO11/12-IIIa-b-6
Discuss the applications of recombinant DNA. STEM_BIO11/12-IIIa-b-7
Objectives: 1. Describe DNA replication and protein synthesis.
2. Explain the processes involved in genetic engineering.
3. Describe some applications of recombinant DNA.
4. Articulate some of the benefits and risks of using genetically modified
organisms.

Let’s Try
Directions: Read the questions carefully and circle the letter of the best answer.

1. Complementary base pairing in DNA assures that only one of the following base
pairs exists in DNA. Which of the following is the correct base pair?
A. Adenine-Adenine B. Thymine-Adenine
C. Thymine-Guanine D. Cytosine-Thymine

2. What is the molecular unit of heredity of all organisms and they are often called the
blueprint for life?
A. Cell B. Genes C. Allele D. DNA

3. RNA is different from DNA because _________________.

A. RNA is single-stranded B. RNA has Uracil
C. RNA has the sugar ribose D. All of these

4. Which of the following technique would most likely be used by forensic scientists?
A. Cloning B. Gene therapy C. karyotyping D. DNA fingerprinting

5. DNA is a polynucleotide molecule consisting of the following nucleotides:

A. Adenine, thymine, uracil, guanine,
B. Adenine, thymine, cytosine, guanine
C. Cytosine, thymidine, adenine, guanosine
D. Cytosine, alanine, thymine, glycerin

6. If a strand of DNA molecule has the sequence GTCCAC, what would be the
complementary section of DNA?
A. GACCTC B. GTCCAC C. CTGGAG D. CAGGTG

7. During replication, the enzyme that breaks the hydrogen bonds holding the base
pairs together as it unwinds and unzips the double helix.
A. DNA B. RNA C. DNA Helicase D. RNA Helicase

1
 8. Which is a negative result of the use of genetic engineering in agriculture?
A. Increased crop yields B. Reduction in pesticide use
C. Unknown side effects D. Higher nutritional values

9. Which best describes the technique of genetic engineering?

A. Adding foreign DNA to organisms to modify the organism’s DNA.
B. Manufacturing synthetic DNA in the laboratory from chemicals
C. Cutting segments of DNA of an organism under a microscope.
D. Exposing DNA of an organism to radioactivity for mutations.

10. The process of making changes in the DNA code of living organisms is called _____?
A. Selective breeding C. Inbreeding
B. Genetic engineering D. Hybridization

Let’s Explore and Discover

How Gene Works?

“What makes you unique?”
Genes are the molecular unit of heredity of all
organisms. They are often called the blueprint for
life because they tell each of your cells what to do
and when to do it. How do genes orchestrate all of
these?
Scientists estimate that humans have about
25,000 different genes. For example, some genes
control eye color, genes that make proteins to
break down food in the stomach, and genes that Figure 1- The arrangement of DNA in the nucleus
encode enzymes that regulate how cells grow.
The cells of the human body contain 23 pairs of
chromosomes. These chromosomes are made up of a chemical
substance known as DNA.

The DNA
Deoxyribonucleic acid or DNA is a genetic material
stored in the nucleus. The nucleus is a part of the eukaryotic
cell and contains nucleic acids and it is responsible for protein
production. Small segments of DNA are called genes. Each
gene holds the instructions for how to produce a single
protein. DNA is a double-helix and has two strands running
in opposite directions. It is made up of building blocks called
nucleotides, which consists of three parts:
(1) A deoxyribose sugar, Figure 2-The DNA Structure
(2) A phosphate group, and
(3) A nitrogenous base

2
 The nitrogenous bases are grouped into two: the two-ringed
purines (Adenine-A and Guanine-G) and the single-ringed
pyrimidines (Cytosine-C and Thymine-T). In the double-stranded
DNA, the two strands run in opposite directions and the bases pair
up such that A always pairs with T and G pairs with C. The A-T
base-pair has 2 hydrogen bonds and the G-C base-pair has 3
hydrogen bonds.

