Government Property

NOT FOR SALE

Science
10
Quarter 4 - Module 7
Biomolecules: Nucleic Acids

Department of Education ● Republic of the Philippines

Science- Grade 10
Alternative Delivery Mode
Quarter 4 - Module 7: Biomolecules: Nucleic Acids
First Edition, 2020

Republic Act 8293, section 176 states that: No copyright shall subsist in any work
of the Government of the Philippines. However, prior approval of the government agency or
office wherein the work is created shall be necessary for exploitation of such work for profit.
Such agency or office may, among other things, impose as a condition the payment of
royalty.
Borrowed materials (i.e. pictures, photos, brand names, trademarks, etc.) included in
this book are owned by their respective copyright holders. Every effort has been exerted to
locate and seek permission to use these materials from their respective copyright owners.
The publisher and authors do not represent nor claim ownership over them.
Published by the Department of Education – Division of Bukidnon
Schools Division Superintendent: Randolph B. Tortola, PhD, CESO IV

Development Team of the Module

Author/s : Rubylen D. Granaderos, MS

Content Editor : Ma. Socorro B. Halasan, PhD
Language Editor : June Francis Sorongon
Reviewers : Ellen A. Azuelo, PhD, Rejynne Mary L. Ruiz, PhD
Illustrator and Layout Artist : Christine Fel A. Matugas, Xyza M. Penkian
Management Team :
Chairperson : Arturo B. Bayocot, PhD, CESO III
Regional Director
Co-Chairpersons : Victor G. De Gracia Jr., PhD, CESO V
Assistant Regional Director
: Randolph B. Tortola, PhD, CESO IV
Schools Division Superintendent
: Shambaeh A. Abantas-Usman, PhD
Assistant Schools Division Superintendent
Mala Epra B. Magnaong, Chief ES, CLMD

Members : Neil A. Improgo, EPS-LRMS

Bienvenido U. Tagolimot, Jr., EPS-ADM
Elbert R. Francisco, CID Chief
Ellen A. Azuelo, EPS-Science
Rejynne Mary L. Ruiz, LRMS Manager
Jeny B. Timbal, PDO II
Shella O. Bolasco, Librarian II

Printed in the Philippines by

Department of Education – Division of Bukidnon
Office Address: Fortich Street, Malaybalay City, Bukidnon
Telefax: (088) 813-3634
E-mail Address: depedbukidnon.net.ph
 10
Science
Quarter 4 - Module 7
Biomolecules: Nucleic Acids

This instructional material was collaboratively developed and reviewed

by educators from public schools. We encourage teachers and other
education stakeholders to email their feedback, comments, and
recommendations to the Department of Education at Bukidnon @
deped.gov.ph.
We value your feedback and recommendation

Department of Education ● Republic of the Philippines

 Table of Contents

COVER PAGE Page

COPY RIGHT PAGE
TITLE PAGE
TABLE OF CONTENTS

Lesson 1: Biomolecules: Nucleic Acids

What I Need to Know 1
What I Know 1
What’s In 2
What’s New 2
What Is It 3
What’s More 4
What I Have Learned 4
What I Can Do 5
Assessment 5
Additional Activity 6
Lesson 2: Nucleic Acid: DNA & RNA
What I Need to Know 8
What I Know 8
What’s In 9
What’s New 9
What Is It 10
What’s More 12
What I Have Learned 13
What I Can Do 13
Assessment 13
Additional Activity 14
Lesson 3: Nucleic Acid Processes
What I Need to Know 15
What I Know 15
What’s In 16
What’s New 17
What Is It 17
What’s More 18
What I Have Learned 19
What I Can Do 20
Assessment 20
Additional Activity 22

Unit Assessment 23
Answer Key 25
References 29
What This Module is About

Introductory Message
For the facilitator:
Welcome to the Science 10 Alternative Delivery Mode (ADM) Module on
Biomolecules.
This module was collaboratively designed, developed and reviewed by educators
from public schools to assist you, the teacher or facilitator in helping the learners
meet the standards set by the K to 12 Curriculum while overcoming their personal,
social, and economic constraints in schooling.
For the learner:
This learning resource hopes to engage the learners in guided and independent
learning activities at their own pace and time. Furthermore, this also aims to help
learners acquire the needed 21st century skills while taking into consideration their
needs and circumstances.

As a facilitator, you are expected to orient the learners on how to use this module.
You also need to keep track of the learners' progress while allowing them to manage
their own learning. Furthermore, you are expected to encourage and assist the
learners as they do the tasks included in the module.
For the parents:
As a coach, you are expected to watch over and support your child throughout their
learning. The same way, parents can mentor and encourage the learners to learn
progressively and independently.
How to Learn from this Module
To achieve the objectives cited above, you are doing the following:
• Take your time reading the lessons carefully.
• Follow the directions and/or instructions in the activities and exercises diligently.
• Answer all the given tests and exercises.

Icons of this Module

This part contains learning objectives that

What I Need to are set for you to learn as you go along the
Know Module.

This is an assessment as to your level of

Knowledge to the subject matter at hand,
Meant specifically to gauge prior related
What I know Knowledge

This part connects previous lesson with that

What’s In Of the current one.

An introduction of the new lesson through

various activities, before it will be presented
What’s New to you

These are discussions of the activities as a

way to deepen your discovery and under-
What is It Standing of the concept.

