Thanks to visit codestin.com
Credit goes to www.scribd.com

0% found this document useful (0 votes)
336 views23 pages

General Biology 1: Most Essential Learning Competncies (Melcs)

Uploaded by

brendon
Copyright
© © All Rights Reserved
We take content rights seriously. If you suspect this is your content, claim it here.
Available Formats
Download as PDF, TXT or read online on Scribd
0% found this document useful (0 votes)
336 views23 pages

General Biology 1: Most Essential Learning Competncies (Melcs)

Uploaded by

brendon
Copyright
© © All Rights Reserved
We take content rights seriously. If you suspect this is your content, claim it here.
Available Formats
Download as PDF, TXT or read online on Scribd
You are on page 1/ 23

General Biology 1

MODULE 5: CENTRAL DOGMA OF BIOLOGY

Gene expression occurs when the information stored in


the DNA is converted into instruction for making proteins or other
molecules. It is tightly regulated process that allows a cell to
respond to its changing environment. It acts as both an on/off
switch to control when proteins are made and also a volume
control that increases or decreases the amount of proteins made.
The study of gene expression provides valuable insights in many
aspects such as the nature of diseases and the effect of treatments
by quantifying the activity of RNA in a biological sample. This
module will allow us to better understand how our genes dictate
the characteristics we possess

Most Essential Learning Competncies( MELCs):


At the end of this module, you should be able to:
1. Illustrate the molecular structure of DNA, RNA and proteins.
2. Diagram the steps in DNA replication and protein synthesis.
3. Outline the processes involved in genetic engineering.
4. Discuss the applications of recombinant DNA

Learning Objectives:

Having successfully completed module 1, you will be able to:


1. explain the relationship between DNA, RNA and proteins to another individual.
2. explain the processes involved in the central dogma of molecular biology;
3. determine types of mutation, its effects and factors affecting occurrence of mutation;
4. describe what occurs during each type of mutation;
5. discuss the processes in genetic engineering, its impacts and applications and;
6. act upon how transgenic organisms benefit society.
Performance Task no.1: DNA Extraction
Extracting DNA from a fruit may sound like a challenging task, but it is not very difficult
at all. The process involves a few general steps: including mashing, filtration,
precipitation, and extraction. After performing this activity, you are to answer what is
required of you and submit as scheduled. This will be graded as your 1st Performance
Task No. 1 for this 2nd grading period, Use the answer sheet provided at the end of the module.
Materials
Fruit (ex. Banana), Salt, Warm water, Liquid soap, Blender or mortar and pestle, Toothpicks, Strainer,
Glass bottle/jar, Chilled Rubbing alcohol, Knife

Watch the video link for a visual presentation of the procedure:


https://www.youtube.com/watch?v=qfa0hi6s35E

Procedure
1. Using a knife, cut the fruit into tiny pieces. Doing so will increase surface area thereby exposing
more cells.
2. Place the fruit pieces in the blender (or mortar and pestle and grind), add a teaspoon of salt and
slowly add warm water to double the volume of the mixture. The salt will help the DNA stay
together during the mashing process. Blend or grind until solution is homogenized.
General Biology 1

3. Pour the mixture into the glass jar through a strainer until half full. Make sure that the mixture
does NOT touch the sides of the glass so you can see changes on the upper part of the solution.
4. Add 2 teaspoons of liquid soap and gently stir the mixture. You should try not to create bubbles
when stirring. Let it stand for 10 minutes.
5. Tilt the glass and very slowly pour the ice-cold ethanol down the side of the glass stopping near
the top. The alcohol should form a layer on top of the mixture (DO NOT MIX! The DNA collects
between the two layers!).
6. Wait for 5 minutes to allow the DNA to separate from the solution.
7. Use the toothpicks to extract the DNA that floats to the surface. It will be long and stringy.
Tips:
1. When pouring the alcohol, make sure that two separate layers are being formed (The
bottom layer being the fruit mixture and the top layer being the alcohol).
2. When extracting the DNA, twist the toothpick slowly. Be sure to only remove the DNA
from the top layer.
3. Try repeating this experiment again using other food such as an onion or chicken liver.

Results/Observations: Possible results of your observation from DNA Extraction experiment


are found on the quiz tab in Genyo. Comprehend each statement/ condition and answer what
is asked.

Do you ever wonder how the genes that are embedded in your chromosomes are
expressed so that you can observe the traits and characteristics that you have
inherited from your parents? Well, that’s what we are going to expound in this lesson.

This can be explained by learning the concepts of the central dogma of biology. By concept, the
genes within the chromosomes are copied in the nucleus into mRNAs. The mRNAs move out of the
nucleus, is read and interpreted in the cytoplasm to form proteins. These proteins will express the trait
embedded within the DNA.
Take the eye color as an example. Let’s say you have inherited a gene that makes your eye
color black. So how is this trait coded in your genes expressed? The cells in your eyes will copy the
gene eye color and forms an mRNA. This mRNA is interpreted in the cytoplasm to create eumelanin,
the pigment that makes the cells’ color brown to black. The gene also controls how much eumelanin is
produced by the eye cells. The more eumelanin is produced, the darker the eye color is. So a person
with a black eye color, creates more eumelanin pigments than brown eyed-person.
All the 46 chromosomes that has been inherited from our parents are present in all of the cells
in our body. However, only the genes that are needed and specific for a particular cell is being copied
and turned into products for genes to be expressed. Confused? Your pancreas cells (islet of
Langerhans) create lipase and other enzymes needed for digestion. The cells make use of the codes
in the DNA to construct these digestive enzymes. In our skin cells, those DNAs needed to produce the
same enzyme produced in the islets of Langerhans are present but they are not copied and used since
it is not an enzyme needed or used by the skin as an organ thus, they are not manufactured.
General Biology 1