The RNA
The ribonucleic acid or RNA is single-stranded and does not
have thymine. Instead, it has adenine pairs with uracil. It is named
after the five-carbon sugar group that makes up its backbone-
ribose.RNA may also be found in the nucleus and cytoplasm of the
cell. The three kinds of RNA are the messenger RNA (mRNA), Figure 3-The RNA Structure
ribosomal RNA (rRNA), and transfer RNA (tRNA).
In the single-stranded RNA, the bases pair up such that A always
pairs with U and G pairs with C.

Figure 4- Differences between DNA and RNA

THE CENTRAL DOGMA OF MOLECULAR GENETICS

Gene is a portion of the DNA. In genetics language, the material found inside the
nucleus which makes up an organism’s complete set of genes called genotype must be
expressed as an observable characteristic or phenotype. The flow of genetic information is
from DNA to messenger RNA(mRNA) to protein. This series of processes of protein
production is called protein synthesis.

The Replication Process

Replication is a process by which a copy
of the original genetic information is duplicated so
that each new cell receives the same information
as that of the parent cell. The following steps
describe the replication of DNA in both eukaryotic
and prokaryotic cells.
1. The enzyme helicase starts to unzip the
double helix as the nucleotide base pairs Figure 5-DNA Replication
separate. Each side of the double helix runs in
opposite directions. At the same time, replication begins on both strands of the
molecules.
2. Free nucleotides pair with the base exposed as the template strand continuously
unzip. An enzyme complex-DNA Polymerase attaches the nucleotide to form a new
strand similar to each template.
3. A sub-unit of the DNA polymerase proofreads the new DNA and the DNA ligase
(enzyme) seals up the fragments into one long strand.

3
 4. Two similar double-stranded molecules of DNA result from replication. The new
copies automatically wind up again.DNA replication is semi-conservative because
one old strand is conserved and used and a new strand is made.
Transcription Process
This process rewrites the genetic code in DNA into
a messenger RNA (mRNA). Transcription takes place in
three steps: initiation, elongation, and termination.
Step 1: Initiation
It is the beginning of transcription. It occurs when
the enzyme RNA polymerase binds to a region of a gene
called the promoter. This signals the DNA to unwind so the
enzyme can ‘‘read’’ the bases in one of the DNA strands.
The enzyme is now ready to make a strand of mRNA with a
complementary sequence of bases.
Step 2: Elongation
It is the addition of nucleotides to the mRNA strand.
RNA polymerase reads the unwound DNA strand and
builds the mRNA molecule, using complementary
Figure 6-DNA Transcription process
base pairs. There is a brief time during this process
when the newly formed RNA is bound to the unwound DNA. During this process, an adenine
(A) in the DNA binds to uracil (U) in the RNA.
Step 3: Termination
Termination is the ending of
transcription and occurs when RNA
polymerase crosses a stop (termination)
sequence in the gene. The mRNA strand is
complete, and it detaches from DNA.

Translation Process
It is the process that takes the information
passed from DNA as messenger RNA and turns
it into a series of amino acids bound together
with peptide bonds. It is essentially a translation Figure 7-DNA Translation process
from one code (nucleotide sequence) to another
code (amino acid sequence). The ribosome is the
site of this action, just as RNA polymerase was the
site of mRNA synthesis. The ribosome matches the
base sequence on the mRNA in sets of three bases
(called codons) to tRNA molecules that have the
three complementary bases in their anticodon
regions. Again, the base-pairing rule is important
in this recognition (A binds to U and C binds to G).
The ribosome moves along the mRNA, matching 3
base pairs at a time and adding the amino acids
to the polypeptide chain. When the ribosome
reaches one of the "stop" codes, the ribosome
releases both the polypeptide and the mRNA. This
polypeptide will twist into its native conformation and Figure 8-The Genetic Code
begin to act as a protein in the cell's metabolism.

4
 The steps in the translation are:
1. The ribosome binds to mRNA at a specific area.
2. The ribosome starts matching tRNA anticodon sequences to the mRNA codon sequence.
3. Each time a new tRNA comes into the ribosome, the amino acid that it was carrying gets
added to the elongating polypeptide chain.
4. The ribosome continues until it hits a stop sequence, then it releases the polypeptide
and the mRNA.
5. The polypeptide forms into its native shape and starts acting as a functional protein in
the cell.

HOW IS GENETIC ENGINEERING DONE?