These are follow-up activities that are in-

tended for you to practice further in order to
What’s More Master the competencies.

What I Have Activities designed to process what you

Learned have learned from the lesson

These are tasks that are designed to show-

case your skills and knowledge gained, and
What I can do Applied into real-life concerns and situations.
 What I Can Do This section provides an activity which will
help you transfer your new knowledge or
skill into real life situations or concerns.

Assessment This is a task which aims to evaluate your

level of mastery in achieving the learning
competency.

Additional Activities In this portion, another activity will be given

to you to enrich your knowledge or skill of
the lesson learned. This also tends retention
of learning concepts.

Answer Key This contains answers to all activities in the

module.

At the end of this module you will also find:

References This is a list of all sources used in

developing this module.

The following are some reminders in using this module:

1. Use this module with care. Do not put an unnecessary mark/s on any part
of the module. Use a separate sheet of paper in answering the exercises.
2. Don’t forget to answer What I Know before moving on to the other activities
included in the module.
3. Read the instructions carefully before doing each task.
4. Observe honesty and integrity in doing the tasks and checking your answers.
5. Finish the task at hand before proceeding to the next.
6. Return this module to your teacher/facilitator once you are through with it.
If you encounter any difficulty in answering the tasks in this module, do not
hesitate to consult your teacher or facilitator. Always bear in mind that you are
not alone.

We hope that through this material, you will experience meaningful learning
and gain deep understanding of the relevant competencies. You can do it!
This page is intentionally left blank.
 Lesson BIOMOLECULES

1 Nucleic Acids

What I Need to Know

At the end of the lesson the students will be able to;

1. Define nucleic acids;
2. Discuss the functions of nucleic acids;
3. Appreciate the importance of nucleic acids to living things.

What I Know
Multiple Choice: Select the correct answer from the given choices. Write
your answer on a separate sheet of paper.
1. In addition to the standard organic elements carbon, hydrogen and oxygen,
nucleic acid also contains___
A. Calcium B. Nitrogen C. Phosphorus D. Sulfur
2. What’s the name of the monomer that makes up a nucleic acid?
A. Deoxyribose B. Nucleotide C. Phospholipid D. Ribose
3. How many parts do nucleotide have?
A. 1 B. 2 C. 3 D. 4
4. Which of the following is not part of a nucleotide?
A. Monosaccharide sugar B. Nitrogen base
C. Oxygen Base D. Phosphate Group
5. Sugar bonds to ________ to form the backbone.
A. Carbonate B. Oxalate C. Phosphate D. Sulfate
6. Which of the following is the main function of DNA?
A. get data B. instigating mitosis
C. sitting the nucleus D. storing genetic information

1
7. The instruction in a DNA molecule is carried in the form of a specific sequence
Of _______.
A. nucleotides B. nitrogen bases C. oxygen bases D. triglycerides
8. Which of the following best describes RNA?
A. double helix B. double-stranded C. single helix D. single-stranded
9. The order of nitrogen bases in RNA determines the sequence of ________
A. amino acids in a nucleotide B. amino acids in a protein
C. phosphate groups in a nucleotide D. phosphate groups in a protein
10. Thymine is never found in ______________.
A. DNA B. Nucleotide C. Nucleus D. RNA

What’s In
In the previous lesson, you have learned about the different
protein structure such as primary, secondary, tertiary and quarternary. The
structure is distinguished by the sequence of amino acid, its’ arrangement and
length. These structures are the results of interactions between R groups, H-
bonding or formation of –S-S- bonds between the chains. Protein molecules are
so long that they automatically coil, fold or twist.
As we continue our lesson, we will be discussing another type of
biomolecules; nucleic acids. Its’ function is to store and transmit genetic
information from their parents to their children.

What’s New
Nucleic acids are the fourth class of biological molecule.
Nucleic acids are responsible for the transmission of inherent characters from
parent to the offspring.
They are responsible for the synthesis of protein in our body. DNA fingerprinting
is a method used by forensic experts to determine paternity. A nucleic acid is a

2
nitrogen containing biological polymer that is involved in the storage and
transmission of genetic information.

What Is It
Nucleic acids are the main information-carrying molecules of the cell and
play a central role in determining the inherited characteristics of every living
thing.
Nucleic acids have a far more important-sounding name: the building blocks of
life.
These components are found in DNA and RNA of every living thing on the planet.
They're located in the nucleus of all living cells, and have a variety of jobs,
including the construction of proteins, the replication of the cells for longevity and
growth, the containment of genetic material that is passed to offspring, and more.
There are five chief types of components in nucleic acids: cytosine,
guanine, thymine, uracil, and adenine. Whether the acid contains uracil or
thymine determines whether it is DNA (thymine) or RNA (uracil).
Each nucleotide has three parts, namely: inorganic phosphate group, five-
carbon monosaccharide sugar, and a nitrogen base.
In a nucleic acid, the sugar of one bond to the phosphate of another. This
makes them string together in a chain. Each sugar is also bonded to a nitrogen
base.
Examples of nucleic acids: DNA (Deoxyribonucleic Acid), RNA
(Ribonucleic Acid), Artificial Nucleic Acids, and Mutations (Regina Bailey, 2020)

The Functions of Nucleic Acids

Nucleic acids are responsible for the transmission of inherent characters
from parent to offspring. They are responsible for the synthesis of protein in our
body. DNA fingerprinting is a method used by forensic experts to determine

3
 paternity. It is also used for the identification of criminals. It has also played a
major role in studies regarding biological evolution and genetics.