Lesson Outline
Unit 1: Central Dogma Unit 2: Mutation
A. DNA Replication (DNA Synthesis) A. Gene Mutation
a. Enzymes: Types:
HUP, HDP, DNA Gyrase, DNA Substitution
Pol, DNA Ligase Insertion
b. Process: Deletion
Unwinding, Priming, Excision, Mode:
Sealing i. Point mutation:
B. Transcription (RNA Synthesis) Silent
a. Enzymes involved: Missense
Sigma Factor, RNA Pol, Rho Nonsense
factor ii. Frameshift Mutation
b. Process:
B. Chromosomal Mutation
Initiation, Elongation,
Duplication, Inversion,
Termination
C. Translation (Protein Synthesis) Deletion, Insertion,
a. Process: Translocation, Non-disjunction
Initiation, Elongation, Unit 3: Genetic Engineering
Termination

Before proceeding with our discussion of the central dogma, let’s take a review of the concepts
of the DNA.
Deoxyribonucleic Acid (DNA) and Ribonucleic Acid (RNA) are polynucleotides which are made
up of repeating units of nucleotides. The chemical components that build up the nucleotides are the
nucleoside and the phosphate group. The nucleotide is composed of five carbon sugar, either a ribose
or deoxyribose and the nitrogen base, purines and pyrimidines. Purines, which includes Guanine (G)
and Adenine (A) are generally bigger because they exhibit double rings in their structural formula.
Pyrimidines like thymine (T), Uracil (U) and Cytosine (C) are single ringed nitrogen bases.

DNA is composed of two antiparallel polynucleotide strands connected at the middle by


Hydrogen bonds between nitrogen bases. Each nucleotide is connected with each other to form a
long chain by phosphodiester bond (covalent sugar-phosphate bonds).
General Biology 1

There is a specific base pairing in


DNA. Only A pairs with T having two
hydrogen bonds and G pairs only with C,
having three hydrogen bonds. In 1935,
Watson and Crick proposed the double
helical structure of the DNA as the three-
dimensional configuration of the molecule.
The diagram of the structure can be likened
to a spiral staircase. Two rails representing
the sugar-phosphate backbones while the
horizontal bars represent nitrogen base
pairs. One turn of the helix contains ten
(10) nucleotide pairs which are 3.4
Angstrom unit apart.
RNA is composed of single strand
of polynucleotide strands. Each nucleotide
is also connected with each other by a
covalent sugar- phosphate bonds. Another difference of RNA from DNA is the presence of U instead
of T, so that specific base pairing for A is U and G to C.
Unit 1 Central Dogma of Biology
The central dogma illustrates the flow of genetic information from DNA through RNA into
proteins. This flow of information is called gene expression. The concept of a sequence of interaction
can be understood through the framework:

A. DNA Replication
DNA is the genetic material that defines
every cell. Before a cell duplicates and is divided
into new daughter cells through
either mitosis or meiosis, biomolecules
and organelles must be copied to be distributed
among the cells. DNA, found within the nucleus,
must be replicated in order to ensure that each
new cell receives the correct number
of chromosomes. The process of DNA
duplication is known as DNA replication which
follows several steps that involve multiple
enzymes and RNA. In eukaryotic cells, such
as animal cells and plant cells, DNA replication
occurs in the S phase of interphase during the cell cycle. The process of DNA replication is vital for cell
growth, repair, and reproduction in organisms.
General Biology 1

Enzymes:
HUP - helix unwinding protein (DNA) helicase); it serves to uncoil and separate the two strands of
the DNA.
HDP – helix destabilizing protein (DNA topoisomerase); it prevents the separated strands form
joining back together (re-annealing)
DNA gyrase – it acts as a tension reducer during the uncoiling process.
DNA pol (polymerase) – it acts to bring DNA nucleotides and pair them with the unpaired strands
of DNA
DNA ligase – this serves to seal or close or join any breaks between two DNA nucleotides

The Process:
a. UNWINDING
Before DNA can be replicated,
the double stranded molecule must be
separated into two single strands. In
order to unwind DNA, bonding between
base pairs must be broken by an
enzyme known as DNA helicase. DNA
helicase disrupts the hydrogen
bonding between base pairs to separate
the strands into a Y shape known as
the replication fork. This area will be
the template for replication to begin.
DNA is directional in both strands, signified by a 5' and 3' end. This notation signifies
which side group is attached the DNA backbone. The 5' end has a phosphate (P) group
attached, while the 3' end has a hydroxyl (OH) group attached. The replication fork is bi-
directional; one strand is oriented in the 3' to 5' direction (leading strand) while the other is
oriented 5' to 3' (lagging strand). The two sides are therefore replicated with two different
processes to accommodate the directional difference.
b. PRIMING
The leading strand is the simplest to replicate. Once the DNA strands have been separated, a
short piece of RNA primer binds to the 3' end of the strand. The primer always binds as the
starting point for replication generated by the enzyme DNA primase.

c. ELONGATION
DNA polymerases creates a new strand. There are five different known types of DNA
polymerases in bacteria and human
cells. In bacteria such as E.
coli, polymerase III is the main
replication enzyme, while polymerase I,
II, IV and V are responsible for error
checking and repair. DNA polymerase
III binds to the strand at the site of the
primer and begins adding new base
pairs complementary to the strand
during replication. In eukaryotic cells,
polymerases alpha, delta, and epsilon
are the primary polymerases involved in
DNA replication. Because replication
proceeds in the 5' to 3' direction on the
General Biology 1

leading strand, the newly formed strand is continuous.