Genetic engineering, also called transformation, works by physically removing a
gene from one organism and inserting it into another, giving it the ability to express the
trait encoded by that gene. This newly generated DNA molecule, with DNA from other
sources, is called recombinant DNA.

The process of genetic engineering requires the successful completion of five steps :
Step 1: DNA Extraction
DNA is extracted from the desired organism. A sample of an organism
containing the gene of interest is taken through a series of steps to remove
the DNA.
Step 2: Gene Cloning
The second step of the genetic engineering process is gene cloning.
During DNA extraction, all of the DNA from the organism is extracted at
once. Scientists use gene cloning to separate the single gene of interest from
the rest of the genes extracted and make thousands of copies of it.
Step 3: Gene Design
Once a gene has been cloned, genetic engineers begin the third step,
designing the gene to work once inside a different organism. This is done
in a test tube by cutting the gene apart with enzymes and replacing gene
regions that have been separated.
Step 4: Transformation or Gene Insertion
The new gene is inserted into some of the cells using various techniques.
Some of the more common methods include the gene gun, agrobacterium,
micro-fibers, and electroporation. The main goal of each of these methods
is to transport the new gene(s) and deliver them into the nucleus of a cell
without killing it. Transformed plant cells are then regenerated into
transgenic plants. The transgenic plants are grown to maturity in
greenhouses and the seed they produce, which has inherited the transgene,
is collected.
Step 5: Backcross Breeding
Transgenic plants are crossed with elite breeding lines using traditional
plant breeding methods to combine the desired traits of elite parents and
the transgene into a single line. The offspring is repeatedly crossed back to
the elite line to obtain a high-yielding transgenic line. The result will be a
plant with a yield potential close to current hybrids that expresses the trait
encoded by the new transgene.

5
 Examples of Genetically Modified Organisms Examples of Genetically Modified Crops
1. Pigs that are resistant to respiratory 1. GMO corn is created to resist insect pests
diseases or tolerate herbicides
2. Land mine-detecting plants 2. GMO soy is used for food for animals,
3. Genetically modified salmon that grow predominantly poultry and livestock, and
incredibly quickly making soybean oil
4. Mosquitoes designed to birth weak 3. GMO cotton was created to be resistant to
offspring bollworms and helped revive the Alabama
cotton industry
5. Cows genetically modified to produce
something resembling human milk 4. GMO potatoes were developed to resist
insect pests and disease
6. Ruppy, the glow-in-the-dark clone beagles
5. Rainbow papaya, was created to resist the
7. The glow-in-the-dark pet Glofish
ringspot virus
8. Featherless chickens
6. GMO summer squash is resistant to some
9. Monkey-pig chimera plant viruses
10. The Vacanti mouse 7. GMO apples were developed to resist
browning after being cut

BENEFITS AND RISKS OF USING GMOs

GMOs, or genetically modified organisms, are organisms whose genetic material
has been altered using genetic engineering. GMOs range from microorganisms like yeast
and bacteria to insects, plants, fish, and mammals. Genetically modified crops (GM crops)
are those engineered to introduce a new trait into the species. Purposes of GM crops
generally include resistance to certain pests, diseases, or environmental conditions, or
resistance to chemical treatments (e.g. resistance to a herbicide). Another purpose of genetic
modification of crops is to enhance their nutritional value, as seen in the case of golden rice.
The use of GM crops is widely debated. At the moment there is no known harm in
consuming genetically modified foods. GM foods are developed – and marketed – because
there is some perceived advantage either to the producer or consumer of these foods. This
is meant to translate into a product with a lower price, greater benefit (in terms of durability
or nutritional value), or both.
Benefits of Using GMOs Risks of Using GMOs Some Potential
Consequences to the
Environment Include:
1. a decreased use of pesticides and 1. potential 1. Unintended
insecticides development of selection
2. reduced greenhouse gas emissions allergens 2. Unwanted change in
3. increased nutritional values in foods 2. production of a toxic gene expression
substance to “non- 3. Unintended effect on
4. contribute to an increase in the
target” organisms non-GM weeds,
number of functional foods or
nutraceutical foods with added benefits 3. increased endocrine pests, or pathogens
disruption, 4. Survival and
5. better taste
reproductive persistence beyond
6. the faster output of cops disorders, and the intended zone
7. more crops can be grown on less land accelerated aging
5. Production of a toxic
8. genetically modified animals have a 4. antibiotic resistance substance to 'non-
higher resistance to disease and overall 5. unknown effects target' organisms
better health
6. soil and water 6. "Horizontal Gene
pollution transfer "