What’s More
Nucleic Acids
This class involves the genetic materials – the DNA and RNA. DNA is the
blueprint of life because it contains instructions on how to make proteins in the
body. Each individual’s DNA is unique, which means that each individual has a
unique set of proteins; that is why each of us looks and behaves differently. RNA
creates a copy of DNA because DNA cannot leave the cell’s nucleus, and
because proteins are constructed outside of the nucleus in the cytoplasm -- the
RNA is necessary to carry the instructions from DNA to the cytoplasm where the
protein is made.
The monomer of nucleic acids is the nucleotide. All nucleic acids are
formed from a series of these nucleotides. Nucleotides consist of three parts: a
five-carbon sugar, a phosphate group and a nitrogen base.

What I Have Learned

True or False. Write True if the statement is correct about nucleic acid and False
if it is wrong. Write your answer on a separate sheet of paper.
1. Nucleic acids are responsible for the transmission of inherent characters from
parent to offspring.
2. The monomer of nucleic acids is the nucleotide.
3. RNA is the blueprint of life because it contains instructions on how to make
proteins in the body.
4. Nucleic acids are responsible for the synthesis of protein in our body.

4
 5. RNA creates a copy of DNA because DNA can’t leave the cell’s nucleus.

What I Can Do
Answer the following questions. Write your answer on a separate sheet

of paper.

1-2. What are the two types of nucleic acids? _________ and ______________
3-5. What is the role of DNA?
________________________________________________________________
________________________________________________________________

6-9. What is the difference between the role of RNA from that of DNA?
________________________________________________________________
________________________________________________________________
10. What is the building block of nucleic acids? ___________________________
What are the three parts of monomer?
11. _________________ 12. ________________ 13. _____________________

Assessment
Multiple Choice. Analyze each question, carefully then chose the letter of the
correct answer. Write the letter of your answer on a separate sheet of paper.
1. Sugar bonds to_____ to form the backbone.
A. Carbonate B. Oxalate C. Phosphate D. Sulfate
2. Which of the following is the main function of DNA?
A. get data B. instigating mitosis
C. sitting the nucleus D. storing genetic information
3. The instruction in a DNA molecule is carried in the form of a specific sequence

5
 Of _____.
A. nitrogen bases B. nucleotides C. oxygen bases D. triglycerides
4. Which of the following best describes RNA?
A. Double helix B. Double-stranded C. Single helix D. Single-stranded
5. The order of nitrogen bases in RNA determines the sequence of_____
A. Amino acids in a nucleotide B. Amino acids in a protein
C. Phosphate groups in a nucleotide D. Phosphate groups in a protein
6. Thymine is never found in_____.
A. DNA B. Nucleotide C. Nucleus D. RNA
7. In addition to the standard organic elements carbon, hydrogen and oxygen,
Nucleic acid also contains;
A. Calcium B. Nitrogen C. Phosphorus D. Sulfur
8. What’s the name of the monomer that makes up a nucleic acid?
A. Deoxyribose B. Nucleotide C. Phospholipid D. Ribose
9. How many parts do Nucleotides have?
A.1 B. 2 C. 3 D. 4
10. Which of the following is not part of a nucleotide?
A. Monosaccharide sugar B. Nitrogen base
C. Oxygen Base D. Phosphate Group

Additional Activity
Choose your answer from the words inside the parenthesis. Write your
answer on a separate sheet of paper.
What are nucleic acids?
 One of the 4 major organic _____ 1. (micromolecules, macromolecules)
found in the living things.
 They just have one function – to make _____ 2. (vitamins, proteins)
 There are two main types of Nucleic Acid; _____ 3. And _____ 4. (DNA
and RNA, Protein and Vitamins, Polymers and Monomers)

6
 Structure of Nucleic Acid (What are they made of?)
 A nucleic acid is made of many _____ 5. (monomers, polymers) joined
together.
 Nucleic acids are polymers made of many monomers called _____
6. (Nucleotides, polypeptides)

7
Lesson BIOMOLECULES

2 Nucleic Acid: DNA & RNA

What I Need to Know

At the end of the lesson the students will be able to;
1. Differentiate DNA from RNA;
2. Discuss the functions of DNA and RNA;
3. Understand how DNA and RNA work in living things.