The lagging strand begins replication by binding with multiple primers. Each primer is only
several bases apart. DNA polymerase then adds pieces of DNA, called Okazaki fragments, to the
strand between primers. This process of replication is discontinuous as the newly created fragments
are disjointed.
d. EXCISION
RNA primers are replaced with DNA nucleotides by the DNA polymerase.

e. SEALING
Since there is a gap between the replaced nucleotides, the gap should be closed by the
enzyme ligase.
Once both the continuous and discontinuous strands are formed, an enzyme
called exonuclease removes all RNA primers from the original strands. These primers are then
replaced with appropriate bases. Another exonuclease “proofreads” the newly formed DNA to
check, remove and replace any errors. DNA ligase joins Okazaki fragments together forming a
single unified strand. The ends of the linear DNA present a problem as DNA polymerase can
only add nucleotides in the 5′ to 3′ direction. The ends of the parent strands consist of repeated
DNA sequences called telomeres. Telomeres act as protective caps at the end of chromosomes
to prevent nearby chromosomes from fusing. A special type of DNA polymerase enzyme
called telomerase catalyzes the synthesis of telomere sequences at the ends of the DNA. Once
completed, the parent strand and its complementary DNA strand coils into the familiar double
helix shape. In the end, replication produces two DNA molecules, each with one strand from the
parent molecule and one new strand (semi-conservative).
B. Transcription (RNA Synthesis)
Transcription is the first stage of the expression of genes into proteins. An mRNA (messenger
RNA) intermediate is transcribed from one of the strands of the DNA molecule. The RNA is called
messenger RNA because it carries the "message," or genetic information, from the DNA to
the ribosomes, where the information is used to make proteins. DNA template is used to produce RNA.
The information is transferred from DNA base sequence to RNA base sequence. RNA and DNA use
complementary coding where base pairs match up, similar to how the strands of DNA bind to form a
double helix.
RNA polymerase mediates the manufacture of an RNA strand that complements the DNA
strand. RNA is synthesized in the 5' to 3' direction. There are some proofreading mechanisms for
transcription, but not as many as for DNA replication. Sometimes coding errors occur.

The functions of the enzymes are listed below.


Sigma factor – this enzyme identifies an initiation point in the DNA where transcription starts.
RNA POL- an enzyme that brings RNA nucleotide to complement the DNA strands being copied.
Rho factors- an enzyme that identifies a termination point to end transcription

Types of RNAs
Messenger RNA (mRNA) – carry code from DNA
Transfer RNA (tRNA) –carry specific amino acid
Ribosomal RNA (rRNA) – component of the ribosome where protein synthesis takes place.

a. INTIATION OF TRANSCRIPTION
The initiation of transcription in bacteria begins with the binding of RNA polymerase to the
promoter in DNA. Transcription initiation is more complex in eukaryotes, where a group of
proteins called transcription factors mediates the binding of RNA polymerase and the initiation of
transcription.
General Biology 1

The next step of transcription is called promoter clearance or promoter escape. RNA
polymerase must clear the promoter once the first bond has been synthesized. Approximately 23
nucleotides must be synthesized before RNA polymerase loses its tendency to slip away and
prematurely release the RNA
transcript.
b. ELONGATION
One strand of DNA
serves as the template for
RNA synthesis, but multiple
rounds of transcription may
occur so that many copies of
a gene can be produced.

c. TERMINATION OF
TRANSCRIPTION
Termination results in
the release of the newly
synthesized mRNA from the
elongation complex. In eukaryotes, the termination of transcription involves cleavage of the
transcript, followed by a process called polyadenylation. In polyadenylation, a series of adenine
residues or poly(A) tail is added to the new 3' end of the messenger RNA strand.

C. Translation (Protein Synthesis)


After DNA is transcribed into a messenger RNA (mRNA) molecule during transcription, the
mRNA must be translated to produce a protein. In translation, mRNA along with transfer RNA (tRNA)
and ribosomes work together to produce proteins.
1. Initiation: ribosomal subunit binds to mRNA
A small ribosomal subunit attaches to a mRNA molecule. At the same time an initiator
tRNA molecule recognizes and binds to a start codon sequence (AUG) on the same mRNA
molecule. A large ribosomal subunit then joins the newly formed complex. The initiator tRNA
resides in one binding site of the ribosome called the P site, leaving the second binding site,
the A site, open. When a new tRNA molecule recognizes the next codon sequence on the
mRNA, it attaches to the open A site. A peptide bond forms connecting the amino acid of the
tRNA in the P site to the amino acid of the tRNA in the A binding site.

2. Elongation: ribosome moves along the mRNA molecule linking amino acids and forming
polypeptide chain
As the ribosome moves along the mRNA molecule, the tRNA in the P site is released
and the tRNA in the A site is translocated to the P site. The A binding site becomes vacant again
until another tRNA that recognizes the next mRNA codon takes the open position. This pattern
continues as molecules of tRNA are released from the complex, new tRNA molecules attach,
and the amino acid chain grows.

3. Termination: ribosome reaches the stop codon which terminates protein synthesis and
release the ribosome
Enzymes:
Amino acyl synthetase – enzyme that mediates in the formation of amino acid –tRNA
complex in the presence of ATP
mRNA- provides the template that gives the code for the amino acid sequence of the
protein
General Biology 1

tRNA- transfer amino acids from different location in the cytoplasm to the exact site of
protein synthesis.
rRNA- they form an organelle known as ribosomes when combined with some protein
where polypeptide/protein synthesis take place
The ribosome will translate the mRNA molecule until it reaches a termination codon
(UGA, UAA, UAG) on the mRNA. When this happens, the growing protein called a polypeptide
chain is released from the tRNA molecule and the ribosome splits back into large and small
subunits.
The newly formed polypeptide chain
undergoes several modifications before
becoming a fully functioning protein.
Proteins have a variety of functions.
Some will be used in the cell
membrane, while others will remain
in the cytoplasm or be transported out
of the cell. Many copies of a protein
can be made from one mRNA
molecule. This is because
several ribosomes can translate the
same mRNA molecule at the same time.
These clusters of ribosomes that
translate a single mRNA sequence are
called polyribosomes or polysomes.