6
 Let’s Practice

Directions: Complete the table that shows a comparison between DNA and RNA based on
the given descriptions. Write the answer in the space provided.
Features DNA RNA
Nitrogenous base
Number of strands
Sugar

Directions: Use the base-pairing rules to figure out the sequence of the new strand of
DNA for the original strands below.

1.C-C-C-G-G-G-T-A-T-G-C-A-T-G-T-A-C-G-T-A-C-G-T-C-G-T-A-T-A-T-C-G
_________________________________________________________________________
2.C-G-C-G-A-T-C-G-G-A-G-C-G-A-T-C-G-A-C-G-A-A-T-G-C-C-T-A-G-T-T-T
_________________________________________________________________________
3.C-G-C-G-A-T-C-G-A-G-C-G-A-T-C-G-A-C-G-A-T-T-G-C-C-T-A-G-T-T-T-T
_________________________________________________________________________
Question:
1. Explain why DNA replication is considered semi-conservative.

Let’s Do More

Directions: Fill in the table below with the correct sequence of DNA. Write your answers in
the space provided.
TEMPLATE DNA COMPLEMENTARY DNA
GGCGG
TGCATCG
AGACTC
GATAAGA
CTGGCTAC

7
 Directions: Transcribe the following sequence of DNA into its mRNA template.

DNA Messenger RNA (mRNA)

GGCGG
ACGTAGC
TCTGAG
GATAAGA
CTGGCTAC
Directions: Translate the mRNA strand into a polypeptide chain, then identify the
codons, anticodons, and amino acid sequence. Use the genetic code table on page 3.

mRNA: UAUGCUUUAGCGCUAGCGCCGCUAAGCC
Codons: _______________________________________________________________
Anticodons: _______________________________________________________________
Aminoacids: _______________________________________________________________

mRNA: AAAUGCCGGUAGUCCGUGAUGACC
Codons: _______________________________________________________________
Anticodons: _______________________________________________________________
Aminoacids: _______________________________________________________________

Let’s Sum It Up

Directions: Summarize the following processes.

GENETIC ENGINEERING CENTRAL DOGMA
1. Replication
1. DNA Extraction ______________________________________
_________________________________________ ______________________________________
_________________________________________ ______________________________________
2. Gene Cloning ______________________________________
_________________________________________
2. Transcription
_________________________________________
______________________________________
3. Gene Design ______________________________________
_________________________________________ ______________________________________
_________________________________________ ______________________________________
_________________________________________
4. Transformation or Gene Insertion 3. Translation
______________________________________
_________________________________________
______________________________________
_________________________________________
______________________________________
5. Backcross Breeding ______________________________________
_________________________________________
_________________________________________

8
 Let’s Assess
Directions: Read the questions carefully and circle the letter of the best
answer.

1. DNA is a polynucleotide molecule consisting of the following nucleotides:

A. Adenine, thymine, uracyl, guanine,
B. Adenine, thymine, cytosine, guanine
C. Cytosine, thymidine, adenine, guanosine
D. Cytosine, alanine, thymine, glycerin
2. Complementary base pairing in DNA assures that only one of the following base
pairs exists in DNA. Which of the following is the correct base pair?
A. Adenine-Adenine B. Thymine-Adenine
C. Thymine-Guanine D. Cytosine-Thymine
3. If a strand of DNA molecule has the sequence GTCCAC, what would be the
complementary section of DNA?
A. GACCTC B. GTCCAC C. CTGGAG D. CAGGTG
4. RNA is different from DNA because _________________.
A. RNA is single-stranded B. RNA has Uracil
C. RNA has the sugar ribose D. All of these
5. During replication, the enzyme that breaks the hydrogen bonds holding the base
pairs together as it unwinds and unzips the double helix.
A. DNA B. RNA C. DNA Helicase D. RNA Helicase
6. Which is a negative result of the use of genetic engineering in agriculture?
A. Increased crop yields B. Reduction in pesticide use
C. Unknown side effects D. Higher nutritional values
7. Which best describes the technique of genetic engineering?
A. Adding foreign DNA to organisms to modify the organism’s DNA.
B. Manufacturing synthetic DNA in the laboratory from chemicals
C. Cutting segments of DNA of an organism under a microscope.
D. Exposing DNA of an organism to radioactivity for mutations.
8. The process of making changes in the DNA code of living organisms is called ____?
A. Selective breeding
B. Genetic engineering
C. Inbreeding
D. hybridization
9. Which of the following technique would most likely be used by forensic scientists?
A. Cloning B. Gene therapy C. karyotyping D. DNA fingerprinting
10. What is the molecular unit of heredity of all organisms and they are often called
the blueprint for life?
A. Cell B. Genes C. Allele D. DNA