What I Know
Multiple Choice: Read the questions below and write the
letter of your answer in a separate sheet of paper.
1. It is a segment of DNA that codes for a particular protein.
A. Genes B. Nucleotide C. RNA D. Trait
2. Where in the cell are chromosomes located?
A. Cytoplasm B. Mitochondria C. Nucleus D. Ribose
3. DNA can be found in what organelles in the cell?
A. Chloroplasts and Mitochondria B. Cytoplasm and Nucleus
c. nucleus and cytoplasm D. Ribosomes and nucleus
4. What is the shape of DNA?
A. Curved B. Double Helix C. Single Helix D. Twisted
5. Which of the following is not a basic building block of DNA?
A. Bases B. Phosphate C. Sugar D. Uracil
6. What do you call the sugar present in RNA?
A. Deoxyribose B. Glucose C. Ribose D. Sucrose
7. Which of the following nitrogen bases is not found in DNA?
A. Cytosine B. Guanine C. Thymine D. Uracil

8
8. It’s a double helix molecule composed of complimentary strands of
deoxyribonucleotide units.
A. DNA B. mRNA C. rRNA D. tRNA
9. If adenine bond with uracil in RNA, What bonds with DNA?
A. Cytosine B. Guanine C. Phosphate D. Thymine
10. Which is a process of making copies of DNA?
A. Mutation B. Replication C. Transcription D. Translation

What’s In
In the previous lesson, you have learned that nucleic acids are
the fourth class of biological molecule. It is a nitrogen containing biological
polymer that is involved in the storage and transmission of genetic information.
Nucleic acids are the main information-carrying molecules of the cell and play a
central role in determining the inherited characteristics of every living thing.

What’s New
As we continue our lesson, you will know the two types of
nucleic acids: DNA and RNA. You will understand where did you got your looks.
The shape of your face, the color of your hair, and many more characteristics.
Nucleic acids are involved in the preservation, replication, and expression
of hereditary information. Two major types of nucleic acids are deoxyribonucleic
acid (DNA) and ribonucleic acid (RNA).

9
What Is It

Ribonucleic acid, or RNA, is also present in the nuclei of living things,

although there are certain types of RNA viruses that only contain RNA, and not
DNA. There are now several known classes of RNA, but three major types are
transfer RNA, messenger RNA, and ribosomal RNA-are mostly responsible for all
of the action in the nucleus that pertains to the genetic information. RNA carries
the information along, is responsible for the growth of new proteins, and creating
peptide bonds. DNA and RNA are made up of three parts: a five carbon sugar
(pentose), a phosphate group, and a ringshaped base containing nitrogen.
Figure 1, below show a model of a nucleotide, the sphere represents a
phosphate group, the pentagon represents a five–carbon sugar (pentose) and
the rectangle represents a nitrogen-containing base.

Figure 1. Show a model of nucleotide

There are two kinds of nucleic acids: DNA, or deoxyribonucleic acid; and
RNA, or ribonucleic acid. DNA is found mainly in the cell nuclei contains the
genetic information that codes for the sequences of amino acids in proteins while
RNA are found in many places in the cell. RNA carries out the synthesis of
proteins. The monomers of nucleic acids are nucleotides.

Table 1 below discusses the differences between RNA and DNA, its’
structure and function.

10
 DNA RNA
Description It contains the genetic It is responsible for
instruction used in the template in the
the development and synthesis of proteins
functioning of all living which in turn controls the
organisms. operation & function of the cell
Function Long-term storage and Transfer the genetic information
transmission of genetic for the creation of proteins from
information the nucleus to the ribosomes`
Sugar and Deoxyribose sugar Ribose sugar
Bases
Phosphate backbone; Phosphate backbone;
Four Bases: adenine, Four Bases: adenine,
guanine, cytosine, and guanine, cytosine, and
thymine uracil

Pairing of A-T (Adenine-Thymine) A-U (Adenine-Uracil)

Bases
G-C (Guanine-Cytosine) G-C (Guanine-Cytosine)
( http://www.diffen.com/difference/DNA_vs_RNA).

The figure below is about DNA that is typically double stranded, whereas
RNA is typically single stranded. Although it is single stranded, RNA can fold
upon itself, with the folds stabilized by short areas of complementary base pairing
within the molecule, forming a three-dimensional structure.

11
 What’s More
Fill in the blanks of the name of the nucleotides. Write your answer on a
separate sheet of papers.

12
 1._______
_

Base from the picture answer the following questions. Use another piece of
paper
For your answers.
Questions for DNA. Answer briefly and concisely.
1. What do DNA stands for?
2. What are the three parts of nucleotide?
3. What are the four bases of DNA?
4. What do you call the sugar found in DNA?
5. How does the bases pair up?
Questions for RNA. Answer briefly and concisely.
1. What are the differences between RNA and DNA?
2. What does RNA stand for?
3. What are the three types of RNA and what is their function?
4. How many nucleotides does it take to make one amino acid?
5. Give at least two importance of proteins.

What I Have Learned

13
Write TRUE if the statement is correct about and FALSE if it is wrong. Write your
answer on a separate sheet of paper. (DNA & RNA)
1. DNA found mainly in the cell nuclei contains the genetic information that codes
for the sequences of amino acids in proteins.
2. RNA is found in many places in the cell and carries out the synthesis of proteins.
The monomers of nucleic acids are nucleotides.
3. The DNA contains the genetic instruction used in the development and
functioning of all living organisms.
4. In DNA; Adenine is paired with Uracil and Guanine to Cytosine.
5. RNA carries the information along, is responsible for the growth of new proteins,
and creating peptide bonds.

What I Can Do
Matching Type: Match the term in the first column with its corresponding
description in the second column.Write the letter of your answer in a separate paper.
1. Nucleotide A. group of three sequential bases of mRNA
2. Double Helix B. group of three sequential bases of tRNA
3. Deoxyribose C. repeating sub-units/building blocks of DNA
&
RNA
4. Codon D. spiral shape of DNA
5. Anticodon E. sugar found in DNA

Assessment
Multiple Choice: Select the correct from the given choices. Write your
answer in a separate sheet of paper.