Self-Assessment 1
Complete the DNA sequence of the DNA and RNA
strands based on the given mRNA sequence.

Multiple Choice Circle the best answer.


1. The DNA replication occurs in a semi-conservative manner which means
a. Two daughter cells with one consisting of double helical parent DNA, others have newly
synthesized DNA.
b. Two daughter cells each consisting one parental strand and one newly synthesized DNA.
c. Two daughters’ cells each consisting of one-half parental and another half newly synthesized
DNA resulting from the crossover.
d. None of the above
2. As the two strands of the double helix are separated, the positive supercoiling interferes with the
further unwinding of DNA. Which of the following enzyme makes a break in a strand of DNA to
release the supercoiling and facilitate the replication to occur?
a. DnaA protein c. Single-strand binding protein
b. DNA polymerase d. Topoisomerase
General Biology 1

3. RNAs form by _____; proteins form by ______.


a. Replication; translation d. translation; transcription
b. transcription; translation e. Transcription; replication
c. replication; transcription
4. Which does not belong to the group?
a. UUA b. UAG c. AUG d. UAG e. None of the choices
5. Using this DNA sequence, transcription would produce a molecule containing:
TAC GGG CAT
a. ATG CCC GTA c. meth - pro - val
b. AUG CCC GUA d. tyr - gly - hist
6. How many codons are in this mRNA?
AUG GAC UGG GCC CAA
a. 3 b. 15 c. 45 d. 5

Additional links below will help you better understand the lessons. Make sure to
allow adobe flash to function using chrome or firefox for the links to work properly.
https://dnalc.cshl.edu/resources/3d/central-dogma.html
http://www.bch.cuhk.edu.hk/vlab/hd/anime1_detail.html

Unit 2: Mutation
Mutation involves any changes in genetic information. Mutations could happen in both the
somatic cells and the gametes.

Only the mutations that took place in the somatic cells can be expressed by the person owning
the mutated cells. However, the mutations cannot be transferred to its offspring. Mutations that
happen in the gametes can be passed to offspring but is not expressed by person who had the
mutation.

There are two categories of mutations: gene mutations and chromosomal mutations.
A. Gene mutations produce changes in a single gene.

Type of mutation according to mode of formation


There are three ways that DNA can be altered when a gene
mutation (change in DNA sequence) occurs.
1. Substitution – one base-pair is replaced by a
different base
2. Insertion – one or more base pairs is added to a
sequence
3. Deletion – one or more base pairs is removed from a
sequence

Point mutations involve only one or a few nucleotides. There


are three possible results for a point a mutation.

1. Silent mutation happens when a base pair is substituted but does not change the amino acid in
the sequence.
Example: TCT and TCC both code for the amino acid Serine
General Biology 1

2. Missense mutation occur when a base pair is substituted and the resulting new codon codes for a
different amino acid.
Example: TCT codes for Serine and CCT codes for Proline

3. Nonsense mutation is when a change in the nucleotide creates a stop codon.


Example: GTG-GTC-CGA-AAC-ACC-TCT-CCT –– GTG-GTC-CGA-UAA-ACC-TCT-CCT-
Val-Val-Pro-Asn-Thr -Ser-Pro Val-Val-Pro-Stop- Thr- Ser- Pro
Examples of common diseases that are caused by point mutation are Sickle cell anemia, Hemophilia,
Tay-Sach, Cystic fibrosis, Phenylketonuria, Polycystic kidney disease, haemochromatosis and hyper
cholesterolemia.

Frameshift mutations is due to either the deletion or insertion of nucleotide/s that causes the shift of
the “reading frame” of the genetic code. Frameshift mutations can change every amino acid that
follows the point of mutation and can have dramatic effects on the organism.
Example: GTG GTC CGA AAC ACC T –– GTG GTC GAA ACA CCT
Val-Val-Pro-Asn-Thr Val-Val-Glu-Thr-Pro

To explain better the effect of frameshift mutation, analyze this sequence:


THE FAT CAT ATE THE RAT.
Delete the first H and regroup the letters in groups of three, then write out the new groups of three.
(TEF ATC ATA TET HER AT)
Does it make sense? Next, insert a letter H after the first A, then regroup the letters in three groups.
(THE FAH TCA TAT ETH ERA T)

How was it different from the original sequence? Notice that the reading sequences was changed as a
letter is deleted or inserted to the original sequence, thus giving a different interpretation when read.

B. Chromosomal mutations produce changes in the number or structure of chromosomes. This


type of mutation happen through the following modes:
• Duplication produces an extra copy of all or part of a chromosome. Examples would include Cri
du chat and Duchene muscular dystrophy.
• Inversion reverses the direction of parts of a chromosome.
• Deletion involves the loss of all or part of a chromosome.
• Insertion includes the addition of segments to the chromosome. Fragile X syndrome and
friedreich’s ataxia are common examples of this mutation.
• Translocation occurs when part of one chromosome breaks off and attaches to another.