9
 Answer Key
Let’s Practice
Let’s Try
Feature DNA2
Activity RNA
1. 6. Nitrogenous base
2. 7.
3. 8. Number of
4. 9. Strands
5. 10. Pentose sugar

Activity 2
Feature DNA RNA
1.
2. Nitrogenous Adenine, Adenine,
3. base Guanine, Guanine,
Cytosine, Cytosine,
Feature DNA RNA Thymine Uracil
Nitrogenous Adenine, Adenine, Number of Double Single
base Guanine, Guanine, Strands strand strand
Cytosine, Cytosine,
Thymine Uracil Pentose Deoxyribose Ribose
Let’s Do More
sugar
Activity 1 of
Number Double Single Activity 2
Strands strand strand Let’s Practice
TEMPLATE COMPLEMENTARY DNA Messenger
DNA
Pentose DNA
Deoxyribose Ribose RNA(mRNA)
sugar
GGCGG
Let’s Practice
Feature DNA RNA ACGTAGC
TCTGAG
Feature DNA RNA
Nitrogenous Adenine,Adenine, GATAAGA
base Guanine,Guanine, CTGGCTAC
Nitrogenous
Adenine, Adenine,
Cytosine,
Cytosine, base Guanine, Guanine,
Thymine Uracil Cytosine, Cytosine,
mRNA: U A U G C U U U A G C G C U A G CThymine
GCCGCU AAGCC
Uracil
Codons:
Number of Double Single
Anticodons: Number of Double Single
Strands strand strand
Aminoacids: Strands strand strand
Pentose Deoxyribose Ribose
sugar mRNA: AAAUGCCGGUAG U C C G UDeoxyribose
Pentose G A U G A CRibose
C
Codons: sugar
Let’sAnticodons:
Practice
Aminoacids: . Let’s Practice
Let’s Assess
Let’s Sum it Up 1. 6.
Activity 1-Answer may 2. 7.
vary 3. 8.
4. 9.
5. 10.

Reference
Feature DNA RNA
Book
Sia, Shila Rose D., Cortez,
Nitrogenous Leah Amor
Adenine, S., and Sotto, Rosario Laurel.Earth and Life Science in Today’s
Adenine,
World for Senior
base High School. Pasig
Guanine, City: Department of Education, 2016.
Guanine,
Cytosine, Cytosine,
10
Thymine Uracil

Number of Double Single

Strands strand strand
FEEDBACK SLIP

A. FOR THE LEARNER

Thank you very much for using this CLAS. This learner’s
material is aimed at ensuring your worthwhile learning through the
help of your family members. For feedback purposes, kindly answer YES NO
the following questions:

1. Are you happy and contented with your learning experiences

using this CLAS?

2. Were you able to follow the processes and procedures that

were indicated in the different learning activities?

3. Were you guided by anybody from your family while using this
CLAS?

4. Was there any part of this CLAS that you found difficult? If yes,
please specify what it was and why.

B. FOR THE PARENTS / GUARDIANS

Do you have any suggestions or recommendations on how we
can make improvements to this module to better serve the learners?

Yes (Please indicate what this is/these are.)

None

Contact Number: __________________________________

NAME OF SCHOOL:

Teacher’s Name and Signature:

Parent’s / Guardian’s Name and Signature:

Date Received:

Date Returned:

11