1. Which of the following sugar is present in RNA?

A. Deoxyribose B. Glucose C. Ribose D. Sucrose
2. Which of the following nitrogen bases is not found in DNA?
A. Cytosine B. Guanine C. Thymine D. Uracil

14
 3. It’s a double helix molecule composed of complimentary strands of
deoxyribonucleotide units.
A. DNA B. mRNA C. rRNA D. tRNA
4. If adenine bonds with uracil in RNA, what will bond with DNA?
A. Cytosine B. Guanine C. Phosphate D. Thymine
5. It’s a process of making copies of DNA.
A. Mutation B. Replication C. Transcription D. Translation
6. It is a segment of DNA that codes for a particular protein.
A. Genes B. Nucleotide C. RNA D. Trait
7. Where in the cell are chromosomes located?
A. Cytoplasm B. Mitochondria C. Nucleus D. Ribose
8. DNA can be found in what organelles in the cell?
A. Chloroplasts and Mitochondria B. Cytoplasm and Nucleus
C. nucleus and cytoplasm D. Ribosomes and nucleus
9. What is the shape of DNA?
A. Curved B. Double Helix C. Single Helix D. Twisted
10. Which of the following is not a basic building block of DNA?
A. Bases B. Phosphate C. Sugar D. Uracil

Additional Activity
DNA Base Pairing Worksheet
 There are basic pairing rules for writing complimentary DNA strands for a given
strand.
 A pairs with T, C pairs with G, In RNA, A pairs with U, instead of T.
Write the complimentary DNA strand for each given strand;
1. CGTAAGCGCTAATTA -

2. TCTTAAATGATCGATC -

3. AATGAATAGCTAGCTT -

4. GGCATTCGCGATCATG -

5. CGTTAGCATGCTTCAT –

15
 Lesson BIOMOLECULES

3 Nucleic Acid Process

What I Need to Know

At the end of the lesson the students will be able to;

1. Identify the DNA and RNA processes.
2. discuss the different nucleic acid processes;
3. Appreciate the importance of nucleic acid processes.

What I Know

Multiple Choice Test. Select the best answer from the choices below and write it
in a separate sheet of paper.

1. The first mRNA codon to specify an amino acid is always

A. AUG B. TAC C. UAA D. UAG
2. Which of the following is the process of converting the information in mRNA
into a sequence of amino acids that make a protein.
A. Mutation B. Replication C. Transcription D. Translation
3. Transfer RNA’s bind during translation by the_____
A. Amino acid B. Anticodon C. Codon D. Template
4. Which of the following is not a type of RNA?
A. mRNA (messenger RNA) B. nRNA (nuclear RNA)
C. rRNA (ribosomal RNA) D. tRNA (transfer RNA)

16
 5. Which type of mutation can be passed on to offspring?
A. Blood mutation B. Chromosome mutation
C. Gene mutation D. Reproductive mutation
6. In terms of DNA and RNA structure, what is nucleotide?
A. A nucleotide is a heterocyclic base.
B. A nucleotide is heterocyclic base bonded to phosphate group.
C. A nucleotide is a sugar molecule covalently bonded to heterocyclic base.
D. A nucleotide is a sugar molecule bonded to phosphate group/s and
heterocyclic base.
7. Which of the following is a condition cause by the deletion of the part of the
short arm of chromosome?
A. Cri du chat B. Down syndrome
C. Edwards syndrome D. Jacobsen syndrome
8. It is a condition usually causing by an extra copy of chromosome 21.
A. Cri du chat B. Down syndrome
C. Edwards syndrome D. Jacobsen syndrome
9. A test used to detect the abnormalities associated with chromosome
Structure.
A. Karyotype B. pregnancy test C. Ultrasound test D. Urinalysis
10. Which characteristic will this double-stranded DNA molecule share with a
Double-stranded RNA molecule of the same size?
A. Both will be degraded by the base.
B. Both will contain inverted repeats.
C. Both will have secondary structure.
D. Both will contain four types of base-pairs.

What’s In
In the previous lesson, you have learned the two types of
nucleic acids: namely DNA and RNA. The DNA found mainly in the cell nuclei
contains the genetic information that codes for the sequences of amino acids in

17
proteins. RNA is found in many places in the cell and carries out the synthesis of
proteins. The monomers of nucleic acids are nucleotides. RNA carries the
information along, is responsible for the growth of new proteins, and creating
peptide bonds.

What’s New
As we continue our lesson, you will identify and discuss the
different DNA and RNA processes and appreciate its importance.

What Is It
The process of DNA duplication is called DNA replication. Replication
follows several steps that involve multiple proteins called replication enzymes
and RNA. In eukaryotic cells, such as animal cells and plant cells, DNA
replication occurs in the S phase of interphase during the cell cycle.
The process of DNA replication is vital for cell growth, repair, and
reproduction in organisms.
DNA is the genetic material that defines every cell. DNA, found within the
nucleus must be replicated in order to ensure that each new cell receives the
correct number of chromosomes.
RNA, the three most well-known and most commonly studied are
messenger RNA (mRNA), transfer RNA (tRNA), and ribosomal RNA (rRNA),
which are present in all organisms. These and other types of RNAs primarily
carry out biochemical reactions, similar to enzymes. Some, however, also have
complex regulatory functions in cells. Owing to their involvement in many
regulatory processes, to their abundance, and to their diverse functions.
RNAs play an important roles in both normal cellular processes and
diseases.