• Nondisjunction is when chromosomes fail to separate properly during meiosis, specifically


during anaphase. If it occurs during meiosis I, all of the cells will be affected and if one of the
cells is fertilized it will result in a zygote with too many or too few chromosomes. If
nondisjunction takes place during meiosis II, half of the cells will be affected and half will be
normal.
Ex. Dawn syndrome, also known as Trisomy 21, Klinefelter’s syndrome (XXY), Edwards’s
General Biology 1

Syndrome (Trisomy 18), Patau’s Syndrome (trisomy 13), Turner’s Syndrome (XO)

Causes of Mutation
Genetic material can be altered by natural events or by artificial means. Errors in the placement
of base pairs can occur during replication. These errors may not be corrected (by the exonuclease) or
detected by the enzymes that would lead to apoptosis.
Environmental conditions may affect the rate of mutation. Chemical or physical agents called
Mutagens, which could either be exogenous, artificial or environmental, cause damages to the DNA
when integrated in the cell and disrupts cell functions.

Effects of Mutations
The effects of mutations on organisms vary widely:
Some mutations have little or no effect.
Some mutations produce beneficial variations. One example is polyploidy in plants, in which an
organism has extra sets of chromosomes. Polyploid plants are often larger and stronger than
diploid plants. Mutations can also produce proteins with new or altered functions that can be
useful to organisms in different or changing environments.
Some mutations negatively disrupt gene function or dramatically change protein structure. Genetic
disorders such as sickle cell disease can result.

Below are links you can try to explore to achieve a better understanding of the
lesson.
http://glencoe.mheducation.com/sites/dl/free/0078802849/383936/BL_26.html
https://my.hrw.com/sh2/sh07_10/student/flash/virtual_investigations/hst/dna/hst_dna_vi.html
https://www.biologycorner.com/worksheets/DNA-sim.html

Self-Assessment 2

The autosomal recessive disorder -thalassemia can be caused by a mutation in the -


hemoglobin gene, and leads to decreased oxygen transport in red blood cells.
Normal -hemoglobin 5’ CACCAUGGUGCACCUGACUCCUGAGGAG 3’
-thalassemia mutation in beta hemoglobin 5’ CACCAUGGUGUACCUGACUCCUGAGGAG 3’

1. For the -hemoglobin protein to be produced the DNA must first be:
a. Translated into RNA c. Transcribed into RNA
b. Translated into protein d. Replicated in S phase
2. Based upon the normal RNA sequence and genetic code above, what will be the first amino acid in
the -hemoglobin protein? a. His b. Thr c. Pro d. Met e. Val
3. Based upon the RNA sequences and genetic code above, what change is occurring in the -
thalassemia protein?
a. A His is replaced with a Tyr c. A Tyr is replaced with a His
b. An Ala is replaced with a Val d. The start codon is lost
General Biology 1

In each of the following DNA sequences, identify the mRNA sequence and type of mutation that
occurred. Use these types of mutation for the identification of mutation: silent point mutation,
missense point mutations, nonsense point mutations, frameshift mutations (insertion/deletion),
deletion, inversion, duplication, and insertion. Look and analyze carefully!
Original DNA Sequence: T A C A C C T T G G C G A C G A C T
mRNA Sequence: AUG UGG AAC CGC UGC UGA
Amino Acid Sequence: MET TRP ASN ARG CYS STOP

Mutated DNA Sequence #1: T A C A T C T T G G C G A C G A C T


What’s the mRNA sequence?
(Circle the change) ______________________________________________
What will be the amino acid sequence? ________________________________________
What kind of mutation is this? ______________________

Mutated DNA Sequence #2: T A C G A C C T T G G C G A C G A C T


What’s the mRNA sequence?
(Circle the change)
__________________________________________________________________________
What will be the amino acid sequence? _________________________________________
What kind of mutation is this? ____________________

Unit 3: Genetic Engineering


- involves the use of molecular techniques to modify the traits of a target organism. The modification of
traits may involve:
I. introduction of new traits into an organism
II. enhancement of a present trait by increasing the expression of the desired gene
III. enhancement of a present trait by disrupting the inhibition of the desired genes’ expression.

Transgenic Organisms-contain foreign DNA (from other


organism)
Recombinant DNA- DNA made by connecting or combining
fragments of DNA from different sources
Polymerase chain reaction (PCR) is a method widely used
in molecular biology to make many copies of a specific DNA
segment.
Tissue Culture-the growth in an artificial medium of cells derived
from living tissue
Cloning- the process of producing genetically identical individuals
of an organism either naturally or artificially.

Genetic engineering using bacteria involves:


Isolation of a chromosome (containing the target gene) and a
plasmid.
Cutting the chromosome (restriction) and plasmids with a
restriction enzyme.
Insertion of the cut sections of the chromosome into the plasmid
Transformation of bacterial cells i.e. getting the bacterial cells to
take up the plasmids.
Expression or production of the required protein by the bacteria with the recombinant DNA.
General Biology 1

Biotechnology- any technological application


that uses biological systems, living organisms,
or derivatives thereof, to make or modify
products or processes for specific use.