18
 In protein synthesis, mRNA carries genetic codes from the DNA in
the nucleus to ribosomes, the sites of protein translation in the cytoplasm.
Ribosomes are composed of rRNA and protein. The ribosome protein
subunits are encoded by rRNA and are synthesized in the nucleolus. Once fully
assembled, they move to the cytoplasm, where, as key regulators of translation,
they “read” the code carried by mRNA.
A sequence of three nitrogenous bases in mRNA specifies the
incorporation of a specific amino acid in the sequence that makes up the protein.
Molecules of tRNA (sometimes also called soluble, or activator, RNA), which
contain fewer than 100 nucleotides, brings the specified amino acids to the
ribosomes, where they are linked to form proteins.

What’s More
Do this Activity. Write your answer in a separate sheet of paper.

RELAY THE MESSAGE

Objectives: • Make a model of the translation process
• Simulate the steps in translation
Materials: • crayons • 1/4 size illustration board or long size folder • scissors
• paste/tape

Procedure:

1. Use the patterns of the components of the DNA and RNA provided by your
teacher.
Color code phosphate = blue, deoxyribose sugar = green, ribose sugar = brown
and nitrogenous bases as follows: adenine = yellow, uracil = orange, guanine =
violet, cytosine = red and amino acid = green.
2. Cut out the shapes of each nucleotide.
3. Using the given order of the nucleotides below, construct a double stranded
DNA molecule. Guanine, Adenine, Cytosine, Thymine, Cytosine, Guanine.
4. Fasten your molecule together using a clear tape. Do not tape across base
pairs.
5. Step 1, use the patterns of the components of the RNA provided by your
teacher.
Color code phosphate = blue, ribose sugar = brown and nitrogenous bases as
follows: adenine = yellow, uracil = orange, guanine = violet and cytosine = red.

19
6. Cut out the shapes of each nucleotide of RNA.
7. With your DNA model in front of you, pull apart the DNA model.
8. using the right strand of the DNA model in step 3, begin matching
complementary RNA
nucleotides with the exposed bases on the DNA model to make mRNA.
9. Tape the RNA nucleotides.
10. Fasten your molecule together using a clear tape. Imagine that mRNA leaves
the cell nucleus and moves out to the cell’s ribosomes. Meanwhile, transfer RNA
(tRNA) is present in the cell cytoplasm. tRNA has a three –base sequence (a
triplet) that can match with the bases of mRNA.
11. Cut out the two models of tRNA only along solid lines.
12. Join the tRNA molecules to the mRNA model.
13. When you are finished, tape your model of the translation process on the
illustration board or folder.

Now, answer these, Write your answer in a separate sheet of paper

Q1. What are the four nucleotide bases present in tRNA? Do these bases differ
from those found in mRNA?
Q2. What base in mRNA can only join with the adenine base of RNA? Uracil
base of tRNA?
Q3. What is a codon? What does it represent?
Q4. What is the role of tRNA in protein synthesis?
Q5. How does a tRNA molecule carrying its amino acid recognize which codon
to attach?
Q6. You have learned that there is a stop codon that signals the end of an amino
acid chain. Why is it important that a stop codon be part of protein synthesis?
Q7. A construction worker brings hollow blocks to build a wall. What part of
translation resembles the construction worker’s job? What do the hollow blocks
represent?

What I Have Learned

Complete the table about the types of RNA and its’ function.
Write your answer in a separate sheet of paper.

TYPES OF RNA
TYPE FUNCTION
1. Carries copies of the instructions for
assembling amino acids from DNA to the
rest of the cell.
Ribosomal RNA 2.
3. Transfers each amino acid to the

20
 ribosome to help assemble proteins.

Answer the following questions:

1. How is mRNA made?
2. What is the name of the process?
3. Where does this happen?

What I Can Do
Fill in the matching base:
DNA DNA DNA mRNA mRNA tRNA
(Process name: Replication) (Process name: transcription) (Process name: translation)
Adenine: ______ Adenine: _______ Adenine: ______
Thymine: ______ Thymine: _______ Uracil: _______
Cytosine: ______ Cytosine: _______ Cytosine: _____
Guanine: ______ Guanine: _______ Guanine: _____

Assessment
Multiple Choice Test. Select the best answer from the choices below and write it
a separate sheet of paper.