Genetically Modified Organisms (GMOs) With


the ability to insert gene sequences, comes the
possibility of providing new traits for these target
organisms. This has allowed the development of
GMOs. Some of these genetic modifications
promise higher product yield for their targets.
Examples:
A. Flavr-Savr tomato -an inhibitor (i.e. antisense RNA) disrupts the expression of a ripening
gene (i.e. polygalacturonase), thereby delaying the softening of the fruit and extending the time
it may be kept in storage and transported to markets.
B. Bt-Corn was developed to incorporate the production of a toxin (i.e. Bt-endotoxin) from
Bacillus thuringensis in corn plants making it resistant to most pests

Additional links below will help you comprehend the lessons.


http://www.bch.cuhk.edu.hk/vlab/hd/vl_detail.html
http://www.bch.cuhk.edu.hk/vlab/hd/anime2_detail.html
http://www.bch.cuhk.edu.hk/vlab/index.html
https://www.biointeractive.org/classroom-resources/crispr-cas-9-mechanism-applications

Self-Assessment 3
Gel electrophoresis is a technique used in biotechnology wherein macromolecules like
DNAs and RNAs are analyzed. In DNA analysis, the DNA are fragmented and separated
based on their size, density and electric charge. In this activity, you are to analyze results
of gel electrophoresis.
A. Multiple Choice Choose the letter of the correct answer.
1. What is an advantage of using genetically engineered bacteria to produce human proteins?
a. The human proteins produced by genetically engineered bacteria work better than those
produced by humans.
b. Genetically engineered bacteria can mass-produce pure human proteins.
c. The human proteins produced by genetically engineered bacteria last longer than those
produced by humans.
d. Genetically engineered bacteria can produce human proteins used to make plastics.
2. If two DNA samples showed an identical pattern and thickness of bands produced by gel
electrophoresis, the samples contained
a. the same amount of DNA. c. fragments of the same size.
b. the same DNA molecules. d. all of the choices.
3. Analyzing DNA by gel electrophoresis allows researchers to
a. compare DNA samples from different sources.
b. determine whether a particular allele of a gene is dominant or recessive.
c. compare the phenotypes of different organisms.
d. cut DNA with restriction enzymes.
4. One function of gel electrophoresis is to
a. Separate DNA fragments b. Cut DNA c. Recombine DNA d. Extract DNA
General Biology 1

5. To produce genetically engineered bacteria that make a human protein, which of the following
steps does a scientist have to take first?
a. Insert the human gene for the protein into a plasmid.
b. Extract the protein from the bacterial culture.
c. Use a restriction enzyme to cut out the gene from human DNA.
d. Transform bacteria with the recombinant plasmid.
B. Analysis Use the gel electrophoresis results to solve the problem.

mom daughter son1 son2

6. The millionaire, Mr. Big, has just died. He has left behind a wife, daughter
and a large inheritance. The news of his death has brought forth 2 men who
claim to be the long-lost son of Mr. & Mrs. Big. Before Mr. & Mrs. Big were
married, they had a child taken from them. They had tried to find him but had
no luck in locating him. A DNA sample was taken from Mrs. Big, the big
daughter and the two men who claim to be the long-lost son. Which, if any, of
the men are telling the truth?

felon S1 S2 S3
8. Lt. Russ is investigating a dad dad
baby mom
murder scene. The felon was 1 2
scratched by his victim & some
of his skin cells were found
under the victim’s fingernails.
A DNA test was performed.
Which of the suspects is the
murderer?

felon S1 S2 S3

7. Suzy was assaulted in


an alley. The police
collected a sample of 9. Mrs. Smith has a baby
cells that was left at the named Jessica. She
crime scene and now believes one of two men
have 3 suspects in can be the father of her
custody. Which of the child. A paternity test is
suspects assaulted Suzy? done and the results are
shown above. Which of
the 2 men are baby
Jessica’s father?
General Biology 1

Performance Task No.2: DNA Modelling


In this activity, you will make use of the DNA cut outs to simulate the processes involved
in the Central Dogma of Molecular Biology. Follow the procedures correctly. Use the
cut outs provided to demonstrate the process involved and answer the questions as you
proceed from one stage to another. Make sure to submit required output to your teacher.
This is equivalent to a 30pts Performance Task No.2 for the 2nd grading period.

A. Nucleic Acids
You are tasked to make a representation of each of the 5-carbon sugar, the five nitrogenous
bases, the phosphate group and enzymes. You may follow the procedures stated in the following
paragraphs or you may use any material as representation of the compounds needed in this activity.
Remember though to be very consistent to your representations as we proceed with the processes
involved in the formation of proteins. Be creative and explore other media to use for this activity.

A ready-made cut-out is provided as another alternative material for this activity. This will only
serve as a guide for you to accomplish your central dogma modelling.

Using the legend from the illustrations given, cut out the shapes to the specified colored paper of the
pattern in the appendix. Each model represents a molecule except the black square model. The
orange must be connected to the brown pentagon so as the different colors.

Group the cut paper models according to color. Assemble nucleotides by


connecting the components using the pattern below for your guide. You should be
making 30 pieces per set. Be sure that the pink should be attached to the brown
and the yellow to the white pentagon.
Group the nucleotides based on the colors of the pentagon. A ready-made DNA and RNA strand cut-
out is provided for your convenience. You may use these or have your own cut-out models.

B. DNA and RNA Assembly


After accomplishing this activity, you should be able to:
a. Describe DNA and RNA
b. Compare DNA and RNA
c. Identify the components of DNA and RNA
d. Construct DNA and RNA models using paper models

Set aside the nucleotides with


brown pentagon. You should have
with you the nucleotides with white
pentagon. Turn the nucleotide
models upside down and shuffle
them. At random, pick up one
nucleotide at a time and assemble a
column of 15 nucleotides. Connect
the black band between the orange
circle and the pentagon.
General Biology 1

Turn the remaining nucleotides side up and pair the strand with the appropriate nucleotide based
on their shapes at their ends.

Keep these factors in mind:


a. DNA is a double stranded molecule
b. The double helix is antiparallel
c. DNA includes deoxyribose and thymine
d. Base-pairing rules apply

What you have is a model of a DNA. Keep all the nucleotide models used for DNA. This time,
bring out the nucleotides for RNA (those nucleotides modes with brown pentagon.