1. In terms of DNA and RNA structure, what is nucleotide?

A. A nucleotide is a heterocyclic base.
B. A nucleotide is heterocyclic base bonded to phosphate group.
C. A nucleotide is a sugar molecule covalently bonded to heterocyclic base.
D. A nucleotide is a sugar molecule bonded to phosphate group/s and
heterocyclic base.
2. It is a condition cause by the deletion of the part of the short arm of

21
 Chromosome?
A. Cri du chat B. Down syndrome
C. Edwards syndrome D. Jacobsen syndrome
3. A condition usually caused by an extra copy of chromosome 21.
A. Cri du chat B. Down syndrome
C. Edwards syndrome D. Jacobsen syndrome
4. A test used to detect the abnormalities associated with chromosome
Structure.
A. Karyotype B. Pregnancy test C. Ultrasound test D. Urinalysis
5. Which characteristic will this double-stranded DNA molecule share with a
Double-stranded RNA molecule of the same size?
A. Both will be degraded by base.
B. Both will contain inverted repeats.
C. Both will have secondary structure.
D. Both will contain four types of base-pairs.
6. The first mRNA codon to specify an amino acid is always
B. AUG B. TAC C. UAA D. UAG
7. The process of converting the information in mRNA into a sequence of amino
acids that make a protein..
B. Mutation B. Replication C. Transcription D. Translation
8. Transfer RNA’s bind during translation by the ____
B. Amino acid B. Anticodon C. Codon D. Template
9. Which of the following is not a type of RNA?
B. mRNA (messenger RNA) B. nRNA (nuclear RNA)
C. rRNA (ribosomal RNA) D. tRNA (transfer RNA)
10. Which type of mutation can pass on to offspring?
A. Blood mutation B. Chromosome mutation
C. Gene mutation D. Reproductive mutation

22
Additional Activity
Answer the activity below. Write your answer in a separate sheet of paper.
Name ____________________ Date ______________ Section _______
Worksheet: DNA, RNA, and Protein Synthesis

Directions: Use your notes and book to answer the following questions concerning
Replication, Transcription, and Protein Synthesis.
1. Define the following terms:
a. Replication-

b. Transcription-

c. Translation-

2. Write the following DNA sequence into their corresponding pair.

CCGATACGCGGTATCCCAGGGCTAATTUAA

23
 Unit Assessment

Multiple Choice: Select the correct from the given choices. Write your answer in a
Separate sheet of paper.

1. Which characteristic will this double-stranded DNA molecule share with a

double-stranded RNA molecule of the same size?
A. Both will be degraded by the base.
B. Both will contain inverted repeats.
C. Both will have secondary structure.
D. Both will contain four types of base-pairs.
2. The first mRNA codon to specify an amino acid is always
C. AUG B. TAC C. UAA D. UAG
3. The process of converting the information in mRNA into a sequence of amino
acids that make a protein.
C. Mutation . Replication C. Transcription D. Translation
4. Transfer RNA’s bind during translation by the
C. Amino acid B. Anticodon C. Codon D. Template
5. Which one of the following is not a type of RNA?
C. mRNA (messenger RNA) B.nRNA (nuclear RNA)
C. rRNA (ribosomal RNA) D. tRNA (transfer RNA)
6. What do you call the sugar present in RNA?
A. Deoxyribose B. Glucose C. Ribose D. Sucrose
7. Which of the following nitrogen bases is not found in DNA?
A. Cytosine B. Guanine C. Thymine D. Uracil
8. it’s a double helix molecule composed of complimentary strands of
deoxyribonucleotide units.

24
 A. DNA B. mRNA C. rRNA D. tRNA
9. If adenine bond with uracil in RNA, adenine bond with _______ in DNA.
A. Cytosine B. Guanine C. Phosphate D. Thymine
. 10. it’s a process of making copies of DNA.
A. Mutation B. Replication C. Transcription D. Translation
11. Thymine is never found in ______________.
A. DNA B. NucleotideC. Nucleus D. RNA
12. In addition to the standard organic elements carbon, hydrogen and oxygen,
Nucleic acids also contain
B. Calcium B. Nitrogen C. Phosphorus D. Sulfur
13. What’s the name of the monomer that makes up a nucleic acid?
A. Deoxyribose B. Nucleotide C. Phospholipid D. Ribose
14. A nucleotide has how many parts?
A.1 B. 2 C. 3 D. 4
15. Which of the following is not part of a nucleotide?
A. Monosaccharide sugar B. Nitrogen base
C. Oxygen Base D. Phosphate Group

25
 Answer Key
Lesson 1- BIOMOLECULES: Nucleic Acid

Additional
WHAT I Activity WHAT I HAVE WHAT I CAN DO Assessment
KNOW LEARNED 1. A
1. Macromolecules
1. D
2. Proteins 1. True 2. D
2. DNA
B 2. True 3. A
3.
3. C 3. False 4. D
4. RNA
4. Monomers
C 4. True 5. D
5.
5. Nucleotides
C 5. True 6. D
6.
6. D 7. C
7. B 8. B
8. D 9. C
9. B 10.C
10.D

26
Lesson 2- Nucleic Acid: DNA & RNA

WHAT I CAN WHATS’

Assessment
MORE Additional Activity WHAT I HAVE
DO
KNOW 1. RNA1. C 2. DNA 3. Base11.
pairGCATTCGCGATTAAT
4. Nucleotides LEARNED
1. A 2. D 12. AGAATTTACTATCGAA 1. True
1. C 5. Cytosine 6. Guanine 7. Adenine 8. Thymine
2. C 3. A 13. TTACTTATCGATCGAA 2. True
2. D
3.
3. A
E DNA 4. D 14. CCGTAAGCGCTAGTAC 3. True
4.
4. B
A 5. B
1. Deoxyribonucleic Acid 15. GCAATGCTACGAAGTA 4. False
5.
5. D
B 6. A
2. Phosphate, Sugar and Nitrogen Base 5. True
6. C 3. G, A, T,7.C C
7. D 8. A
4. Deoxyribose
8. A 5. A and 9.T, GBand C
9. D RNA 10.D
10.B 1. RNA-uracil
RNA – single helix
DNA – double helix
2. Ribonucleic Acid
3. mRNA-copy the DNA template,
rRNA-components of ribosome and make
proteins
tRNA-carries amino acid.
4. 3

27
Lesson 3- Nucleic Acid Processes

WHAT I KNOW WHATS’ MORE.