Turn the nucleotide models upside down and shuffle them like what you did with the DNA
nucleotide models (with the pentagon). At random, pick one nucleotide at a time and assemble a column
of 15 nucleotides. Connect again the black between the orange circle and the brown pentagon.

What you have made is an RNA model?


Examine your assessment RNA. List down characteristics like: number of strands, the different
color present, the color of the pentagon. Compare your DNA and RNA model. List down similarities.
Tabulate their differences based on the following number of strands, colors present, color of the
pentagon.

C. DNA Replication
After this activity, you should be able to:
a. Identify the different enzymes required for DNA replication
b. Give the specific functions of these enzymes
c. List down the steps involved during each stage of replication
d. Demonstrate the different steps involved in DNA replication

DNA, being the genetic material must be passed on faithfully form parent cell to daughter cell
from generation to another in order to preserve the characteristics of a species. This is made possible
by DNA replication, a process which provides two exact copies of the DNA to be distributed to daughter
cells.

DNA replication is a semi-conservative process. Newly synthesized molecules are composed of


a template strand of previously synthesized parental DNA and a newly synthesized DNA strand. The
accuracy of replication is made possible by specific base pairing (A-T; G-C)

Replication of prokaryotes and viral DNA are more clearly understood than replication of
eukaryotes DNA because of the complexity of organization.

In this activity, you are going to mimic DNA replication using models. You are going to prepare
to enzymes models for this activity. Below are illustrations of the different enzymes’ models. Using
illustrations given below cut the shapes to a white cardboard.

HDP HUP GYRASE Rho

DNA Pol LIGASE


RNA Pol
General Biology 1

Before you begin, construct first a 21 nucleotide DNA model. Recall what you have done in the
module of DNA and RNA assembly. Set the enzyme model, RNA nucleotide, DNA nucleotides in one
place of your working area.

The process of replication can be broken down into series of stages. But the whole process is
continuous. To understand how replication happens, you are going to do it by stages.

The first stage is:

UNWINDING
Since the DNA are coiled together to fit inside the nucleus, they should be first uncoiled and be
separated before they are duplicated. This is brought about by an enzyme, Helix Unwinding Protein.
During the uncoiling and unwinding, a tension is also developed and this tension is also reduced by
DNA gyrase. Separated DNA strands have the tendency to join (re-anneal) back together because of
their specific base pairing. To prevent them from re-annealing Helix destabilizing Protein blocks two
DNA strands.

To illustrate this stage, position by following proteins, HUP and DNA gyrase on one end of your model
to identify the starting point.
3’ 5’

5’ 3’
Bring HUP and gyrase to other end moving across the whole length of your DNA strand to show the
action of these enzymes to the DNA. Separate your strands to about 30 cm apart. Put HDP in
between the two strands. Label one if the strands 1 and the other 2

3’ 5’

5’ 3’

PRIMING
When the DNA strands separate, nucleotides from the cytoplasm pairs with the open strands.
The first to complement (pair) with the few open nucleotides are the RNA nucleotides known as RNA
primers or simply primers.

To illustrate again the priming process, bring the RNA pol protein on one end of strand 1
(opposite the phosphate), facing the strand 3 DNA nucleotide then add RNA nucleotides to complement
the first 3 nucleotides of the DNA following the direction of the arrow in the illustration.
Do the same procedure with the other strand but in the opposite end. Remember that DNA has
a characteristic of anti-parallelism.

ELONGATION
DNA nucleotides pair with the open strands with specific nitrogen bases until all the free ends
are complemented.
Remove the RNA pol located on the first strand. This time bring DNA pol on the fourth nucleotide and
complement it with DNA nucleotide.
Bring the DNA pol on the other end of strand I passing across the whole length, then add nucleotides
to complement the free ends of the DNA strand I following the same direction.
After you have paired strand I, do the same with strand 2, addition of DNA nucleotide to the 2nd strand
opposes the direction if the elongation of strand 1.
General Biology 1

EXCISION
RNA primers are replaced with DNA nucleotides. This replacement process is brought about by
an enzyme known as the DNA pol.

Bring DNA pol on the first 3 nucleotides of strand 1 replace the RNA nucleotides with DNA nucleotides.
Do the same with strand 2.

SEALING
Since there is a gap between the replaced nucleotides, the gap should be closed. This is done
by the enzyme ligase.

Pass DNA ligase across the whole length of both the two DNA strands.

C. Transcription (RNA Synthesis)


DNA stores biological information in its nucleotide base sequences. But traits are expressed
through the action of protein either directly or indirectly. The question then is how does the DNA transfer
stored information to the proteins?

DNA template is used to produce RNA. The information is transferred from DNA base sequence
to RNA base sequence. In this activity, you will copy a nucleotide base sequence of the model DNA to
produce a mode RNA.

After this, you should be able to:


a. Identify the enzymes needs for transcription
b. Give the roles of these enzymes
c. Demonstrate the steps in transcription

Transcription is a continuous process. It is the production of RNA’s that are needed for the
production of protein. For purposes of understanding the whole process you are going to present it in
three stages, namely initiation of transcription, elongation and termination of transcription.

a. Initiation of Transcription
An enzyme identifies an initiation point in the DNA and breaks the bond between the nitrogenous
bases. Once the initiation point has been identified, another enzyme brings in RNA nucleotides to pair
(complement) with the DNA. Only one strand of the DNA, called the sense strand will be copied. While
the DNA is being copied, specific base pairing is still followed; where c pairs with G, G pairs with C, A
with U in place of T and T with A.