1. A 1. In tRNA, the nucleotides are adenine, uracil, guanine and cytosine.
2. C The same nitrogenous bases are found in mRNA. The tRNA contains
3. C other nitrogenous bases that are derivatives of the same nucleotides
4. B
2. Adenine pairs with uracil and vice-versa.
5. C
6. D 3. A codon is a set of three nitrogenous bases in mRNA which codes for a
7. A specific amino acid.
8. B 4. Transfer RNA brings an amino acid in the cytoplasm to the ribosomes.
9. A Each tRNA molecule attaches to only one type of amino acid.
10. C 5. In tRNA there is a sequence of three nucleotides that are
complementary to the nucleotides in the mRNA codon. These
three nucleotides are called an anticodon because they bond to
the codon of the messenger RNA. The tRNA carries only the
amino acid that the anticodon specifies.
6. When a stop codon is reached, translation ends and amino acid strand
is released from the ribosome.
7. It resembles the job of the tRNA and the hollow blocks represent the
amino acids.

WHAT I HAVE LEARNED WHAT I CAN DO

Fill in the blanks: DNA-DNA
1. Messenger RNA A-T
2. Is part of a ribosomes T-A
3. Transfer RNA C-G
Questions: G-C
DNA-mRNA
1. DNA act as a template. The DNA unzips in the A-U
area of that gene & free RNA nucleotide pair up T-A
with the bases on the DNA, those RNA nucleotide C-G
G-C
bond together to create the mRNA strand
mRNA-tRNA
2. Transcription A-U
3. Nucleus U-A
C-G
G-C

28
Assessment Additional Activity
1. D 1. Replication - Each time a cell divides,
each of its double strands of DNA splits
2. A into two single strands.
3. B 2. Transcription is the process by which DNA
4. A is copied (transcribed) to mRNA, which
5. C carries the information needed for protein
6. B synthesis.
3. Translation - the process by which mRNA
7. C
directs protein synthesis with the
8. C assistance of tRNA is called translation.
9. B DNA coding:
10. C GGCTATGCGCCATAGGGTCCCGATTAACTT

Unit
Assessment
1. C
2. C
3. C
4. C
5. B
6. C
7. D
8. A
9. D
10. B
11. D
12. D
13. B
14. C
15. C

29
References
Printed Materials:
Comparison between DNA and RNA. Retrieved from http://www.diffen.com/ difference/
DNA vs. RNA
Cooper, J. "Peptide Geometry Part. 2." VSNS-PPS, 1 February 1995,
http://www.cryst.bbk.ac.uk/PPS95/course/3_geometry/index.html
Chang, Raymond, (1998). Chemistry. 6th edition. Mc Graw-Hill Companies, Inc.
Chute, Rose Marie. "Dehydration Synthesis." Anatomy and Physiology Resources,
13 March 2012, http://apchute.com/dehydrat/dehydrat.html.

Gribbin, J. (2002). The Scientists: A History of Science Told Through the Lives of Its
Greatest Inventors. New York: Random House. p. 546. ISBN 0812967887.

LeMay, Jr. Eugene H., et al. (2000). Chemistry Connections to Our Changing World
(Teacher’s Edition) Prentice Hall, Inc. Upper Saddle River, NJ 07458
Reece, Jane B., and Neil A. Campbell. Campbell Biology. Benjamin Cummings, 2011.
DNA Replication Steps and Process.

Electronic Sources:
n.d. Accessed 9 July 2020
https://www.softschools.com/quizzes/chemistry/nucleic_acids/quiz6042.html. Questions on Nucleic

n.d. Accessed 9 July 2020

https://www.softschools.com/examples/science/nucleic_acids_examples/27/. Nucleic Acids

n.d. Accessed 9 July 2020

href="https://www.softschools.com/examples/science/nucleic_acids_examples/27/">Nucleic Acids
Examples</a>

n.d. Accessed 9 July 2020

https://elshareitforfree.blogspot.com/p/dna-and-rna-multiple-choice-questions_76.html. DNA and RNA

n.d. Accessed 9 July 2020

https://akademiexcel.com/dna-rna-and-protein-synthesis-worksheet-answer-key/. DNA and RNA

n.d. Accessed 9 July 2020

https://www.britannica.com/science/RNA. RNA

n.d. Accessed 9 July 2020

“nucleic acid”. (2014). Retrieved from ://www.nature.com/scitable/definition/nucleic-acid-274
Link

30
For inquiries and feedback, please write or call:

Department of Education – Bureau of Learning Resources (DepEd-BLR)

DepEd Division of Bukidnon

Fortich Street, Sumpong, Malaybalay City
Telefax: (088) 813-3634
E-mail Address: [email protected]

31