Using your enzyme models, bring sigma factor to the initiation point. (Assume that initiation point would
be at end your DNA model). Separate the two strands of DNA.
Bring the RNA pol where the sigma factor is located and join them together. Complement the sense
strand with RNA nucleotide

Once the first nucleotide has been complemented, the RNA nucleotides continue to complement at the
other DNA nucleotides, the process known as elongation.

b. Elongation
A strand of RNA is continuously being formed. As the enzymes move along the sense strand
RNA nucleotides further complements the other DNA nucleotides.
To illustrate elongation and formation of a strand of RNA, bring the two joined enzymes
towards the end. While bringing two joined enzymes to the other end of the DNA, complemented the
DNA sense strand with RNA nucleotides.
General Biology 1

c. Termination of Transcription
RNA synthesis stops when an enzyme identifies a point in the DNA sense strand a command
to stop elongating (termination point). This terminating enzyme combines with other enzymes to prevent
further addition of RNA nucleotides.

Bring the Rho factor on the last nucleotide of the DNA sense strand. Combine the three enzymes
together and remove them from the setup.

Separate the RNA strand formed from the sense strand. Bring the two DNA strands back
together to form the original DNA model. Separate the enzymes.

D. Translation (Protein Synthesis)


The mRNA produced during transcription carries
biological information copied from DNA. It is the RNA
which serves as a template to produce amino acids. The
information is transferred from RNA base sequence to
protein amino acid sequence. Eventually, the information
stored in the DNA is relayed to the protein.
In this activity, you will attempt to build a
polypeptide, which is the hidden code in the DNA copied
by mRNA.

After finishing this, you should be able to:


a. Identify the functions of mRNA, tRNA, rRNA
b. Give the roles of the enzymes needed in protein
synthesis
c. Demonstrate the assembly of polypeptide using paper model
d. Use correctly the genetic code chart
e. List down the observations of the polypeptide formed using genetic code chart

The codon chart on the left will help you identify the specific amino acid that is complementary to
the mRNA strand (codon).

To differentiate it with the other succeeding amino acid, methionine, which may be formed during
elongation process, let us call it to be formulated methionine (f-met).

The following requirements (enzyme model and RNA models) are needed in the translation
process. Cut paper models on a cardboard or any material of your choice.

Peptide Bond Small Sub Unit


tRNA

Large Sub Unit

Amino
Acid
Amino Acyl
Synthase
General Biology 1

To illustrate this stage, bring the small and big unit of the ribosome together. Take note that the
smaller unit is above the bigger unit. Bring the mRNA on the side of the ribosome with an ‘A’ mark. Be
sure that the first codon (triplet) to enter the ribosome has t5he nitrogenous bases AUG (violet, red,
green)

P A

Once the mRNA is on its place, bring the amino acid-tRNA complex (aa-tRNA) - tRNA with
attached amino acid; that has the anticodon to complement to the codon of the mRNA. The anticodon
of the tRNA should have the nitrogen bases UAC (red, violet, yellow) and is carrying with it the amino
acid f-met.

The next step is the binding of another aa- tRNA complex. Entrance of aa-tRNA is in the ‘A’ site.

Move the mRNA-tRNA complex towards the P site of the ribosome. The movement allows
another codon to enter the ‘A’ site. Bring appropriate complex to complement the free codon of the
mRNA.
In order that the two amino acids will join together, a bond between them is formed, known as the
formation of peptide bond.
To illustrate this, disconnect the f-met amino acid from the first tRNA and connect the two amino
acids by a peptide bond represented by a dark bond. Do not detach the amino acids from the other
tRNA yet.
Continuous movement the mRNA – tRNA towards the P site of the ribosome, simultaneously
complementing the codon with a tRNA with appropriate anticodon, as in the procedure in binding of
amino acid and
formation of peptide A U G bond.

A U G A C G

UAC

A
m
A A
i
m m
n
i i
o
n n
A
o o
c
A A
i
c c
d
i i
General Biology 1

Termination of translation stops the whole process when termination codon, which could be
UAG, UGA, UAA is in the ‘A’ site of the Ribosome. Elongation do not proceed any longer, RNA complex
separates with each other and a polypeptide (protein) is formed.

When a codon of the mRNA in the A site of the ribosome is either UAG, UGA or UAA, detach
the last tRNA from the amino acid, set aside the polypeptide formed and separate the RNA complex.

U A A

A
m
A i
A A A m n
m m m i o
i i i n A
Output Refer to the quiz part in Genyo. Make use of the cut outs as a reference to your
n n n o c
answers in the quiz. Answer as you proceed with each step/stage ofi the processes involved in
o o o A
The central Dogma. A A A c d
c c c i
i i i d
d d d
General Biology 1

Strand 1

Strand 2

Nucleotide Cut Outs for the DNA Model


General Biology 1

Answers to Formative Tasks


Self-Assessment 1 Central Dogma
Analysis

Multiple Choice
1. B 2. D 3. B 4. C 5. B 6. D

Self-Assessment 2 Mutation

Mutated DNA Sequence #1: T A C A T C T T G G C G A C G A C T


What’s the mRNA sequence? (Circle the change) AUG UAG AAC CGC UGC UGA
What will be the amino acid sequence? MET STOP
What kind of mutation is this? Nonsense Substitution Point Mutation

Mutated DNA Sequence #2: T A C G A C C T T G G C G A C G A C T


What’s the mRNA sequence? (Circle the change) AUG CUG GAA CCG CUG CUG A
1. Bwill be the amino
What acid sequence? MET 3.
2. D LEU
A GLU ARG LEU LEU
What kind of mutation is this? Missense Insertion Point Mutation

Self-Assessment 3 Genetic Engineering


1. B 2. D 3. A 4. A 5. A
6. Son 1 7. S1 8. S2 9. Dad 1

You might also like